Nanobodies for targeted detection of vibrio parahaemolyticus virulence proteins in shrimp glass shrimp and detection products thereof

CN122483189BActive Publication Date: 2026-09-04SANYA INST OF OCEANOGRAPHY OCEAN UNIV OF CHINA +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610976229.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-07-02
Publication Date
2026-09-04
Estimated Expiration
2046-07-02

AI Technical Summary

Technical Problem

[0004]尽管目前针对TPV的流行病学、病原学及毒力机制已有一定研究进展,但针对其关键致病因子的特异性识别分子仍较为缺乏,这使得TPV在苗种生产过程中的早期预警、快速检测仍受到较大限制

Benefits of technology

本申请通过对对虾玻璃虾苗的致病弧菌(副溶血性弧菌)的氨基酸进行结构预测,截取核心表位片段基因后进行重组质粒构建和蛋白表达纯化,并采用噬菌体展示技术,分别从羊驼来源和鲨鱼来源的天然噬菌体库中筛选得到抗VHVP-1纳米抗体、抗VHVP-2纳米抗体和抗VHVP-3纳米抗体,再次利用原核表达体系进行生产,从而找到了高亲和力的抗VHVP-1纳米抗体、抗VHVP-2纳米抗体和抗VHVP-3纳米抗体,降低生产和研发成本。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122483189B_ABST
    Figure CN122483189B_ABST
Patent Text Reader

Abstract

The application discloses a nano antibody for targeted detection of Vibrio parahaemolyticus virulence protein of glass shrimp and a detection product thereof, the amino acid sequence of the nano antibody is SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22 or SEQ ID NO. 23, the nano antibody can specifically recognize VHVP-1 protein, VHVP-2 protein and VHVP-3 protein, and can rapidly and specifically detect whether shrimp and other aquatic animals, aquaculture water, aquaculture feed or fresh bait are infected with TPV virus and the like, so that the effective prevention and efficient monitoring of the epidemic disease in shrimp aquaculture production are realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of virus detection technology, specifically to a nanobody for targeted detection of Vibrio parahaemolyticus virulence protein in shrimp glass seedlings and its detection product. Background Technology

[0002] Translucent post-larva vibriosis (TPV) is a bacterial disease in shrimp caused by Vibrio parahaemolyticus. Because infected individuals appear completely transparent like glass, it is also known as "glass seedling" disease by shrimp farmers. This disease has a rapid onset and extremely high mortality rate, causing devastating damage to shrimp larvae production. Infected Litopenaeus vannamei exhibit typical clinical symptoms, primarily pale and atrophied hepatopancreas and an empty digestive tract. This causes diseased individuals to lose normal pigmentation and contents, resulting in a transparent appearance. Pathological studies show that infection with the pathogen VpTPV can induce specific histopathological changes, manifested as necrosis and shedding of hepatopancreatic tubules and midgut epithelial cells. This pathological feature shares several similarities with another important shrimp disease—acute hepatopancreatic necrosis disease (AHPND). However, compared with the strain that causes acute hepatopancreatic necrosis, VpTPV is more toxic to Litopenaeus vannamei, causing faster and more complete death, thus posing a continuous and serious threat to my country's shrimp breeding industry.

[0003] Existing research indicates that the highly virulent phenotype of TPV-associated highly pathogenic Vibrio is closely related to the multiple key virulence factors it carries. Based on the subjects of this study and existing research, the main pathogenic factors associated with VpTPV can be summarized as VHVP-1, VHVP-2, and VHVP-3, all of which are considered to be closely related to the TPV pathogenic process and are important virulence molecules that mediate the pathogen's infection of the host, damage to the hepatopancreas and intestinal tissue structure, and ultimately lead to high mortality in shrimp. Among them, VHVP-1 mainly acts as a receptor binding and transport component of the toxin complex, and its TcA and other structural domains are responsible for recognizing receptors on the surface of host cells; VHVP-2 is the core virulence factor causing shrimp mortality, with a structure similar to bacterial insecticide toxins (TcdB); VHVP-3 usually acts as an effector component of the toxin complex (similar to TcC), and together with VHVP-1 and VHVP-2, it constructs a complete toxin system, synergistically mediating pathological damage to host cells. The three virulence factors mentioned above are not only key targets in the study of the pathogenesis mechanism of VpTPV, but also an important molecular basis for the rapid detection of pathogens.

[0004] Although some progress has been made in the epidemiology, etiology, and virulence mechanisms of TPV, specific recognition molecules targeting its key pathogenic factors are still lacking. This significantly limits the early warning and rapid detection of TPV in seedling production. Existing detection methods, such as qPCR and nested PCR, rely heavily on laboratory equipment and specialized operations, resulting in relatively long detection cycles, which are not conducive to rapid screening and immediate assessment at the seedling production site.

[0005] Nanobodies possess advantages such as small size, high affinity, strong stability, low preparation cost, and ease of engineering modification. Colloidal gold immunochromatographic test strips, on the other hand, offer advantages such as ease of operation, rapid detection, intuitive results, and convenient on-site use, making them particularly suitable for the on-site detection needs of grassroots production environments such as shrimp hatcheries and aquaculture farms. Constructing colloidal gold immunochromatographic test strips containing nanobodies targeting VHVP-1, VHVP-2, and VHVP-3 would not only facilitate the rapid identification of the main pathogenic factors of TPV, but also provide a practical technical means for the early diagnosis, pathogen detection, and continuous monitoring of this disease, possessing significant application value and practical significance. Summary of the Invention

[0006] The purpose of this invention is to find high-affinity anti-VHVP-1 nanobodies, anti-VHVP-2 nanobodies, and anti-VHVP-3 nanobodies to specifically recognize VHVP-1, VHVP-2, and VHVP-3 proteins, respectively. This enables rapid and specific detection of whether shrimp and other aquaculture animals, aquaculture water, aquaculture feed, or live bait are infected with TPV virus, thus solving the problem of effective prevention and efficient monitoring of diseases in shrimp farming.

[0007] To solve this technical problem: This application provides a nanobody for targeted detection of Vibrio parahaemolyticus virulence protein in shrimp glass seedlings. The amino acid sequence of the nanobody is SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22 or SEQ ID NO.23.

[0008] Furthermore, the amino acid sequence of the anti-VHVP-1 nanobody is SEQ ID NO.18 or SEQ ID NO.21.

[0009] Furthermore, the anti-VHVP-1 nanobody is used to detect the virulence protein of Vibrio parahaemolyticus, which is the VHVP-1 protein. The nucleotide sequence of the gene encoding the VHVP-1 protein is shown in SEQ ID NO.1.

[0010] Furthermore, SEQ ID NO.18 is of alpaca origin; SEQ ID NO.21 is of shark origin.

[0011] Furthermore, the amino acid sequence of the anti-VHVP-2 nanobody is SEQ ID NO.19 or SEQ ID NO.22.

[0012] Furthermore, the anti-VHVP-2 nanobody is used to detect the virulence protein of Vibrio parahaemolyticus, which is the VHVP-2 protein. The nucleotide sequence of the gene encoding the VHVP-2 protein is shown in SEQ ID NO.2.

[0013] Furthermore, SEQ ID NO.19 is of alpaca origin; SEQ ID NO.22 is of shark origin.

[0014] Furthermore, the amino acid sequence of the anti-VHVP-3 nanobody is SEQ ID NO.20 or SEQ ID NO.23.

[0015] Furthermore, the anti-VHVP-3 nanobody is used to detect the virulence protein of Vibrio parahaemolyticus, which is the VHVP-3 protein. The nucleotide sequence of the gene encoding the VHVP-3 protein is shown in SEQ ID NO.3.

[0016] Furthermore, SEQ ID NO.20 is of alpaca origin; SEQ ID NO.23 is of shark origin.

[0017] This application also provides a shrimp glass larvae detection product including the above-mentioned nanoantibodies.

[0018] Furthermore, the products for testing shrimp larvae using glass substrate include reagents, test strips, or kits.

[0019] Furthermore, the test strips include immunochromatographic test strips prepared using any one of the labeling technologies: colloidal gold labeling, colloidal carbon labeling, fluorescent microsphere labeling, and nanoparticle labeling.

[0020] Furthermore, the shrimp glass larvae testing products include a first antibody combination, a second antibody combination, or a third antibody combination.

[0021] Furthermore, the first antibody combination is used to specifically recognize the VHVP-1 antigen protein. The first antibody combination consists of: a rabbit polyclonal antibody as the first gold-labeled antibody, a first T-line antibody with the amino acid sequence SEQ ID NO.18, and a goat anti-rabbit antibody as the first C-line antibody.

[0022] Furthermore, the second antibody combination is used to specifically recognize the VHVP-2 antigen protein. The second antibody combination consists of: a rabbit polyclonal antibody as the second gold-labeled antibody, a second T-line antibody with the amino acid sequence SEQ ID NO.19, and a goat anti-rabbit antibody as the second C-line antibody.

[0023] Furthermore, the third antibody combination is used to specifically recognize the VHVP-3 antigen protein. The third antibody combination consists of: a rabbit polyclonal antibody as the third gold standard antibody, a third T-line antibody with the amino acid sequence SEQ ID NO.23, and a goat anti-rabbit antibody as the third C-line antibody.

[0024] Compared with existing technologies, the nanobody and its detection product for targeted detection of Vibrio parahaemolyticus virulence protein in shrimp glass seedlings provided in this application have the following beneficial technical effects: This application predicts the amino acid structure of pathogenic Vibrio parahaemolyticus in shrimp larvae, extracts the core epitope gene fragment, constructs recombinant plasmids, and expresses and purifies the protein. Using phage display technology, anti-VHVP-1, anti-VHVP-2, and anti-VHVP-3 nanobodies were screened from natural phage libraries derived from alpacas and sharks, respectively. These nanobodies were then produced using a prokaryotic expression system, thus identifying high-affinity anti-VHVP-1, anti-VHVP-2, and anti-VHVP-3 nanobodies and reducing production and R&D costs.

[0025] The detection product for shrimp larvae developed in this application utilizes the principle of antigen-antibody interaction and combines immunochromatography and colloidal gold technology to prepare test strips that specifically recognize VHVP-1, VHVP-2, or VHVP-3 proteins of TPV virus. These strips can rapidly detect whether shrimp and other aquaculture animals are infected with TPV virus within 10 minutes, whether the aquaculture water contains TPV virus, or whether aquaculture feed and live bait are contaminated with TPV virus. This solves the problem of effective prevention and efficient monitoring of diseases in shrimp farming, lays the foundation for rapid detection of TPV virus, and can provide a reference model for early detection of pathogens in other farmed animals, demonstrating broad applicability. Attached Figure Description

[0026] The above description of the present invention and the following detailed embodiments will be better understood when read in conjunction with the accompanying drawings. It should be noted that the drawings are merely examples of the claimed technical solutions.

