A zmexo70c1 protein and application thereof in regulating plant plant height or ear length
By cloning and regulating the expression level of the ZmEXO70C1 protein, the problem of shortened ears caused by plant height regulation in existing technologies was solved, achieving a reduction in maize plant height while maintaining ear length, thereby improving maize yield and lodging resistance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHINA NAT SEED GRP CO LTD
- Filing Date
- 2026-07-06
- Publication Date
- 2026-07-31
AI Technical Summary
In existing technologies, genes that regulate maize plant height often result in shorter ears and fewer kernels, making it difficult to reduce plant height while maintaining ear length, thus affecting maize yield.
By cloning and utilizing the ZmEXO70C1 protein and its encoding gene, and regulating its expression level, plant height was reduced without affecting ear length, thereby increasing maize yield.
While reducing plant height, the ear length remains unchanged, thereby improving the plant's resistance to lodging and yield, and cultivating high-yielding maize varieties.
Smart Images

Figure CN122483167A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant breeding technology, and in particular to a ZmEXO70C1 protein and its application in regulating plant height or spike length. Background Technology
[0002] Maize (Zea mays L.) is one of the world's three major food crops and also an important industrial and livestock raw material. As the leading crop in terms of yield and planted area, maize plays an irreplaceable role in ensuring a stable global food supply. In recent years, with the development of related industrial technologies and the evolution of energy supply demands, maize has gradually transformed from a traditional food crop into a diversified crop with multiple uses, including food, feed, industrial raw material (such as for the production of industrial ethanol), and energy crop. With the continuous development of deep processing industries and the expansion of livestock product production, the global market demand for maize in industrial and feed sectors is rapidly increasing, and the supply and demand relationship of maize is receiving increasing attention. Therefore, further improving the yield and quality of maize has become an urgent technical problem to be solved in this field.
[0003] Biological yield, grain yield, and quality are core target traits in maize genetic breeding. Among these, plant height is closely related to both grain yield and biological yield, serving as a crucial factor in plant architecture and decisively influencing overall plant biomass. Studies have shown that modifying plant architecture can effectively increase maize biomass. Therefore, plant height is not only a vital target trait in maize genetics and breeding research, but in-depth analysis of the genetic basis regulating plant height formation also has significant guiding implications for the breeding of new maize varieties.
[0004] Currently, the functional genes that have been cloned to regulate maize plant height mainly operate through hormonal pathways. These genes regulate plant height through various biological hormone pathways, including homologous genes of Br2, targeting auxin, gibberellin, brassinolide, and others. The main phenotype is dwarfism, which is accompanied by undesirable phenotypes such as ear shortening under certain conditions, thus affecting yield traits.
[0005] The growth and development of maize plant height is a very complex process. Identifying more plant height mutants by utilizing genetic and omics knowledge and further isolating the gene is of great significance for understanding the mechanism of its growth and development, revealing the genetic mechanism of plant height, and breeding new lines with ideal traits. Summary of the Invention
[0006] To address the problems of existing technologies, this invention provides a ZmEXO70C1 protein and its application in regulating plant height or spike length.
[0007] Plant dwarfing can effectively improve lodging resistance, and the reduction of shading between plants after dwarfing allows for increased planting density. However, genes related to plant height often lead to shorter ears and fewer grains. The ZmEXO70C1 gene cloned in this invention, through overexpression, can reduce plant height while maintaining ear length, thereby significantly increasing plant yield and possessing important application value.
[0008] In a first aspect, the present invention provides a ZmEXO70C1 protein, comprising: (1) The amino acid sequence as shown in SEQ ID NO.1; (2) An amino acid sequence that has at least 98%, 95%, 90%, 85%, 80%, 75% or 70% identity with the amino acid sequence shown in (1) and has the same function.
[0009] The amino acid sequence shown in SEQ ID NO.1: .
[0010] Secondly, the present invention provides a nucleic acid for encoding the aforementioned ZmEXO70C1 protein.
[0011] Furthermore, the nucleic acid comprises any of the following nucleotide sequences: (1) A nucleotide sequence as shown in SEQ ID NO.2 or SEQ ID NO.3; (2) The complementary sequence of the nucleotide sequence shown in (1); (3) A nucleotide sequence that has at least 98%, 95%, 90%, 85%, 80%, 75% or 70% identity with the nucleotide sequence shown in (1) or (2) and encodes a protein with the same function.