[0027] Figure 1The diagram shows the hydrophilicity and hydrophobicity analysis of VHVP proteins in the examples (where the horizontal axis represents position, the vertical axis represents fraction, A represents VHVP-1 protein, B represents VHVP-2 protein, and C represents VHVP-3 protein). Figure 2 The example shows the predicted secondary structure of the VHVP-1 candidate large fragment protein (where A represents the sequence information of the VHVP-1 candidate large fragment protein, and BC represents different representations of the two-dimensional structure distribution of the VHVP-1 candidate large fragment protein). Figure 3 The example shows the predicted secondary structure of the VHVP-2 candidate large fragment protein (where A represents the sequence information of the VHVP-2 candidate large fragment protein, and BC represents different representations of the two-dimensional structure distribution of the VHVP-2 candidate large fragment protein). Figure 4 The example shows the predicted secondary structure of the VHVP-3 candidate large fragment protein (where A represents the sequence information of the VHVP-3 candidate large fragment protein, and BC represents different representations of the two-dimensional structure distribution of the VHVP-3 candidate large fragment protein). Figure 5 The above is a prediction of the candidate large fragment antigenic epitope region for VHVP in the example (where the horizontal axis is the position, the vertical axis is the fraction, A is VHVP-1 protein, B is VHVP-2 protein, and C is VHVP-3 protein). Figure 6 The image shows an agarose gel electrophoresis image of the first PCR amplification product in the example (where M is the marker, 1 is the first PCR amplification product of the VHVP-1 epitope gene, 2 is the first PCR amplification product of the VHVP-2 epitope gene, 3 is the first PCR amplification product of the VHVP-3 epitope gene, and 4 is the pET-28a linearized vector). Figure 7 The image shown is an agarose gel electrophoresis image of the second PCR amplification product in the example (where M is the marker, 1 is the second PCR amplification product of VHVP-1, 2 is the second PCR amplification product of VHVP-2, and 3 is the second PCR amplification product of VHVP-3). Figure 8 The above are SDS-PAGE images of VHVP-1 epitope protein prokaryotic expression in the examples (where M is the marker, 1 is the first expansion culture of VHVP-1, 2 is the first induction culture of VHVP-1, 3 is the inclusion body of VHVP-1, 4 is the flow-through fluid (FT) of VHVP-1, 5 is the 20 mM imidazole washed protein of VHVP-1, 6 is the 40 mM imidazole washed protein of VHVP-1, 7 is the VHVP-1 protein, and 8 is the 1 M imidazole washed protein of VHVP-1). Figure 9The image shows an SDS-PAGE diagram of VHVP-2 epitope protein expressed in prokaryotes in the example (where M is the marker, 1 is the bacterial culture after the first induction of VHVP-2, 2 is the inclusion body of VHVP-2, 3 is the flow-through fluid (FT) of VHVP-2, 4 is the 20 mM imidazole washed protein of VHVP-2, 5 is the 40 mM imidazole washed protein of VHVP-2, 6 is the VHVP-2 protein, and 7 is the 1 M imidazole washed protein of VHVP-2). Figure 10 The image shows the SDS-PAGE of VHVP-3 epitope protein expressed in prokaryotes in the examples (where M is the marker, 1 is the first expansion culture of VHVP-3, 2 is the first induction culture of VHVP-3, 3 is the inclusion body of VHVP-3, 4 is the flow-through filtrate of VHVP-3 (FT), 5 is the 20 mM imidazole washed protein of VHVP-3, 6 is the 40 mM imidazole washed protein of VHVP-3, 7 is the VHVP-3 protein, and 8 is the 1 M imidazole washed protein of VHVP-3). Figure 11 This is a standard curve for BCA protein concentration determination in the examples; Figure 12 The image shows the Western blot identification results of the antigen proteins in the examples (where M is the marker, 1 is the VHVP-1 antigen protein, 2 is the VHVP-2 antigen protein, and 3 is the VHVP-3 antigen protein). Figure 13 This is a graph showing the binding of 96 phage clones to the VHVP epitope protein identified by phage ELISA in this example (where the horizontal axis represents the phage clone number and the vertical axis represents the phage clone at OD). 450 Absorbance value at nm; A is VHVP-1 phage, B is VHVP-2 phage, C is VHVP-3 phage). Figure 14 The image shows the alignment results of positive clones in the example (where A is the vNAR screening alignment, B is the VHH screening alignment result, and the black box area is the CDR3 region of the nanobody). Figure 15 The following is an SDS-PAGE electrophoresis image of VHH nanobody expression and purification in the example (where A is VHH-VHVP-1, B is VHH-VHVP-2, C is VHH-VHVP-3; M is Marker, 1 is the third expansion culture, 2 is the fourth induction culture, 3 is the supernatant after sonication, 4 is the flow-through buffer (FT), 5 is 20 mM imidazole washed protein, 6 is 40 mM imidazole washed protein, 7 is 80 mM imidazole washed protein, and 8 is VHH nanobody). Figure 16The following is an SDS-PAGE electrophoresis image of vNAR nanobody expression and purification in the examples (where A is vNAR-VHVP-1, B is vNAR-VHVP-2, C is vNAR-VHVP-3; M is Marker, 1 is the third expansion culture, 2 is the fourth induction culture, 3 is the precipitate after sonication, 4 is the flow-through buffer (FT), 5 is 20 mM imidazole washed protein, 6 is 40 mM imidazole washed protein, 7 is 80 mM imidazole washed protein, 8 is 200 mM imidazole washed protein, and 9 is vNAR nanobody). Figure 17 The images show the SDS-PAGE and Western blot identification results of the nanobodies in the examples (where M is the marker, A is the SDS-PAGE result of the nanobodies, 1 is VHH-VHVP-1 nanobody, 2 is VHH-VHVP-2 nanobody, 3 is VHH-VHVP-3 nanobody, 4 is vNAR-VHVP-1 nanobody, 5 is vNAR-VHVP-2 nanobody, 6 is vNAR-VHVP-3 nanobody; B is the Western blot identification result of the VHH nanobody, 1 is VHH-VHVP-1 nanobody, 2 is VHH-VHVP-2 nanobody, 3 is VHH-VHVP-3 nanobody; C is the Western blot identification result of the vNAR nanobody, 1 is vNAR-VHVP-1 nanobody, 2 is vNAR-VHVP-2 nanobody, 3 is vNAR-VHVP-3 nanobody). Figure 18 This is an ELISA affinity verification graph for VHH and vNAR nanobodies in the examples (where the horizontal axis represents antibody concentration, in units of [log[]). 10 [(μg / μL)], with OD as the ordinate. 450 Absorbance values ​​at nm; A is the comparison between VHH nanobody and vNAR nanobody of VHVP-1, B is the comparison between VHH nanobody and vNAR nanobody of VHVP-2, and C is the comparison between VHH nanobody and vNAR nanobody of VHVP-3. Figure 19 The diagram shows the docking of the nanobody with the antigen protein in the example (where the white area is the main body of the nanobody, the red area is the CDR3 of VHH; the blue area is the CDR3 of vNAR; A and B represent docking with VHVP-1; C and D represent docking with VHVP-2; E and F represent docking with VHVP-3). Figure 20 The image shows the ultraviolet absorption spectrum of the colloidal gold solution in the examples; Figure 21 This is a structural diagram of the colloidal gold test strip in the embodiment; Figure 22 The graphs show the specificity test results of the colloidal gold test strip in Test Example 2 (where A, B, and C correspond to the specificity test results of VHVP-1, VHVP-2, and VHVP-3 test strips, respectively). Figure 23 The graph shows the sensitivity test results of the colloidal gold test strip in Test Example 3 (where A, B, and C correspond to the sensitivity test results of VHVP-1, VHVP-2, and VHVP-3 test strips, respectively). Figure 24 The amplification curves of the TPV-VHVP-2 recombinant plasmid in Test Example 4 are shown below (where A is the amplification curve of the TPV-VHVP-2 recombinant plasmid, with the x-axis representing the cycle number and the y-axis representing the normalized fluorescence signal value after baseline subtraction; B is the standard curve of the TPV-VHVP-2 recombinant plasmid, with the x-axis representing logarithmic fluorescence signal). 10 (Copy count, with the vertical axis representing the Ct value); Figure 25 The actual sample test results of the colloidal gold test strip in Test Example 4 are shown (where wells 1, 2, and 3 correspond to the actual sample test results of VHVP-1, VHVP-2, and VHVP-3 test strips, respectively; AC corresponds to the three shrimp confirmed to be infected by RT-PCR; and DI is the negative control, i.e., the six shrimp confirmed not to be infected by RT-PCR). Detailed Implementation

[0028] The detailed features and advantages of this application are described below in the specific embodiments. The content of this description is sufficient to enable any person skilled in the art to understand the technical content of this application and implement it accordingly. Based on the specification, claims and drawings disclosed in this specification, a person skilled in the art can easily understand the related objectives and advantages of this application.

[0029] In this specification and claims, several terms will be used, and unless otherwise indicated, these terms will be defined to have the following meanings: All other terms used herein for special definition are intended to have the general meaning understood by one of ordinary skill in the art, in particular, meaning that one of ordinary skill in the art can directly and without doubt determine how the technical solution of this application can be implemented after reading the claims, description and drawings of this application.

[0030] Even if there are incomplete descriptions, omissions, or ambiguities in the grammar, words, punctuation, graphics, symbols, etc. of the claims, description, and drawings of this application, those skilled in the art can still arrive at the only correct understanding by reading the claims, description, and drawings as a whole without extensive reasoning or experimentation, and effectively exclude various incorrect interpretations that are not aimed at achieving the purpose of this application.

[0031] The terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of that feature. In the description of this invention, "a plurality of" means at least two, such as two, three, etc., unless otherwise explicitly specified.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0033] To make the objectives, technical solutions, and advantages of the present invention clearer, the embodiments of the present invention will be further described in detail below with reference to the accompanying drawings. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0034] (1) Source of sample materials Camel Source Natural Library was purchased from Shenzhen Kangti Life Technology Co., Ltd.

[0035] The shark natural library was obtained by the method described in the patent document with publication number CN119638825A.

[0036] Upstream and downstream primer synthesis and sequencing: carried out by Sangon Biotech (Shanghai) Co., Ltd., hereinafter referred to as Sangon.

[0037] (2) Sources of reagents and consumables Agar powder, 20 PBS, isopropyl thio-β-D-galactoside, bovine serum albumin (BSA), and single-component TMB chromogenic solution were purchased from Solarbio; ampicillin, sodium chloride, imidazole, 10× Tris-Glycine SDS-PAGE electrophoresis buffer, trypsin, 10% AEBSF, Tris, sucrose, Tween 20, and trisodium citrate dihydrate were purchased from Shanghai Sangon Biotech; tryptone and yeast extract were purchased from Oxoid; Ni-NTA and PD-10 desalting columns were purchased from Cytiva; DL2000 Plus DNA Marker, DL5000 DNA Marker, ChamQSYBR qPCR Master Mix, ClonExpress MultiS One Step Cloning Kit, and DH5α chemocompetent cells were purchased from Novizan; GL DNA Marker 10000 was purchased from Aikerui Biotechnology; 5× loading buffer, trichromatic pre-stained protein markers 10-180 kDa, and trichromatic pre-stained protein markers 10-250 kDa were also purchased. kDa and Omni-Easy™ one-step PAGE gel rapid preparation reagents were purchased from Shanghai Yamei; SDS-PAGE gel rapid staining solution was purchased from Absci; ultrafiltration tubes were purchased from Merck Millipore; BCA kit, agarose gel DNA recovery kit, skim milk powder, goat anti-rabbit IgG (HRP), and HRP-labeled mouse anti-HIS monoclonal antibody were purchased from Beyotime; Bis-Tris 10% high-resolution precast gel (Bis-Tris), Precast Running Buffer, 2L (Powder) denaturing protein precast gel buffer (powder) were purchased from Yisheng; marine animal tissue genomic DNA extraction kit and BL21 (DE3) competent cells were purchased from Tiangen; M13KO7 Helper phage and T4 DNA ligase were purchased from NEB; dog shark peripheral blood lymphocyte isolation kit was purchased from Haoyang Biotechnology; Anti-M13 Antibody (HRP) and Mouse Monoclonal Mab were purchased from Beijing Yiqiao Shenzhou; Sartorius CN140 was purchased from Sartorius; chloroauric acid was purchased from Shanghai Test; K2CO3 was purchased from Maclean's; immunization tubes and immunization tube caps were purchased from Baroque; plastic cartridges, fiberglass, absorbent pads, and base plates were purchased from Hangzhou Fenghang.

[0038] (3) Source of instruments and equipment Snowflake ice maker and ultrasonic cell disruptor were purchased from Xinzhi; constant temperature metal bath was purchased from Youning; decolorizing shaker and rotary mixer were purchased from Qilinbeier; multifunctional microplate reader and plate washer were purchased from Bio Tek; protein purification system and protein electrophoresis system were purchased from Bio-Rad; centrifuge was purchased from Beckman; ultrapure water preparation system was purchased from Merk Millipore; gel imaging system was purchased from Analytick Jena ChemoStudio; vertical pressure steam sterilizer was purchased from Yamato; electronic balance was purchased from Ohaus; ultra-low temperature freezer, medical refrigerator / freezer, clean bench, and liquid nitrogen tank were purchased from Haier; constant temperature shaking incubator and electric thermostatic incubator were purchased from Zhicheng; PCR instrument was purchased from Thermo Fisher; real-time fluorescence quantitative PCR instrument was purchased from Analytickjena; and membrane streaking and gold labeling machine, programmable strip cutter, wide strip cutter, plate shelling machine, and membrane streaking and gold labeling machine were purchased from Hangzhou Fenghang.

[0039] (4) The solutions required for the experiment and their preparation methods LB liquid medium: 1% (w / v) tryptone, 0.5% (w / v) yeast extract, 1% (w / v) NaCl, sterilized at 121°C for 20 min; LB solid medium: 1% (w / v) tryptone, 0.5% (w / v) yeast extract, 1% (w / v) NaCl, 1.5% (w / v) agar powder, sterilized at 121°C for 20 min; 10×SDS-PAGE electrophoresis buffer: 250 mM Tris-HCl, 2.5 M glycine, 1% (w / v) SDS; TBS: 10 mM Tris-HCl, pH 8.0, 150 mM NaCl; TBST: 10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% Tween20; Blocking solution: 5% skim milk powder dissolved in TBST; Electroporation buffer: 25 mM Tris-HCl, 192 mM glycine, 20% methanol, freshly prepared and pre-cooled before use; PBST: 20 PBS buffer diluted 20-fold to 1 Add 0.1% Tween20 to PBS; Primary antibody: mouse monoclonal antibody, diluted 1:3000 with blocking buffer; Secondary antibody: Goat anti-mouse antibody, diluted 1:5000 with blocking buffer; 2×YT liquid culture medium: NaCl 0.5 g, 1.6 g Tryptone, 1 g Yeast Extract, dissolved in an appropriate amount of double deionized water (ddH2O), after complete dissolution, bring the volume to 100 mL, autoclave at 121℃ for 20 min, and store at 4℃ for later use. 2×YT solid medium (Amp): Dissolve 0.5 g NaCl, 1.6 g Tryptone, 1 g Yeast Extract, and 1.5 g Agarose B in an appropriate amount of ddH2O. After complete dissolution, bring the volume to 100 mL. Autoclave at 121℃ for 20 min. When the medium temperature drops to about 50℃, add Amp (100 μg / mL), plate the medium, and store it upside down at 4℃ after the medium solidifies. 2×YT solid medium (Tet): Dissolve 0.5 g NaCl, 1.6 g Tryptone, 1 g Yeast Extract, and 1.5 g Agarose B in an appropriate amount of ddH2O. After complete dissolution, bring the volume to 100 mL. Autoclave at 121℃ for 20 min. When the medium temperature drops to about 50℃, add Tet (10 μg / mL), plate the medium, and store it upside down at 4℃ after the medium solidifies. Ampicillin (stock solution): Accurately weigh 2.5 g of ampicillin into a 50 mL centrifuge tube, add 40 mL of sterile water, mix thoroughly to dissolve, and bring the volume to 50 mL. Filter the solution through a 0.22 μm filter membrane for sterilization, dispense (1 mL / tube), and store at -20℃. Kanamycin (stock solution): Accurately weigh 2.5 g of kanamycin into a 50 mL centrifuge tube, add 40 mL of sterile water, mix thoroughly to dissolve, and bring the volume to 50 mL. Filter the solution through a 0.22 μm filter membrane for sterilization, dispense (1 mL / tube), and store at -20℃. Tetracycline (stock solution): Accurately weigh 2.5 g of tetracycline into a 50 mL centrifuge tube, add 40 mL of anhydrous ethanol, mix thoroughly to dissolve, and then bring the volume up to 50 mL. Filter the solution through a 0.22 μm filter membrane for sterilization, dispense (1 mL / tube), and store at -20℃. CBS: 3.03 g Na2CO3, 6.0 g NaHCO3, add 1 L of sterile water, dissolve and store at 4℃; 0.2 M K2CO3 aqueous solution: Accurately weigh 0.2764 g of anhydrous potassium carbonate powder and add purified water to 10 g; 10% BSA solution: Accurately weigh 1 g of bovine serum albumin powder and add purified water to make 10 g; Gold complex solution: Accurately weigh 0.1 g bovine serum albumin powder and 0.2 g sucrose, pipette 250 μL pH8.0 Tris-HCl and 10 μL Tween20, and then add purified water to 10 g; Gold diluent: Accurately weigh 0.2 g bovine serum albumin powder and 0.5 g sucrose, take 250 μL of pH 8.0 Tris-HCl and 10 μL of Tween 20, and then add purified water to 10 g; Gold Label Pad Treatment Solution: Weigh 5 g BSA powder and 5 g sucrose, pipette 10 μL Tween20, and then add purified water to make up to 100 g; Sample pad treatment solution: Weigh 1 g BSA powder and 1 g sucrose, pipette 10 μL Tween20, and then add purified water to make up to 100 g.

[0040] Example This application provides a nanobody targeting the virulence protein of Vibrio parahaemolyticus in shrimp glassy seedlings and its detection product, comprising the following steps: The expression and purification of S1, VHVP-1, VHVP-2, and VHVP-3 antigen proteins are detailed below: 1. Structural prediction and antigenic epitope assessment The structures of the main pathogenic factors of vibrio vulnificus in shrimp, VHVP-1 (GenBank: WP_269169668.1), VHVP-2 (GenBank: APX09935.1), and VHVP-3 (GenBank: KIT24301.1), were predicted based on the amino acid sequences of these factors, which are already indexed in GenBank by NCBI. The bioinformatics software analysis tools are shown in Table 1.

[0041] Table 1 Bioinformatics Software Analysis Tools ;

[0042] Given that the core virulence proteins VHVP-1, VHVP-2, and VHVP-3 of *TPV* pathogenic bacteria in shrimp are all high molecular weight proteins (VHVP-1 predicted molecular weight is 283.37 kDa, VHVP-2 predicted molecular weight is 161.34 kDa, and VHVP-3 predicted molecular weight is 106.6 kDa), direct in vitro recombinant expression of the full-length gene is prone to inclusion body formation, leading to protein insolubility, and may also mask key neutralizing antigenic determinants due to steric hindrance. Therefore, truncated expression is performed, and highly immunogenic fragments are screened using bioinformatics methods.

[0043] (1) The physicochemical properties of the substance were analyzed using ProtParam online software. The analysis included parameters such as molecular formula, relative molecular mass, amino acid composition and theoretical isoelectric point. The hydrophilicity and hydrophobicity of the substance were analyzed using ProtScale online software. The existence of transmembrane regions was predicted using TMHMM2.0 online software. The signal peptide was predicted and analyzed using SignalP 5.0 Server.

[0044] Based on the analysis results of Prot Param and Prot Scale, the physicochemical properties and hydrophilicity / hydrophobicity of the full-length amino acid sequences of the three large proteins were evaluated, as shown in Table 2. Figure 1 As shown, highly hydrophobic segments that are prone to causing recombinant protein precipitation were excluded. Combining the prediction results of TMHMM 2.0 and Signal P 5.0, several candidate large fragments located on the extracellular side of the protein and with good hydrophilicity were preliminarily identified.

[0045] Table 2 Predicted physicochemical properties of VHVP-1, VHVP-2, and VHVP-3 proteins ;

[0046] (2) Subsequently, the secondary structure of the above three proteins was predicted using SOPMA software, and the proportion of each structural component was analyzed to identify highly hydrophilic and highly flexible candidate regions.

[0047] The results are as follows Figure 2-4 As shown, secondary structure prediction of the amino acid sequence of the candidate large fragment of VHVP-1 protein revealed that random coils accounted for 69.32% of the secondary structure in this region, α-helices accounted for 18.75%, and extended chains accounted for 11.93%. Figure 2 The results of the candidate large fragments of the VHVP-2 protein showed that random coils accounted for 57.29% of the secondary structure in this region, α-helices accounted for 21.67%, and extended chains accounted for 21.04%. Figure 3 In the candidate large fragment results for VHVP-3 protein, random coils accounted for 63.71%, α-helices for 22.16%, and extended chains for 14.13%. Figure 4 Therefore, the focus is on extracting flexible regions with a high proportion of random coils and β-turns from each candidate protein fragment to determine the range for subsequent epitope prediction.

[0048] (3) Based on the highly hydrophilic and highly flexible candidate regions initially identified in step (2), the SWISS-MODEL online software was used to predict the tertiary structure of this region, and the template with the highest sequence similarity was selected for homology modeling. The Bepipred Linear Epitope Prediction 2.0 was used to predict the antigenic epitopes of the target protein, and amino acid residues above the default threshold of 0.5 were used as potential epitope sites. Candidate antigenic epitope regions were screened by combining continuity, surface accessibility and protein structural characteristics.

[0049] The results are as follows Figure 5 As shown, after removing structurally masked regions and low antigenic index regions, the core antigenic determinant clusters with dense scoring peaks and high exposure in three-dimensional space were located. Finally, two core epitope fragments with immunogenic potential were successfully extracted from the preferred region of the VHVP-1 protein: nucleotide sequences 3348 to 3822 (corresponding to amino acid residues 1116 to 1274) and nucleotide sequences 4941 to 5532 (corresponding to amino acid residues 1647 to 1844) of the VHVP-1 gene were tandemly constructed. A linker sequence (G4S)3 was added between the two tandem VHVP-1 epitope gene segments. This was done to enable the fusion protein to fold independently, enhance the conformational flexibility of the fusion protein, and improve the accessibility of the antigenic epitope, ultimately yielding the VHVP-1 epitope region gene SEQ ID NO.1, totaling 915 bp.

[0050] A core epitope fragment was extracted from the VHVP-2 protein, namely the nucleotide sequence from position 1923 to position 3012 of the VHVP-2 gene (corresponding to amino acid residues from position 641 to position 1004), as the target gene for the VHVP-2 antigenic epitope. The VHVP-2 epitope region gene SEQ ID NO.2 was finally obtained, totaling 1092 bp.

[0051] A core epitope fragment was extracted from the VHVP-3 protein, namely the nucleotide sequence from position 2160 to position 2883 of the VHVP-3 gene (corresponding to amino acid residues from position 720 to position 961), as the target gene for the VHVP-3 antigenic epitope. The VHVP-3 epitope region gene SEQ ID NO.3 was finally obtained, totaling 726 bp.

[0052] 2. Constructing recombinant plasmids (1) Using the publicly available VpTPV plasmid (reference: Development and a TaqMan probe-based qPCR assay for Vibrio parahaemolyticus causing translucent post-larvaedisease (TPD) detection in Litopenaeus vannamei, Journal of Invertebrate Pathology, 2026, 216: 108574.) as a template, specific primers were designed based on the VHVP-1, VHVP-2 and VHVP-3 epitope regions obtained in step 1 above using Primer Premier 5.0 software. Since SEQ ID NO.1 is composed of two sequence segments, two pairs of primers were designed. At the same time, linearization primers were designed using the commercially available pET-28a vector. The primer sequences are shown in Table 3.