[0012] The nucleotide sequence (full gene length) shown in SEQ ID NO.2 is as follows:
[0013] The nucleotide sequence (CDS region) shown in SEQ ID NO.3 is as follows:
[0014] Thirdly, the present invention provides a biomaterial comprising: The aforementioned nucleic acid; the biological material is selected from expression cassettes, vectors, cells, recombinant viral particles, tissues or organs.
[0015] The expression cassette of this invention includes a promoter, a coding sequence (corresponding to the nucleotide sequence of the aforementioned nucleic acid), and a termination signal for terminating the transcription process (e.g., including a terminator and a polyadenylation signal). It can also guide the cell to add a poly(A) tail to the end of the mRNA to increase mRNA stability and translation efficiency. Common examples include SV40 polyA and BGHpolyA. Furthermore, various elements can be added to the expression cassette, such as enhancers, introns, Kozak sequences, Shine-Dalgarno sequences, or selectable marker genes.
[0016] The vectors described in this invention include: plasmid vectors (extrachromosomal circular DNA molecules derived from bacteria or yeast), viral vectors (modified viruses that have had their pathogenicity and self-replication capabilities removed, but retain their ability to efficiently infect cells and deliver genetic material into cells), bacteriophage vectors, or artificial chromosome vectors (e.g., bacterial artificial chromosome BAC or yeast artificial chromosome YAC).
[0017] The cells described in this invention are cells whose genetic material has undergone artificial and stable alterations, such as the introduction of the nucleic acids provided in this application. The cells described in this invention include animal cells, plant cells, or microbial cells, wherein the animal and plant cells do not possess the potential to develop into a complete individual (and do not belong to any animal or plant species).
[0018] The recombinant viral particles described in this invention are in the form of virus-like particles, where a protein coat (viral capsid) encapsulates genetic material (such as the aforementioned nucleic acid). For example, the recombinant viral particles are prepared by transfecting the aforementioned viral vector and other helper plasmids into a packaging cell line (such as HEK293T cells), which will complete the expression and assembly of viral proteins and recombinant genes to obtain complete recombinant viral particles.
[0019] Those skilled in the art, having access to the nucleic acid disclosed in this application, are fully aware of the preparation methods of the aforementioned expression cassettes, vectors, cells, and recombinant viral particles based on existing technology. There are no technical obstacles involved, and therefore, expression cassettes, vectors, cells, and recombinant viral particles containing the aforementioned nucleic acid are also within the scope of this invention.
[0020] The tissues or organs described in this invention do not belong to a complete plant individual or plant population, and do not possess population consistency and stability, therefore they do not belong to "plant varieties".
[0021] This invention further provides plants comprising the aforementioned ZmEXO70C1 protein, or the aforementioned nucleic acid, or the aforementioned biological material. Apart from containing the aforementioned ZmEXO70C1 protein, or the aforementioned nucleic acid, or the aforementioned biological material, the plants defined in this invention do not have the same or highly similar genetic background, and therefore do not exhibit consistency and stability in major traits, and are therefore not considered plant varieties.
[0022] Preferably, the plant is obtained through the following means: (1) The ZmEXO70C1 protein, or the nucleic acid, or the biological material is directly introduced into the plant; (2) The plant shown in (1) is obtained by directly hybridizing it with other wild-type plants; (3) Intermediate lines of maize plants as shown in (1) during the process of constructing stable varieties.
[0023] Those skilled in the art will fully understand that plants in the above-mentioned situations do not possess stability and uniformity, and therefore do not belong to "plant varieties".
[0024] Fourthly, the present invention provides a reagent kit comprising: The aforementioned ZmEXO70C1 protein, or the aforementioned nucleic acid, or the aforementioned biological material.
[0025] Fifthly, the present invention provides the application of the aforementioned ZmEXO70C1 protein, or the aforementioned nucleic acid, or the aforementioned biological material, or the aforementioned kit in regulating plant height or spike length.
[0026] Furthermore, by reducing the expression level of the ZmEXO70C1 protein or the nucleic acid in the plant, the plant height is increased; and / or, By increasing the expression level of the ZmEXO70C1 protein or the nucleic acid in the plant, the plant height is reduced, preferably while maintaining the spike length.
[0027] Further, the expression level of the ZmEXO70C1 protein or the nucleic acid is reduced by any one or more methods including gene editing, transcriptional gene silencing, or post-transcriptional gene silencing; and / or, Increase the expression level of the ZmEXO70C1 protein or the nucleic acid in plants using any of the following methods: (1) Increase the copy number of the nucleic acid; (2) Replace the promoter of the nucleic acid; (3) Add enhancers upstream or downstream of the nucleic acid; (4) Optimize the nucleotide sequence of the nucleic acid according to the host type; (5) Modify the ZmEXO70C1 protein by adding a stabilizing tag or signal peptide; Preferably, the gene editing includes: knocking out the nucleic acid using a CRISPR / Cas9, TALEN, or ZFN system; The transcriptional gene silencing includes: suppressing the expression of the nucleic acid by using CRISPR interference or DNA methylation-mediated silencing; The post-transcriptional gene silencing includes: using RNA interference or antisense RNA to reduce the expression of the nucleic acid.
[0028] In a sixth aspect, the present invention provides the use of the aforementioned ZmEXO70C1 protein, or the aforementioned nucleic acid, or the aforementioned biological material, or the aforementioned kit in any of the following: (1) Cultivating transgenic plants; (2) Improvement of plant varieties related to plant height or spike length; (3) Improvement of plant germplasm resources.
[0029] Furthermore, the plant is a monocotyledonous plant or a dicotyledonous plant; Preferably, the plant is a species of the genus *Zea*. More preferably, the plant is corn.
[0030] The present invention has the following beneficial effects: This invention cloned a ZmEXO70C1 protein and its encoding gene. By regulating its expression level, the plant height and ear length traits of maize can be controlled. Specifically, increasing the expression level of this protein reduces plant height while maintaining ear length. The ZmEXO70C1 protein and its encoding gene provided by this invention can be used to breed lodging-resistant and high-yielding maize varieties without affecting ear length, and have significant application value. Attached Figure Description
[0031] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0032] Figure 1 This is provided by the embodiments of the present invention. ZmEXO70C1 A schematic diagram of the gene structure.
[0033] Figure 2 This is the result of the comparison of the original parent promoter region sequences between the two parents provided in the embodiments of the present invention.
[0034] Figure 3 This is the phenotypic comparison result of 42461-KO1 provided in the embodiments of the present invention.
[0035] Figure 4 The statistical results of plant height of 42461-KO1 provided in the embodiments of the present invention are as follows: pH represents plant height. The statistical results of 23HN, 24JL, 25JL and 25HN in different years and locations are as follows.
[0036] Figure 5 This is the phenotypic comparison result of 42461-KO2 provided in the embodiments of the present invention.
[0037] Figure 6 This is the plant height statistical result of 42461-KO2 provided in the embodiment of the present invention.
[0038] Figure 7 These are two embodiments of the present invention. ZmEXO70C1 Comparison of plant height phenotype between gene overexpression lines (42461-OE1 and 42461-OE2).
[0039] Figure 8 These are two embodiments of the present invention. ZmEXO70C1 Statistical results of plant height of gene overexpression lines (OE+1a corresponds to 42461-OE1; OE+1b corresponds to 42461-OE2).
[0040] Figure 9 This is provided by the embodiments of the present invention. ZmEXO70C1 Statistical results of ear length in transgenic materials. Detailed Implementation
[0041] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0042] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.
[0043] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.
[0044] Example 1 1. A Residual In-Loop (RIL) population was constructed by crossing DE3 and BY815 as parents. Seeds were harvested and planted to obtain F1 generation plants. Population analysis revealed a close linkage between the near-isogenic QTL-qPH3 marker and field plant height differences. Five generations of self-pollination were performed on the F1 plants. Based on the agronomic traits of each line and marker screening, a total of 39 residual heterozygous lines containing different residual heterozygous regions of qPH3 were obtained.
[0045] 2. In order to further refine the functional genes of qPH3, five pairs of polymorphic SNP markers were designed in the candidate interval (Table 1). The candidate genes were finally determined to be located between markers 3-68 and 3-49, with a genetic distance of about 25 kb. This range includes two candidate genes, Zm00001d042460 and Zm00001d042461.
[0046] Table 1 Primers used for fine-tuning
[0047] 3. To identify candidate genes, this invention searched for annotations on MaizeGDB and Gramene websites. The results showed that there were two candidate annotated genes in the located interval, among which... Zm00001d042460 It is an ABI3-VP1 family transcription factor gene. Zm00001d042461 Encodes a gene of the EXO70 protein family.