[0053] Table 3. Primer sequence list for PCR amplification ;

[0054] (2) Using the epitope region genes (SEQ ID NO.1~SEQ ID NO.3) and pET-28a vector obtained in step 1 above as template DNA, the first round of PCR reaction was performed using the primers in step (1) above. SEQ ID NO.1 is a conventional two-step PCR reaction.

[0055] The first round of PCR reaction system consisted of: 1 μL template DNA, 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 25 μL 2×Phanta Max Master Mix, and ddH2O to a final volume of 50 μL.

[0056] The first round of PCR reaction procedure was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, a total of 30 cycles from denaturation to extension, 72℃ extension for 5 min, and storage at 4℃.

[0057] After the first round of PCR reaction, the first PCR amplification products were obtained and detected by 1.5% agarose gel electrophoresis. The results are as follows: Figure 6As shown, the first PCR amplification product of the VHVP-1 epitope gene has a bright band at 955 bp, the first PCR amplification product of the VHVP-2 epitope gene has a bright band at 1132 bp, the first PCR amplification product of the VHVP-3 epitope gene has a bright band at 766 bp, and the pET-28a linearized vector has a bright band at 5224 bp. The VHVP-1, VHVP-2, and VHVP-3 epitope genes, as well as the pET-28a linearized vector, were recovered using an agarose DNA recovery kit.

[0058] (3) The first PCR amplification product obtained in step (2) above was ligated with the pET-28a linearized vector using recombinase. The ligation system was as follows: 2 μL of the first PCR amplification product, 3 μL of the pET-28a linearized vector, 4 μL of 5×CEII Buffer, 2 μL of Exnase II, and ddH2O was added to make up to 20 μL. After gently mixing with a pipette, the mixture was reacted at 37°C for 30 min to obtain the first ligation products of the VHVP-1 epitope gene, the VHVP-2 epitope gene, and the VHVP-3 epitope gene, respectively. The products were stored at 4°C for later use.

[0059] (4) Thaw the DH5α competent cells on ice. Take 10 μL of the first ligation product obtained in step (3) and add it to 100 μL of DH5α competent cells. Mix gently and then immediately place on ice for 30 min. Heat shock in a metal bath at 42℃ for 30 s, and then immediately place on ice for 2 min. Under sterile conditions, add the transformed bacterial solution to 250 μL of antibiotic-free LB liquid medium and shake at 37℃ and 220 rpm for 60 min to obtain the first transformation bacterial solutions of VHVP-1, VHVP-2, and VHVP-3.

[0060] Subsequently, 200 μL of each of the above first transformation bacterial cultures were spread onto kanamycin-resistant LB solid medium and incubated overnight at 37°C upside down to obtain VHVP-1, VHVP-2 and VHVP-3 first plates, respectively.

[0061] (5) Pick the monoclonal plaques on the first plate of VHVP-1, the first plate of VHVP-2 and the first plate of VHVP-3 from step (4) above and shake them. After incubating at 200 rpm and 37℃ for 45 min, take 1 μL of bacterial solution as a template for bacterial PCR reaction, which is the second round of PCR reaction.

[0062] The second round of PCR reaction system consisted of: 1 μL of single-clone bacterial culture, 10 μL of 2×Rapid Taq Master Mix, 1 μL of universal primer T7 (SEQ ID NO.14: TAATACGACTCACTATAGGG), 1 μL of target gene-R, and ddH2O to a final volume of 20 μL. The target gene-Rs were the downstream primers for VHVP-1, VHVP-2, and VHVP-3 as shown in Table 6. Specifically, the target gene-R for the VHVP-1 single-clone bacterial culture PCR reaction was V1-TR in Table 6, the target gene-R for the VHVP-2 single-clone bacterial culture PCR reaction was V2-R in Table 6, and the target gene-R for the VHVP-3 single-clone bacterial culture PCR reaction was V3-R in Table 6.

[0063] The second round of PCR reaction procedure was as follows: 95℃ pre-denaturation for 10 min, 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 5 s, a total of 30 cycles from denaturation to extension, 72℃ extension for 5 min, and storage at 4℃.

[0064] After the second round of PCR reaction, the second PCR amplification products were obtained and detected by 1.5% agarose gel electrophoresis. The results are as follows: Figure 7 As shown, the second PCR amplification product of the VHVP-1 epitope gene has a brighter band at 1022 bp, the second PCR amplification product of the VHVP-2 epitope gene has a brighter band at 1199 bp, and the second PCR amplification product of the VHVP-3 epitope gene has a brighter band at 833 bp.

[0065] (6) Select positive single clones of the second amplification product from step (5) above for expansion culture. Place them on a shaker and culture at 200 rpm and 37℃ for about 6 h. After extracting the plasmid using a plasmid miniprep kit, take an appropriate amount of plasmid and send it to Sangon Biotech for the first sequencing. The sequencing primers are T7 and T7 Ter (SEQ ID NO.15: GCTAGTATTGCTCAGCGG). The first sequencing result is compared with the agarose gel electrophoresis result of the second PCR amplification product. The similarity is 100%. Therefore, the recombinant protein plasmid vector was successfully constructed. The VHVP-1 plasmid, VHVP-2 plasmid and VHVP-3 plasmid with correct sequence alignment were obtained respectively. Label them and store them in a -20℃ freezer.

[0066] 3. Expression and purification of antigen proteins (1) Plate coating: The VHVP-1 plasmid, VHVP-2 plasmid and VHVP-3 plasmid obtained in step 2 above with correct sequence alignment were transformed into BL21 (DE3) competent cells. The transformation steps were the same as (4) in step 2 above. After the plate coating was completed, the cells were incubated upside down in an incubator at 37°C overnight to obtain the second plate of VHVP-1, the second plate of VHVP-2 and the second plate of VHVP-3.

[0067] (2) Activation: Pick single colonies from each of the above second plates and put them into 200 μL of Kana-resistant LB liquid medium. Incubate overnight at 37°C and 220 rpm to obtain VHVP-1 first monoclonal bacterial suspension, VHVP-2 first monoclonal bacterial suspension and VHVP-3 first monoclonal bacterial suspension respectively.

[0068] (3) Inoculation: The culture was expanded to 20 mL by 100 times the amount of each first monoclonal bacterial culture to obtain VHVP-1 first expanded culture culture, VHVP-2 first expanded culture culture and VHVP-3 first expanded culture culture respectively; then each expanded culture culture was inoculated into 2 L of Kana resistant LB liquid medium and cultured in a shaker at 37℃ and 220 rpm for about 3.5 h.

[0069] (4) Induction: OD of the first culture medium 600 nm When the concentration was 0.5, IPTG (isopropyl β-D-Thiogalactoside) with a final concentration of 1 mM was added, and the mixture was induced at 37℃ and 220 rpm for 4 h to obtain the first induction bacterial culture of VHVP-1, VHVP-2 and VHVP-3.

[0070] (5) Centrifugation: Transfer the inducing bacterial cultures of each culture to a large centrifuge bottle, centrifuge at 4℃ and 4200 rpm for 20 min, discard the supernatant, and retain the bacterial precipitate to obtain the first precipitate of VHVP-1, VHVP-2, and VHVP-3, respectively. Then add 20 mL of 1% thiocyanate to each first precipitate. PBS (phosphate buffered saline solution, administered via 20...) (Diluted with PBS) The first precipitate of VHVP-1, the first precipitate of VHVP-2, and the first precipitate of VHVP-3 were resuspended to obtain the first resuspension of VHVP-1, the first resuspension of VHVP-2, and the first resuspension of VHVP-3.

[0071] (6) Ultrasound: The first suspensions obtained in step (5) above were ultrasonically broken using an ultrasonic cell disruptor. The ultrasonic power was 30%, the ultrasonic time was 2 seconds, the interval was 4 seconds, and the total ultrasonic time was 40 minutes, respectively, to obtain the second suspensions of VHVP-1, VHVP-2 and VHVP-3. The second resuspensions of VHVP-1, VHVP-2, and VHVP-3 were aliquoted into 2 mL centrifuge tubes and centrifuged at 4200 rpm and 4 °C for 20 min to obtain the second precipitates of VHVP-1, VHVP-2, and VHVP-3, as well as the supernatant after sonication of VHVP-1, VHVP-2, and VHVP-3. The second precipitates of VHVP-1, VHVP-2, and VHVP-3 were resuspended in 20 mL of PBS containing 2 M urea to obtain the third resuspensions of VHVP-1, VHVP-2, and VHVP-3.

[0072] (7) Inclusion body preparation: The third suspensions obtained in step (6) above were ultrasonically disrupted at 30% power for 2 seconds with a 4-second interval, for a total ultrasonic time of 5 minutes, to obtain VHVP-1, VHVP-2, and VHVP-3 fourth suspensions, respectively. The VHVP-1, VHVP-2, and VHVP-3 fourth suspensions were aliquoted into 2 mL centrifuge tubes and centrifuged at 4200 rpm and 4°C for 20 minutes. The supernatant was discarded, and the centrifugation was repeated 5 times to obtain inclusion bodies with high purity, namely VHVP-1, VHVP-2, and VHVP-3 inclusion bodies.

[0073] (8) Inclusion body dissolution: VHVP-1 inclusion body, VHVP-2 inclusion body and VHVP-3 inclusion body in step (7) were resuspended in 20 mL of PBS containing 0.3% sodium dodecyl sulfate (SKL) to obtain VHVP-1 fifth suspension, VHVP-2 fifth suspension and VHVP-3 fifth suspension respectively. They were then sonicated once more at 30% power for 2 s, with a 4 s interval, for a total sonication time of 5 min to obtain VHVP-1 sixth suspension (VHVP-1 inclusion body solution), VHVP-2 sixth suspension (VHVP-2 inclusion body solution) and VHVP-3 sixth suspension (VHVP-3 inclusion body solution).

[0074] (9) Inclusion body refolding: The VHVP-1 inclusion body solution, VHVP-2 inclusion body solution and VHVP-3 inclusion body solution in step (8) above were refolded using a PD-10 desalting column, following the instructions of the PD-10 desalting column, to obtain the refolded VHVP-1 inclusion body solution, the refolded VHVP-2 inclusion body solution and the refolded VHVP-3 inclusion body solution.

[0075] (10) Nickel column affinity chromatography: Take 5 mL of Ni-NTA (nickel NTA affinity chromatography medium, abbreviated as nickel column), and sequentially use 20 mL of ultrapure water and 1 mL of nickel column affinity chromatography medium. The nickel column was equilibrated with PBS. The refolded VHVP-1 inclusion body solution, the refolded VHVP-2 inclusion body solution, and the refolded VHVP-3 inclusion body solution from step (9) were injected into the nickel column using a 10 mL syringe and a 0.22 μm syringe filter, respectively. The outflowing solutions were VHVP-1 flow-through solution FT, VHVP-2 flow-through solution FT, and VHVP-3 flow-through solution FT. The nickel column was washed with 20 mL of 20 mM imidazole Wash Buffer 1 to remove contaminating proteins, yielding VHVP-1 20 mM imidazole washed protein, VHVP-2 20 mM imidazole washed protein, and VHVP-2 20 mM imidazole washed protein, respectively. The nickel column was washed with 20 mL of 40 mM imidazole Wash Buffer 1 to remove contaminating proteins, yielding VHVP-1 40 mM imidazole washed protein, VHVP-2 40 mM imidazole washed protein, and VHVP-2 40 mM imidazole washed protein, respectively. The column was washed with 40 mM imidazole to remove contaminating proteins. The nickel column was then washed with 20 mL of 200 mM imidazole wash buffer 1 to remove contaminating proteins, yielding VHVP-1 (200 mM imidazole washed protein), VHVP-2 (200 mM imidazole washed protein), and VHVP-2 (200 mM imidazole washed protein). The remaining proteins were then washed with 10 mL of 1 M imidazole wash buffer to remove the remaining proteins, yielding VHVP-1 (1 M imidazole washed protein), VHVP-2 (1 M imidazole washed protein), and VHVP-2 (1 M imidazole washed protein). Finally, the column was washed with 20 mL of ddH2O, and the nickel column was stored in 20% ethanol at 4°C.