[0048] 4. Expression level analysis of candidate genes showed no difference in the expression level of Zm00001d042460 between the two parents, while the expression level of Zm00001d042461 differed by 5-fold. Therefore, this invention uses Zm00001d042461 as the functional gene for plant height QTL-qPH3. Full-length sequencing of the gene region showed no difference in the exon regions between the two parents; therefore, the difference in the promoter region is considered to be the fundamental reason for the difference in expression levels. The gene structure is as follows... Figure 1 As shown.
[0049] 5. Primers were designed to amplify and sequence the promoter region. The results showed significant differences between the two parents' promoter regions, particularly in the BY815 parent. Zm00001d042461 The promoter region contains deletions of over 800 bp and other small mutations, as shown in the following mutation details. Figure 2 As shown.
[0050] 6. To further verify ZmEXO70C1 Whether genes truly affect plant height is a question explored in this invention using gene editing technology (Cas9) to investigate the effects of genes on plant height in KN5585 and B73. ZmEXO70C1 Gene knockout can be performed, and knockout methods include: (1) The target sequence is CGTCGCGCCGAAGACGCAGGCGG.
[0051] (2) Digest the pCXB053 plasmid with BsaI at 37°C for about 1 hour. Purify and recover the digested product using the DC301 kit. Ligate the target sgRNA sequence with the U6 promoter and ligate the linearized plasmid from the previous step with T4 ligase. After transforming the ligation vector into DH5α bacteria, identify the ligation status by PCR sequencing. Then, transform the vector plasmid into Agrobacterium EHA105 by electroporation and identify it by PCR.
[0052] Using freshly peeled corn embryos (approximately 1 mm in diameter), the embryos were placed in 2 mL plastic centrifuge tubes containing 1.8 mL of suspension. Approximately 150 immature embryos were processed within 30 minutes. The suspension was then removed, leaving the remaining corn embryos in the tubes. 1.0 mL of Agrobacterium suspension was added, and the tubes were incubated for 5 minutes. The embryos in the centrifuge tubes were then resuspended and transferred to a co-culture medium. Excess Agrobacterium suspension was removed from the surface using a pipette, and the embryos were co-cultured in the dark at 23°C for 3 days. After co-culture, the embryos were transferred to resting medium and incubated in the dark at 28°C for 6 days. They were then transferred to selection medium containing diammonium phosphate (DAP) for two weeks of selection culture, followed by two weeks of selection culture on a new selection medium. Resistant callus was transferred to differentiation medium and cultured at 25°C, 5000 lx, under light for 3 weeks. The differentiated seedlings were then transferred to rooting medium and cultured at 25°C, 5000 lx, under light until rooting occurred. The seedlings were then transferred to plug trays for further growth.
[0053] Two mutants, 42461-KO1 and 42461-KO2, with different genetic backgrounds but the same mutation site were finally obtained. Molecular marker detection (forward primer: TCTCCAGTATCTCCTTCTCGGA, reverse primer: ATTGGTTAGTGGAGGCGAGC) showed that the two mutants had the same mutation site and were homozygous mutations with GC deletion (as shown in Table 2).
[0054] Table 2 Editing of CRISPR strains at target sites
[0055] 7. Phenotypic identification of the homozygous lines of these two mutants showed that, after phenotypic testing in three seasons (2023 Hainan, 2024 Jilin, and 2025 Jilin), knocking out this gene under both backgrounds resulted in a significant increase in maize plant height. Figures 3-6 As shown.
[0056] The results showed that the plant height of 42461KO-1 increased from 192.1 cm to 200.9 cm, and the plant height of 42461KO-2 increased from 230.6 cm to 239.7 cm.
[0057] 8. This invention further constructed an overexpression line of this gene in KN5585 material, and identified positive overexpression materials using glufosinate. The method is as follows: The gene was amplified from cDNA or a template using high-fidelity PCR with primers designed with specific restriction enzyme sites (as shown in SEQ ID NO.2). The NEWMOL vector was then linearized by double digestion with the same restriction endonuclease and recovered by agarose gel electrophoresis. Next, the recovered target gene was ligated to the linearized vector. A recombinant plasmid was typically constructed using T4 DNA ligase or homologous recombinase and transformed into competent *E. coli* cells. Positive clones were screened on plates containing the appropriate antibiotics, and colony PCR, restriction enzyme digestion verification, and sequencing were used to ensure the inserted sequence was correct and mutation-free.