[0076] (11) Take 40 μL each of the above-mentioned VHVP-1 first expansion culture, VHVP-1 first induction culture, VHVP-1 inclusion bodies, VHVP-1 flow-through filtrate (FT), VHVP-1 20 mM imidazole washed protein, VHVP-1 40 mM imidazole washed protein, VHVP-1 protein, and VHVP-1 1 M imidazole washed protein, and mix them with 10 μL of 5 After mixing with loading buffer, the protein was denatured by heating in a 99°C metal bath for 10 min, followed by centrifugation at 5000 rpm for 10 min. A 10% high-resolution precast gel (Bis-Tris) was then assembled, and run at 160°C for 40 min. The protein gel was stained with SDS-PAGE fast staining solution and destained with tap water. A clear band of VHVP-1 protein at approximately 35 kDa was observed, indicating successful protein expression and good purity. Further experiments can proceed. See the attached image for specific VHVP-1 expression and purification data. Figure 8 .

[0077] Take 40 μL each of the above-mentioned VHVP-2 first induction bacterial culture, VHVP-2 inclusion bodies, VHVP-2 flow-through filtrate (FT), VHVP-2 20 mM imidazole washed protein, VHVP-2 40 mM imidazole washed protein, VHVP-2 protein, and VHVP-2 1 M imidazole washed protein, and mix them with 10 μL of 5 After mixing with loading buffer, the protein was denatured by heating in a 99°C metal bath for 10 min, followed by centrifugation at 5000 rpm for 10 min. A 10% high-resolution precast gel (Bis-Tris) was then assembled, and run at 160°C for 40 min. The protein gel was stained with SDS-PAGE fast staining solution and destained with tap water. A clear band of VHVP-2 protein at approximately 42 kDa was observed, indicating successful protein expression and good purity. Further experiments can proceed. See the attached image for VHVP-2 expression and purification diagram. Figure 9 .

[0078] Take 40 μL each of the following: VHVP-3 first expansion culture, VHVP-3 first induction culture, VHVP-3 inclusion bodies, VHVP-3 flow-through filtrate (FT), VHVP-3 20 mM imidazole washed protein, VHVP-3 40 mM imidazole washed protein, VHVP-3 protein, and VHVP-3 1 M imidazole washed protein. Mix each mixture with 10 μL of 5... After mixing with loading buffer, the protein was denatured by heating in a 99°C metal bath for 10 min, followed by centrifugation at 5000 rpm for 10 min. A 10% high-resolution precast gel (Bis-Tris) was then assembled, and run at 160V for 40 min. The protein gel was stained with SDS-PAGE fast staining solution and destained with tap water. A clear band of VHVP-3 protein at approximately 29 kDa was observed, indicating successful protein expression and good purity. Further experiments can proceed. See the attached image for VHVP-3 expression and purification diagram. Figure 10 .

[0079] (12) The VHVP-1, VHVP-2 and VHVP-3 proteins from step (10) above were passed through a PD-10 desalting column. The sample was loaded according to the column instructions to remove salts such as imidazole. Then, the proteins were concentrated using a 10 kDa concentration tube to obtain VHVP-1 antigen protein, VHVP-2 antigen protein and VHVP-3 antigen protein respectively. The protein concentration was determined using a BCA kit. After being dispensed into 100 μg / tube, the proteins were flash-frozen in liquid nitrogen and stored at -80°C.

[0080] The results are as follows Figure 11 As shown, VHVP-1 antigen protein (diluted 5-fold), VHVP-2 antigen protein (diluted 10-fold), and VHVP-3 antigen protein (diluted 5-fold) at OD 562 The absorbance values ​​were 0.507, 0.195, and 0.57, respectively. Based on the fitted equation y=0.8852x+0.1075, the concentrations of VHVP-1 antigen protein were approximately 2.26 mg / mL, VHVP-2 antigen protein was approximately 0.99 mg / mL, and VHVP-3 antigen protein was approximately 2.61 mg / mL.

[0081] 4. Western blot validation of antigen proteins (1) SDS-PAGE electrophoresis: VHVP-1 antigen protein, VHVP-2 antigen protein and VHVP-3 antigen protein were prepared. 10 μL of 5× loading buffer was added to each 40 μL protein solution. The mixture was boiled in a metal bath at 99℃ for 10 min and centrifuged at 5000 rpm for 10 s. 10 μL of protein was loaded onto a 10% high-resolution precast gel (Bis-Tris) with parameters set at 160 V for 40 min.

[0082] (2) Electrophoresis: After electrophoresis, the PVDF membrane, which is the same size as the protein gel, is immersed in methanol for activation. After arranging the membrane in the order of sponge pad-filter paper-protein gel-PVDF membrane-filter paper-sponge pad, air bubbles are removed with a roller, and the membrane is clamped and placed in the transfer apparatus. Pour in the pre-cooled transfer buffer, cover the transfer apparatus and bury it in ice, and set the parameters to 200 mA for 90 min.

[0083] (3) Washing: After the transfer, remove the PVDF membrane and wash it three times with TBST buffer for 5 min each time.

[0084] (4) Sealing: Add 5% skim milk powder solution and seal at room temperature for 2 h.

[0085] (5) Incubation of primary antibody: Discard the blocking solution, add diluted mouse anti-his-HRP as primary antibody and incubate at room temperature for 2 h.

[0086] (6) Washing: Wash 3 times with TBST, turn over and wash 3 times, 5 minutes each time.

[0087] (7) Add ECL colorimetric solution to the membrane and place it in the dark for 2 min, and observe the results.

[0088] The results are as follows Figure 12 As shown, the recombinant protein is indeed a His-tagged protein. The theoretical size of the VHVP-1 antigen protein is 35 kDa, the theoretical size of the VHVP-2 antigen protein is 42 kDa, and the theoretical size of the VHVP-3 antigen protein is 29 kDa, which allows for further experiments.

[0089] S2. Screening anti-VHVP-1, VHVP-2, and VHVP-3 nanobodies from a camel-derived natural nanobody library. The specific steps are as follows: 1. Construction of the Camel Source Natural Library (1) The camel-derived natural library used in this experiment was purchased from Shenzhen Kangti Life Technology Co., Ltd.

[0090] According to the experimental report provided by Kangti Life, the blood samples for this library were collected from 103 healthy alpacas. After steps including total RNA extraction, reverse transcription, PCR amplification, and ligation of the vector and PCR products with enzymes, the entire bacterial culture was collected through 20 electroporation transformations to construct a bacterial library. Forty-eight single colonies were randomly selected for colony PCR, with a positive cloning rate of 96%. Sequencing and protein sequence diversity comparison showed that all submitted sequences were independent sequences, and the bacterial library diversity reached 100%, meeting the requirements. The bacterial library was then rescued and purified using M13K07-assisted phage to obtain a phage library, and its titer was tested. The final library size was 2.3 × 10⁻⁶. 9 The bacterial library of PFU and its titer of 1.2 × 10⁻⁶ 12 A phage library of pfu / mL.

[0091] 2. Assisting in the amplification, purification, and titer determination of bacteriophages (1) Activation: SS320 glycerol bacteria were streaked on 2×YT (tetracycline resistant) solid medium and incubated overnight at 37°C in an electric thermostatic incubator to obtain the third plate. The next day, a single colony was randomly picked from the third plate and transferred to 5 mL of 2×YT (tetracycline resistant) liquid medium and shaken overnight at 37°C.

[0092] (2) Amplification: The next day, the above bacterial culture was transferred to 100 mL of 2×YT (tetracycline resistant) liquid medium and cultured at 37℃ until the logarithmic growth phase. Helper phage M13K07 was added according to the following formula: ;

[0093] Note:T helper-phage The titer of the helper phage is 1.6 × 10⁻⁶. 13 pfu / mL; OD 600 The value of the bacterial culture when helper phages are added.

[0094] After incubating in a shaker at 37°C for 30 min, kanamycin (50 μg / mL) and IPTG (0.2 mM) were added to the mixture in a clean bench in proportion, and then the mixture was incubated in a shaker at 30°C overnight.

[0095] (3) Purification: The next day, centrifuge all bacterial culture at 4℃ and 4000 rpm for 10 min, collect the supernatant and transfer it to a new tube. Add 1 / 4 volume of pre-chilled 20% PEG / NaCl to the tube, mix well and place on ice for 30 min. Then centrifuge at 4℃ and 4000 rpm for 20 min. Discard the supernatant and invert the tube on paper for 2 min. Then add 1 mL of PBS buffer and repeatedly pipette to suspend the precipitate and transfer it to a new 1.5 mL tube. Add another 1 / 4 volume of pre-chilled 20% PEG / NaCl, mix well and place on ice for 10 min. Centrifuge at 4℃ and 12000 rpm for 10 min, remove the supernatant completely, add 1 mL of PBS buffer and repeatedly pipette to suspend the precipitate. Centrifuge at 4℃ and 12000 rpm for 2 min, carefully aspirate the supernatant and aliquot it into 1.5 mL tubes, 100 μL per tube, and store in an ultra-low temperature freezer (-80℃) for long-term use.

[0096] (4) Potency determination: 5 mL of SS320 Escherichia coli was cultured in advance to OD. 600 Approximately 0.5, for later use. Take 10 μL of the helper phage prepared in (3) and serially dilute it 10-fold (10 μL + 90 μL sterile water per tube) to 10⁻¹², for a total of 12 tubes, and mix well for later use. Add 90 μL of SS320 logarithmic phase bacterial culture to each tube, mix by pipetting, and incubate at 37°C for 30 min. Take 5 μL from each tube and transfer it to a 2×YT (kanamycin resistant) solid culture plate, and incubate at 37°C overnight to obtain the fourth plate of VHVP-1, the fourth plate of VHVP-2, and the fourth plate of VHVP-3. The next day, count the number of single colonies at each dilution and calculate the titer of the helper phage according to the following formula: Where N is the number of colonies at a certain dilution factor, and D is the dilution factor.

[0097] 3. Panning of phage libraries containing anti-VHVP-1, VHVP-2, and VHVP-3 epitope antigens (1) First round of screening: First, VHVP-1 antigen protein, VHVP-2 antigen protein, and VHVP-3 antigen protein were coated separately. 50 µg of VHVP-1 antigen protein, VHVP-2 antigen protein, and VHVP-3 antigen protein were coated onto immunotubes A, B, and C respectively, with 2 mL of CBS as the coating solution. The tubes were incubated overnight at 4°C with slow rotation. The next day, the coating solution in the immunotubes was discarded, and the tubes were washed three times with PBS for 5 min each time. 2 mL of 3% BSA was added as blocking solution, and the tubes were rotated at room temperature for 2 h. The blocking solution was discarded, and the tubes were washed three times again with PBS for 5 min each time. 2 mL of PBS was added, and then a camel-derived natural phage library (provided by Shenzhen Kangti Life Technology Co., Ltd., with a titer of 1.2 × 10⁻⁶) was added. 13 Incubate with 100 µL of PBST buffer (pfu / mL) at room temperature for 1 h by rotation. Discard the liquid in the immunoassay tube, add 2 mL of PBST buffer and wash the tube 20 times, rotating slowly for 5 min each time. Discard the liquid in the immunoassay tube, add 1 mL of 0.25 mg / mL trypsin solution, and wash the phage by rotation slowly at room temperature for 30 min. Then add 10 µL of 10% AEBSF protease inhibitor to stop the elution, and transfer the eluent from the immunoassay tube to a new 1.5 mL tube, which is the first round of washing eluent.