[0058] After obtaining the correct recombinant plasmid, it was transferred into Agrobacterium competent cells by electroporation. Agrobacterium-mediated genetic transformation was then used to infect explants of the target plant. Freshly peeled maize embryos (approximately 1 mm in size) were used as material. The peeled maize embryos were placed in 2 ml plastic centrifuge tubes containing 1.8 mL of suspension. Approximately 150 immature embryos were processed within 30 min. The suspension was removed, leaving the maize embryos in the tubes. Then, 1.0 ml of Agrobacterium suspension was added, and the tubes were incubated for 5 min. The embryos in the centrifuge tubes were then resuspended and transferred to a co-culture medium. Excess Agrobacterium suspension on the surface was removed using a pipette, and the tubes were co-cultured in the dark at 23 °C for 3 days. After co-culture, the embryos were transferred to resting medium and incubated in the dark at 28 °C for 6 days. Finally, they were transferred to selection medium containing diammonium phosphate (DAP) for two weeks of selection culture, followed by two weeks of selection culture on a new selection medium. The resistant callus was transferred to differentiation medium and cultured at 25°C, 5000 lx, under light for 3 weeks; the differentiated seedlings were transferred to rooting medium and cultured at 25°C, 5000 lx, under light until rooting occurred; the seedlings were then transferred to plug trays for growth.
[0059] This invention further identified two stable positive overexpression lines using glufosinate. Phenotypic analysis confirmed that overexpression of this gene led to dwarfing of the plant. Specific phenotypes are as follows: Figure 7 and Figure 8 As shown, the plant height of plant OE+1a decreased from 194.2cm to 186.0cm, and the plant height of plant OE+1b decreased from 194.2cm to 186.2cm.
[0060] 9. In addition, this invention also statistically analyzed the spikelet length data of this gene. In CRISPR lines with a B73 background, the spikelet length of positive homozygous events of this gene was significantly higher than that of the wild type. In OE lines with a KN5585 background, there was no significant difference between positive lines of this gene and the wild type. The statistical results are as follows: Figure 9 As shown.
[0061] The results showed that the spike length of CRISPR-1 (42461-KO1) increased by 2.22 cm, while the spike length of 42461-OE1 did not change significantly compared with before overexpression.
[0062] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A ZmEXO70C1 protein, characterized in that, Including the amino acid sequence shown in SEQ ID NO.
1.
2. A nucleic acid, characterized in that, The nucleic acid is used to encode the ZmEXO70C1 protein of claim 1.
3. The nucleic acid according to claim 2, characterized in that, The nucleic acid includes a nucleotide sequence as shown in SEQ ID NO.2 or SEQ ID NO.
3.
4. A biomaterial, characterized in that, include: The nucleic acid as described in claim 2 or 3; the biological material is selected from expression cassettes, vectors, cells, recombinant viral particles, tissues or organs.
5. A reagent kit, characterized in that, include: The ZmEXO70C1 protein of claim 1, or the nucleic acid of claim 2 or 3, or the biomaterial of claim 4.
6. A dwarf plant, characterized in that, include: The ZmEXO70C1 protein of claim 1, or the nucleic acid of claim 2 or 3, or the biomaterial of claim 4; The plant in question is a species of the genus *Zea*.
7. The plant according to claim 6, characterized in that, The plant was obtained through the following means: (1) The ZmEXO70C1 protein, or the nucleic acid, or the biological material is directly introduced into the plant; (2) The plant shown in (1) is obtained by directly hybridizing it with other wild-type plants; (3) Intermediate lineage of the plant shown in (1) in the process of constructing a stable variety.
8. The application of the ZmEXO70C1 protein of claim 1, or the nucleic acid of claim 2 or 3, or the biological material of claim 4, or the kit of claim 5 in regulating plant height or spike length; The plant in question is a species of the genus *Zea*.
9. The application according to claim 8, characterized in that, Increase plant height by reducing the expression level of the ZmEXO70C1 protein or the nucleic acid in the plant; and / or, By increasing the expression level of the ZmEXO70C1 protein or the nucleic acid in the plant, the plant height is reduced while the spike length is not reduced.
10. The use of the ZmEXO70C1 protein of claim 1, or the nucleic acid of claim 2 or 3, or the biological material of claim 4, or the kit of claim 5, in any of the following: (1) Cultivating transgenic plants; (2) Improvement of plant varieties related to plant height or spike length; (3) Improvement of plant germplasm resources; The plant in question is a species of the genus *Zea*.