[0098] (2) First round of valence testing: The method is the same as step (4) of S2 above.

[0099] (3) Amplification of the first round of elution buffer: Two tubes of 5 mL SS320 bacterial culture were cultured in advance to the logarithmic phase to allow OD to be generated. 600 Approximately 0.5-0.55, for later use. Take 500 μL of the phage eluent obtained from the first round of screening of VHVP-1, VHVP-2, and VHVP-3 respectively (store the remaining eluent at 4℃), and add it to 5 mL of freshly cultured SS320 bacterial suspension. Infect on a shaker at 37℃ and 250 rpm for 30 min. Spread the 5.5 mL of phage-infected bacterial suspension evenly onto three 130×130 mm 2×YT square agar plates (containing 2% glucose, 2% agarose, and 100 μg / mL Amp), 3 plates each for VHVP-1, VHVP-2, and VHVP-3, for a total of 6 plates. Incubate overnight at 37℃, which are the fifth plates for VHVP-1, VHVP-2, and VHVP-3. Add 2 mL of 2×YT(Tet) liquid medium to the surface of each overnight culture plate. Use a cell scraper to scrape off all colonies from the plate and collect the mixed bacterial solution into 15 mL centrifuge tubes, which are the first mixed bacterial solutions of VHVP-1, VHVP-2, and VHVP-3, 6 mL in each tube. At the same time, measure the OD of the bacterial solution. 600The values ​​were recorded, and then 20% glycerol was added to the first mixed bacterial solution of VHVP-1, the first mixed bacterial solution of VHVP-2, and the first mixed bacterial solution of VHVP-3. The solutions were then aliquoted and stored at -80℃, which are the bacterial libraries of the first eluent of VHVP-1, the first eluent of VHVP-2, and the first eluent of VHVP-3.

[0100] The bacterial OD of the bacterial libraries obtained from the above eluents was calculated. 600 Substitute the value into the following formula: V(μL)=10 / OD 600 Calculate the initial bacterial volume of VHVP-1, VHVP-2, and VHVP-3 by multiplying by 1000, and then transfer them to 100 mL of 2×YT (ampicillin-resistant, tetracycline-resistant) liquid medium. These are the second expansion cultures of VHVP-1, VHVP-2, and VHVP-3. The initial OD values ​​of each second expansion culture are then calculated. 600 The value was 0.1. OD was measured after incubation at 37℃ until the logarithmic phase. 600 The value is then used for helper phage rescue. The volume of helper phage added is based on the following formula ( (Titer of the helper phage used) ;

[0101] After being placed back into a shaker at 37°C and cultured for another 30 min, kanamycin (50 μg / mL) and IPTG (0.2 mM) were added to the solution in a clean bench in proportion to the solution. The solution was then placed back into a shaker at 30°C and cultured overnight to obtain the second induction bacterial suspensions of VHVP-1, VHVP-2, and VHVP-3.

[0102] (4) Purification of the first round of phage sub-libraries: The method is the same as in step S2 (4) above. After purification, the first round of phage sub-libraries are obtained and used as the input phage library for the second round of screening.

[0103] (5) Second round of screening: The method is the same as in (1) of S2, except that the added phage library is the phage sub-library obtained in the first round of screening (about 10). 12 The second round of screening eluent was obtained by screening with PFU (phage elution product). The titer detection, amplification, and purification steps of the phage eluent were the same as above. Finally, the second round of phage sub-libraries were purified and used as the input phage library for the third round of screening.

[0104] (6) Third round of screening: The method is the same as in (1) of S2, except that the phage library added is the phage sub-library obtained in the second round of screening (approximately 10). 12 PFU was used to obtain the third round of screening eluent.

[0105] S3. Screening for anti-VHVP-1, VHVP-2, and VHVP-3 nanobodies from a natural shark nanobody library, the specific steps of which are as follows: (1) The shark natural library used in this experiment was obtained by the method described in the patent document with publication number CN119638825A.

[0106] Using 12 non-immunized striped bamboo sharks as samples, anticoagulated blood was collected from the spleen and tail vein, and blood lymphocytes were isolated. The process involved total RNA extraction, reverse transcription to obtain cDNA, PCR amplification of vNAR fragments, and recovery. Sixteen electroporation transformations were performed to collect all bacterial cultures for bacterial library construction. Forty-eight colonies were randomly selected for colony PCR verification, with a 100% positive insertion rate. From the positive clones, another 48 were randomly selected for sequencing and sequence alignment. The results showed that all clones encoded nanobody sequences with no repetitive sequences (48 / 48 independent, approximately 100% diversity). Based on this, M13KO7 helper phage was used for rescue amplification to prepare a phage display library, and its titer was determined. The final library size was 1×10⁻⁶. 7 PFU bacterial library and titer of 4×10 12 A phage library of pfu / mL.

[0107] (2) Screening process in shark natural nanobody library: The above step S2 was used to obtain the third round of phage elution.

[0108] S4. Phage-ELISA identification and analysis, the specific steps are as follows: 1. After diluting the third-round phage elution buffers obtained in steps S2 and S3 by 12 gradients, prepare 5 mL of SS320 E. coli and shake to OD. 600 Approximately 0.5, for later use. Take 10 μL of the third round screening eluent and serially dilute it 10-fold (10 μL + 90 μL sterile water per tube) to a final concentration of 10. -12 Twelve tubes were prepared and mixed thoroughly. 90 μL of S320 *E. coli* in logarithmic growth phase was added to each tube and mixed by pipetting. 5 μL of each gradient was evenly spread onto 2×YT (Amp-resistant) solid medium and incubated overnight at 37°C to obtain the sixth plates for VHVP-1, VHVP-2, and VHVP-3, respectively.

[0109] 2. The next day, pick 96 single clones from the sixth plate of VHVP-1, the sixth plate of VHVP-2 and the sixth plate of VHVP-3 obtained in step 1 above and put them into sterile 96-well cell culture plates. Add 200 μL of 2×YT (Amp, Tet resistance) liquid medium to each well and incubate overnight at 37°C to obtain the first cell culture plate of VHVP-1, the first cell culture plate of VHVP-2 and the first cell culture plate of VHVP-3.

[0110] 3. The next day, take 5 μL of bacterial culture from each of the VHVP-1, VHVP-2 and VHVP-3 cell culture plates obtained in step 2 above and transfer them to a new sterile 96-well cell culture plate containing 200 μL of 2×YT (Amp, Tet resistance) liquid medium per well. Incubate at 37°C for 3 h to obtain the VHVP-1, VHVP-2 and VHVP-3 cell culture plates respectively. The overnight bacteria before transfer are stored at 4°C.

[0111] 4. Subsequently, helper phages were added to each well according to the following formula, so that the ratio of bacteria to phages was 1:20. (Titer of the helper phage used) ;

[0112] After incubating at 37°C for 30 min, kanamycin (final concentration 50 μg / mL) and IPTG (final concentration 0.2 mM) were added aseptically. The mixtures were then incubated overnight at 30°C to obtain VHVP-1, VHVP-2, and VHVP-3 post-induction bacterial cultures. Simultaneously, VHVP-1, VHVP-2, and VHVP-3 antigen proteins (all at 1 ng / μL) were coated onto microplates using CBS (100 μL / well). BSA (1 ng / μL) was used as a control (100 μL / well). The plates were incubated overnight at 4°C to obtain VHVP-1, VHVP-2, and VHVP-3 second-cell culture plates.

[0113] 5. Then, centrifuge the VHVP-1 second cell culture plate, VHVP-2 second cell culture plate, and VHVP-3 second cell culture plate at 5000 rpm and 4℃ for 10 min. Collect the supernatant and store it for later use. This will yield the VHVP-1 first phage supernatant, VHVP-2 first phage supernatant, and VHVP-3 first phage supernatant, respectively.

[0114] 6. The next day, discard the coating solution and wash each well three times with 200 μL PBS for 10 min each time. Add 200 μL of 3% BSA as blocking solution and block at room temperature for 1 h. Discard the blocking solution, add 200 µL of 0.1% PBS to each well to wash away the blocking solution, and wash three times at room temperature for 10 min each time.

[0115] 7. Add 120 μL of 3% BSA to each well, and then add 80 μL of the first phage supernatant of VHVP-1, VHVP-2 and VHVP-3 obtained in step 5 above. Incubate at room temperature for 2 h. Discard the liquid in the plate, add 200 μL of PBST to each well and wash 3 times for 10 min each time.

[0116] 8. Add 100 μL of M13 Bacteriophage Antibody (HRP) diluted 1:40000 to each well and incubate at room temperature for 1 h. Discard the liquid in the plate, add 200 μL of PBST to each well and wash 3 times for 10 min each time.

[0117] 9. Add 100 μL of TMB colorimetric solution to each well, vortex to mix, and incubate in the dark for 5 min. Remove the plate, add 100 μL of 1 M HCl to each well to stop the color development, and measure the OD. 450 value.

[0118] Color development results as follows Figure 13 As shown, during the colorimetric result processing, the OD values ​​of the antigen incubation wells and their corresponding BSA control wells were compared. 450 The ratios of the values ​​were sorted from largest to smallest, and the monoclonal bacteria with the highest ratios were selected. The bacterial cultures of each were sent to Sangon Biotech Shanghai Co., Ltd. for sequencing. The primers required for sequencing the camel library were pADL-F (SEQ ID NO.16): TGTGAGCGGATAACAATTTCAC; and the primers required for sequencing the shark library were P1 (SEQ ID NO.17): CCAGGCTTTACACTTTATGC.

[0119] Sequencing results as follows Figure 14As shown, five vNAR sequences with different CDR3 regions were screened from the shark natural library (1 VHVP-1; 2 VHVP-2; 2 VHVP-3). Seventeen VHH sequences with different CDR3 regions were screened from the camel natural library (1 VHVP-1; 7 VHVP-2; 9 VHVP-3). It is noteworthy that the number of specific VHH sequences obtained from the camel natural library (17 sequences) is significantly greater than the number of vNAR sequences from the shark natural library (5 sequences). This is mainly due to the significant difference between the donor population and the final library size; the camel library was collected from 103 alpacas, resulting in a library size of 2.3 × 10⁻⁶. 9 PFU, however, is limited by the sample size, constructed from only 12 striped bamboo sharks, resulting in a library capacity of only 1×10⁻⁶. 7 PFU. The anti-VHVP-2 nanobody sequence and P / N value obtained by screening were also higher than those of anti-VHVP-1 and VHVP-3. This is closely related to its high exposure as a core lethal factor and its active toxic domain. Therefore, compared with VHVP-1 and VHVP-3, which are used for transport and assembly, the epitope of VHVP-2 is more easily recognized and tightly bound by the long CDR3 region of the nanobody in its natural state.

[0120] Based on the antigen-binding titer determined by ELISA, three VHH sequences were selected according to the ratio of positive signal to background signal (P / N, P / N > 2.1 is generally considered a positive clone): VHH-VHVP-1-24 (SEQ ID NO.18), VHH-VHVP-2-28 (SEQ ID NO.19), and VHH-VHVP-3-81 (SEQ ID NO.20); and three vNAR sequences were selected: vNAR-VHVP-1-66 (SEQ ID NO.21), vNAR-VHVP-2-42 (SEQ ID NO.22), and vNAR-VHVP-3-56 (SEQ ID NO.23). These six specific single-domain antibody genes were sent to Sangon Biotech (Shanghai) Co., Ltd. for codon optimization and whole-genome synthesis for subsequent recombinant antibody expression and functional verification.

[0121] The expression and identification of S5, anti-VHVP-1, VHVP-2, and VHVP-3 VHH nanobodies and vNAR nanobodies are shown in the following steps: 1. The three vNAR sequences and three VHH sequences synthesized in step S4 above were used to construct recombinant plasmids by Sangon Biotech (Shanghai) Co., Ltd., and then cloned into the pET-28a prokaryotic expression vector. Three different pET-28a-VHH recombinant plasmids and three different pET-28a-vNAR recombinant plasmids were obtained respectively.

[0122] 2. Take 10 μL of each of the recombinant plasmids obtained in step S5.1 above and add them to 100 μL of BL21(DE3) competent cells, then incubate on ice for 30 min. Next, heat shock at 42℃ for 90 s, then immediately place on ice for 5 min. Add 900 µL of antibiotic-free LB medium under sterile conditions, and incubate on a shaker at 37℃ and 220 rpm for 45 min to obtain VHVP-1, VHVP-2, and VHVP-3 second transformation cultures, respectively. Then, take 100 μL each of the VHVP-1, VHVP-2, and VHVP-3 second transformation cultures and spread them on Kana-resistant LB solid medium, incubate overnight at 37℃ inverted, to obtain the seventh plate. The following day, single colonies were picked from each of the seventh plates and transferred to 5 mL of Kana-resistant LB liquid medium. After incubation at 37°C and 220 rpm until the logarithmic phase, glycerol and bacterial suspension were added to cryovials and stored at -80°C, thus obtaining pET-28a-VHH BL21(DE3) glycerol bacteria and pET-28a-vNAR BL21(DE3) glycerol bacteria, respectively.

[0123] 3. Protein-induced expression and purification of VHH nanobodies (1) The above pET-28a-VHH BL21(DE3) glycerol bacteria were inoculated into 10 mL of LB liquid medium with Kana resistance at a ratio of 1:100 and cultured overnight at 37℃ and 220 rpm to activate the bacteria and obtain VHH-VHVP-1 third expansion culture, VHH-VHVP-2 third expansion culture and VHH-VHVP-3 third expansion culture respectively.

[0124] (2) Take 1 mL of the third expansion culture of VHH-VHVP-1, VHH-VHVP-2, and VHH-VHVP-3 respectively as uninduced samples. The remaining samples are transferred to 1 L of LB liquid medium with Kana resistance at a ratio of 1:1000 and shaken at 37℃ and 220 rpm until OD is reached. 600 The values ​​were between 0.6 and 0.8. IPTG was added to a final concentration of 20 mM, and the mixture was induced overnight at 16°C and 200 rpm to obtain the fourth induction bacterial cultures of VHH-VHVP-1, VHH-VHVP-2, and VHH-VHVP-3, respectively.

[0125] (3) Take 1 mL of the fourth induction bacterial culture of VHH-VHVP-1, VHH-VHVP-2 and VHH-VHVP-3 respectively as SDS-PAGE electrophoresis samples. The remaining bacterial culture is put into a large centrifuge bottle and centrifuged at 4200 rpm for 20 min at 4℃. The supernatant is discarded and the bacterial cells are collected. Each 1 L of bacterial cells is resuspended in 20 mL PBS in a 50 mL centrifuge tube and stored at 4℃ to obtain the seventh resuspension of VHH-VHVP-1, VHH-VHVP-2 and VHH-VHVP-3.

[0126] (4) Place the above-mentioned seventh suspensions of VHH-VHVP-1, VHH-VHVP-2, and VHH-VHVP-3 on ice and sonicate for 30 min at 30% power, with the power on for 2 s and off for 4 s until the solution is clear. Centrifuge the sonicated cells at 4℃ and 12000 rpm for 30 min, and collect the supernatant for subsequent nickel column chromatography to obtain the supernatant after sonication of VHH-VHVP-1, VHH-VHVP-2, and VHH-VHVP-3, respectively.

[0127] (5) The supernatant after sonication of VHH-VHVP-1, VHH-VHVP-2 and VHH-VHVP-3 was subsequently purified by nickel column, desalted and concentrated and SDS-PAGE electrophoresis as in step S1 3 (10)-(12) above, to obtain VHH-VHVP-1 nanobody, VHH-VHVP-2 nanobody and VHH-VHVP-3 nanobody respectively.

[0128] The results are as follows Figure 15 As shown, VHH-VHVP-1 (SEQ ID NO.18) has a molecular weight of 15.27 kDa and a concentration of 1.94 mg / mL, VHH-VHVP-2 (SEQ ID NO.19) has a molecular weight of 14.91 kDa and a concentration of 1.12 mg / mL, and VHH-VHVP-3 (SEQ ID NO.20) has a molecular weight of 15.04 kDa and a concentration of 1.34 mg / mL. After aliquoting, they were flash-frozen in liquid nitrogen and stored at -80°C.

[0129] 4. The methods and steps for protein induction expression and purification of vNAR nanobodies are the same as those in step S5.3 above, to obtain vNAR-VHVP-1 nanobodies, vNAR-VHVP-2 nanobodies and vNAR-VHVP-3 nanobodies respectively.

[0130] The results are as follows Figure 16As shown, vNAR-VHVP-1 (SEQ ID NO.21) has a molecular weight of 14.31 kDa and a concentration of 0.65 mg / mL, vNAR-VHVP-2 (SEQ ID NO.22) has a molecular weight of 13.55 kDa and a concentration of 0.68 mg / mL, and vNAR-VHVP-3 (SEQ ID NO.23) has a molecular weight of 13.58 kDa and a concentration of 1.11 mg / mL. After aliquoting, they were flash-frozen in liquid nitrogen and stored at -80°C.

[0131] Experiments revealed that all camel-derived nanobody proteins (VHH nanobody) were expressed in a soluble manner, while shark-derived nanobody proteins (vNAR nanobody) were expressed as inclusion bodies. Sharks, as marine cartilaginous fish, naturally contain high concentrations of urea (a protein denaturant) to maintain osmotic pressure balance. To adapt to this denaturing environment, vNAR has evolved an extremely dense hydrophobic core. In a conventional E. coli aqueous expression system lacking high urea concentrations, the exposed hydrophobic regions of vNAR are prone to non-specific aggregation, leading to incorrect protein folding and the formation of inclusion bodies. In contrast, camel-derived VHH, situated in a normal physiological aqueous environment, may have undergone hydrophilic mutations in key amino acids of its framework region (FR2), giving it naturally superior solubility.

[0132] 5. The specific methods and steps for Western blot validation of VHH nanobodies and vNAR nanobodies are the same as those in step S1.4 above, and the results are as follows: Figure 17 As shown, the purification effect and the specificity of the nanobody protein are good, with no extra impurities, and the next step of the experiment can be carried out.

[0133] 6. ELISA was used to verify the binding affinity of VHH nanobodies and vNAR nanobodies to VHVP-1, VHVP-2, and VHVP-3 antigen proteins, respectively. (1) Antigen coating: VHVP-1 antigen protein, VHVP-2 antigen protein and VHVP-3 antigen protein were diluted with CBS coating buffer to 1 μg / mL, 100 ng per well, and coated overnight at 4℃; (2) Washing the plate: Pour out the liquid in the plate and pat it dry on absorbent paper (when patting dry, be careful to avoid leaving fingerprints on the bottom of the microplate and affecting subsequent readings). Wash each well with 200 μL PBST 3 times, 5 min each time; (3) Sealing: 100 μL of 1% BSA solution per well was used for sealing at room temperature for 2 h; (4) Washing: Discard the blocking solution, wash each well with 200 μL PBST 3 times, 5 min each time; (5) Primary antibody: Each VHH nanobody, vNAR nanobody and positive control were set with different concentration gradients and 3 parallel groups. The negative control was BSA. 100 μL was added to each well and incubated for 1 h. (6) Washing the plate: Discard the liquid in the plate, add 200 μL of PBST to each well and wash 3 times, 5 min each time; (7) Secondary antibody: Add 100 μL of diluted secondary antibody (mouse anti-his-HRP) to each well for each VHH nanobody and vNAR nanobody. The secondary antibody for the positive control is goat anti-rabbit-HRP. Incubate at room temperature for 1 h. (8) Washing: Discard the liquid in the plate and wash 10 times with 200 μL PBST, 5 min each time; (9) Color development: Add 100 μL of TMB color development solution to each well, shake to mix, and incubate in the dark for 5 min.

[0134] (10) Termination: After the color development is completed, add 100 μL of 1M HCl to each well to terminate the color development.

[0135] (11) Reading: On the OD of the microplate reader 450 nm Read the values ​​from the microplate.

[0136] The results are as follows Figure 18 As shown, the camel-derived VHH nanobody and shark-derived vNAR nanobody obtained in this application both exhibited effective and specific binding to the target antigen, and displayed typical concentration-dependent binding curves. The half-maximal effective concentration (EC50) of each nanobody is shown in the figure. 50 Between 2.084 and 46.03 ng / μL, it showed good affinity for the corresponding antigens.

[0137] 7. Homology Modeling and Molecular Docking To intuitively analyze the interaction between the CDR3 region of the nanobody and the antigen protein, computer simulation methods were used to predict and analyze its binding site: (1) AlphaFold3 was used to model the three-dimensional structure of VHH nanobody, vNAR nanobody and each antigen protein respectively; the pTM values ​​of the obtained models were all higher than the default threshold of 0.5, indicating that the models have high credibility. (2) Based on the three-dimensional structure, molecular docking analysis was performed on VHH nanobody, vNAR nanobody and various antigen proteins using the HDOCKlite v1.1 server online docking tool; (3) The optimal conformation was selected based on the molecular docking score, and the interaction amino acid sites between the nanobody and the antigen protein were analyzed to identify the key binding sites on the nanobody. The interaction amino acid sites were further verified and analyzed using PLIP online software, and the three-dimensional structure of the interaction interface was drawn using PyMOL computer software.

[0138] The results are as follows Figure 19 As shown, the VHH-VHVP-1 complex forms hydrogen bonds (N104-Y48, P101-R35) and locks its conformation through the hydrophobic stacking of residues such as F110 and A99. In contrast, VNAR1 penetrates deep into the antigen with its long CDR3 ring. Residues R95, G93, R90, and S104 form hydrogen bonds with G46, Y48, G7, and S164 of the antigen, and enhance binding through extensive hydrophobic interactions between Q91 and antigens L37 and F21. The CDR3 region of VHH2 initially stabilizes the interface through hydrogen bonds between R101 and antigen S4. VNAR2 relies on residues such as P97, D99, and Y100 in its complementarity-determining region to form polar interactions with antigens Y178 and S240, and combines with hydrophobic stacking to stabilize the conformation. In docking with VHVP-3, we found that the CDR3 region hardly interacted with the antigen. This phenomenon may stem from the unique spatial conformation and chemical properties of the target antigen epitope, which are highly complementary to the binding interface formed by CDR1 / CDR2. VHH3 binds to the antigen K152, H247, and H245 via multiple hydrogen bonds (G66, K65, N62, etc.) in the CDR2 region, forming a stable complex. VNAR3's CDR1 binds via R27 and S124, N127 hydrogen bonds. This tight hydrogen bond network and hydrophobic interactions between the hypervariable regions of the nanobody and the antigen provide a direct structural explanation for the results of previous ELISA experiments.

[0139] In ELISA experiments, the EC50 of VHVP-3 50 The results were relatively low, consistent with observations in molecular docking models. The docking results revealed that the antibody failed to utilize its core region CDR3 to form an effective and stable interaction with the antigen, maintaining the stability of the complex only through local contact in the CDR1 / 2 region. The molecular docking results confirm the screened nanobodies' specific recognition ability of the target pathogenic factor.

[0140] S6. Preliminary application of nanobody and colloidal gold chromatography test strips: Specific steps are as follows: 1. Preparation of colloidal gold (0.02% 30 nm colloidal gold) Prepare a clean 250 mL Erlenmeyer flask, rinse it repeatedly with purified water 5-6 times, and dry it for later use. Place it on a stirring and heating apparatus and heat it. When the solution temperature reaches approximately 95°C, stop heating, start stirring, and quickly add 9 mL of 1% trisodium citrate solution. At this point, the solution color gradually changes from yellow to white, then to dark gray, and finally to purplish-red. Continue the reaction for 5 minutes. After the reaction is complete, cool it to room temperature and store it in a 4°C refrigerator for later use. Take 1 mL of the prepared colloidal gold solution and measure its absorption spectrum in the wavelength range of 400-600 nm using a UV spectrophotometer.

[0141] like Figure 20 As shown, the colloidal gold solution has a wine-red appearance, the system is homogeneous and free of impurities, and the maximum absorption wavelength is about 520 nm. Using the linear equation y = 0.4271x + 514.56 between the colloidal gold particle size (x) and the maximum absorption wavelength (y), the diameter of the colloidal gold particles is estimated to be about 13 nm.

[0142] 2. Colloidal gold-labeled nanobodies Take 1 mL of colloidal gold solution into a 1.5 mL EP tube, add 10 μL of 0.2 M potassium carbonate (K2CO3) solution, and gently shake to adjust the pH of the colloidal gold. Add the same amount of the protein to be labeled to each pH gradient colloidal gold tube, invert and mix at room temperature for 10 min to label the antibody, and add 100 μL of 10% NaCl solution to each tube. The highest pH value that keeps the red color unchanged is usually the optimal labeling pH. Add the antibody to be labeled to this pH value, mix well, and then add 30 μL of 10% BSA solution to the antibody-labeled colloidal gold solution. Invert and mix at room temperature for 5 min to block the colloidal gold. Then, centrifuge the blocked colloidal gold solution at 8000 rpm for 6 min, carefully aspirate the supernatant to a new centrifuge tube, and continue centrifuging at 10000 rpm for 8 min. Discard the supernatant. The precipitates obtained from the two centrifugations were reconstituted in 100 μL of gold reconstitution solution to obtain 100 μL of colloidal gold concentrate labeled with nanobodies.

[0143] 3. Apply gold leaf and dry. Cut glass fiber into 4 mm wide strips, immerse them in the pre-prepared gold pad treatment solution for 40 min, then remove and dry at 37°C. After drying, dilute the colloidal gold concentrate prepared in step S6.2 above with 300 μL of gold diluent and drop it onto the glass fiber, then dry again. Cut glass fiber into 20 mm wide strips, immerse them in the pre-prepared sample pad treatment solution for 40 min, then dry.

[0144] 4. Assembly and identification of test strips Two different antibodies were used to scribble onto the NC membrane using a scribing machine to serve as the test line (T line) and control line (C line) of the test strip, respectively, and dried at 37°C. The sample pad, gold label pad, NC membrane, and absorbent pad were then assembled onto the PVC base plate in sequence, with an overlap of approximately 0.2 cm between each pair of pads. Figure 1 As shown. Use a strip cutter to cut the assembled test strips into 4 mm wide pieces. Place the cut test strips into the plastic cartridges for testing. Figure 21 ).

[0145] Comparative Example The difference between this comparative example and the previous example is that the antigen protein to be detected is different.

[0146] The antigen proteins used in the comparative examples were MBP (tag protein), SWP1 (shrimp hepatic enterocytozoon virus isolated protein), VP28 (white spot syndrome virus virulence protein), and GST (tag protein), all of which were proteins that had been expressed, purified, and preserved in the laboratory, as well as the nsp1 protein prepared in the patent document with publication number CN119638825A. The antigen proteins used in the examples were VHVP-1 antigen protein, VHVP-2 antigen protein, and VHVP-3 antigen protein.

[0147] To further illustrate the advantages of the present invention, the antigen proteins used in the comparative examples and embodiments were tested using the following test examples 1-6.

[0148] Test Example 1: Nanobody Cross-Pairing Test ELISA results verifying the binding affinity of nanobodies to antigens showed that nanobodies screened from camel and shark libraries exhibited different affinities. Therefore, we cross-paired six nanobodies (VHH and vNAR) with corresponding recombinant rabbit polyclonal antibodies (purchased from Sangon Biotech) and labeled them with colloidal gold according to the combinations shown in Table 4. After streaking, the test strips were assembled, and then 0.2 mg / mL antigen solutions were added. Results were observed after 10 minutes.

[0149] Table 4. Combinations of C-line, T-line, and gold-labeled antibody in colloidal gold test strips for three antigens. ;

[0150] The results showed that the binding process of recombinant rabbit polyclonal antibody and vNAR to colloidal gold was relatively smooth during the labeling process. However, the VHH nanobody exhibited varying degrees of gold death after the addition of colloidal gold. Therefore, a specific combination was selected. When vNAR was used as the gold-labeled antibody and VHH was used as the T-line antibody, the C-line was not obvious and false positives occurred. The effect was also unsatisfactory when recombinant rabbit polyclonal antibody was used as the T-line antibody. When recombinant rabbit polyclonal antibody was used as the gold-labeled antibody and nanobody was used as the T-line antibody, the T-line and C-line were displayed better. Therefore, the optimal antibody cross-pairing combination was selected as recombinant rabbit polyclonal antibody as the gold-labeled antibody, nanobody as the T-line antibody, and goat anti-rabbit as the C-line antibody (see Table 5), and this combination was used for subsequent sensitivity and specificity tests.

[0151] Table 5. Combination of C-line, T-line, and gold-labeled antibody in anti-VHVP colloidal gold test strips ;

[0152] Test Example 2: Specificity Detection of Colloidal Gold Test Strips The colloidal gold test strip combination with good color development in Test Example 1 (Table 5) was selected, namely, the gold-labeled antibody was rabbit polyclonal antibody, the T-line antibody was nanobody (among which, the T-line antibody of serial number 1 was VHH-VHVP-1 for detecting VHVP-1 antigen protein; the T-line antibody of serial number 2 was VHH-VHVP-2 for detecting VHVP-2 antigen protein; and the T-line antibody of C was vNAR-VHVP-3 for detecting VHVP-3 antigen protein), and the C-line antibody was goat anti-rabbit antibody, to prepare colloidal gold test strips for detecting three antigen proteins. Samples of eight antigen proteins (MBP, SWP1, VP28, GST, nsp1, and VHVP-1, VHVP-2, and VHVP-3 antigen proteins) at a concentration of 0.1 mg / mL were added to test strips 1-3 respectively, and the color development was observed after approximately 10 minutes.

[0153] The results of test example 2 are as follows Figure 22 As shown, the test strips for VHVP-2 and VHVP-3 only showed clear detection lines (T lines) in the corresponding antigen wells, while the other control groups showed no color development, indicating that the VHVP-2 and VHVP-3 test strips have good specificity. In contrast, the test strip for VHVP-1 showed color development in the homologous antigen wells, and T lines were also observed in the MBP, VP28, and nsp1 detection groups. This result indicates that the VHVP-1 test strip has a certain degree of cross-reactivity with the above proteins, and its detection specificity needs further optimization.

[0154] Test Example 3: Sensitivity Detection of Colloidal Gold Test Strips The colloidal gold test strip combination with good color development in Test Example 1 was selected (Table 5). 100 μL of antigen protein samples with concentrations of 100 μg / mL, 50 μg / mL, 25 μg / mL, 12.25 μg / mL, 6.25 μg / mL and 3.125 μg / mL, respectively, were added to test strips 1-3. The color development was observed after 10 min.

[0155] The results of test example 3 are as follows Figure 23 As shown, the sensitivity of the VHVP-1 test strip is 12.5 μg / mL; the sensitivity of the VHVP-2 test strip is 6.25 μg / mL; and the sensitivity of the VHVP-3 test strip is 12.5 μg / mL.

[0156] Test Example 4: Actual Sample Testing Commercially available Litopenaeus vannamei shrimp were used in the experiment. Before the experiment, Vibrio parahaemolyticus strains were inoculated onto LB liquid medium and cultured overnight at 37°C and 180 rpm with shaking. The resulting bacterial suspension was centrifuged for 20 min. The suspension was resuspended in PBS, and then resuspended once more in sterile filtered seawater. Finally, the bacterial count was performed using a hemocytometer under an optical microscope to achieve a bacterial concentration of 1.0 × 10⁻⁶. 9 CFU / mL. Litopenaeus vannamei was randomly divided into an experimental group and a control group. Based on the preliminary experimental results, the experimental group was treated as follows: First, the shrimp in the experimental group were placed in a high-concentration bacterial solution (1.0 × 10⁻⁶ CFU / mL). 9 Soak for 15 min at a concentration of CFU / mL. Then, dilute the soaked bacterial solution with seawater to a concentration of 1.0 × 10⁻⁶ CFU / mL. 7 The concentration was measured in CFU / mL. The control group shrimp were raised in normal seawater without any treatment. The rearing conditions were: water temperature 26±1℃, pH 8.0±0.2, and salinity 30‰. Until the cumulative mortality rate of the experimental group shrimp reached approximately 50%, 6 surviving shrimp from the control group and 3 from the experimental group were randomly collected. 20 mg of hepatopancreatic tissue was extracted from each shrimp, and DNA was extracted using a marine animal tissue genomic DNA extraction kit. Real-time quantitative PCR was used to detect TPV infection.

[0157] The RT-PCR reaction system was as follows: 1 μL template DNA, 0.4 μL TPV-VHVP-2-F (SEQ ID NO.24) (10 μM), 0.4 μL TPV-VHVP-2-R (SEQ ID NO.25) (10 μM), 10 μL ChamQ SYBR qPCR Master Mix, and ddH2O was added to make up to 20 μL.

[0158] SEQ ID NO.24: 5'-GCTCTGGCACCACCGACCTAAT-3'; SEQ ID NO. 25: 5'-CCTTCAGGCAACGATACACGGAATG-3'.

[0159] The RT-PCR reaction program was as follows: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 10 s, 55℃ annealing for 30 s, for a total of 40 cycles.

[0160] The results are as follows Figure 24-25 As shown in Table 6, 10-fold serial dilutions of the TPV-VHVP-2 recombinant plasmid were used to establish an RT-PCR standard curve. The Ct value gradually increased with decreasing template copy number, showing a strong linear relationship. The regression equation for the standard curve was: Y = -3.339X + 38.82, and the correlation coefficient R0 was [value missing]. 2 =0.9901, indicating that the standard curve has good reliability. Shrimp in the TPV-treated group showed high viral load, with an average Ct value of approximately 25.9, significantly lower than the control group, confirming successful TPV infection of the experimental samples. The test strips used to detect VHVP-1, VHVP-2, and VHVP-3 antigens in the positive samples all showed varying degrees of T-line development, while the test strips used to detect the control group only showed a single C-line. Figure 25 This result indicates that the colloidal gold immunochromatographic test strip based on nanobodies has good accuracy.

[0161] Table 6 Comparison of detection results between colloidal gold test strips and real-time qPCR ;

[0162] Test Example 5 Referring to Test Example 2, 100 μL of pathogen protein at a concentration of 0.1 mg / mL was tested using a colloidal gold test strip prepared with rabbit polyclonal antibody as the gold-labeled antibody, nanobody as the T-line antibody (wherein, T-line antibody number 1 is VHH-VHVP-1 used to detect VHVP-1 antigen protein; T-line antibody number 2 is VHH-VHVP-2 used to detect VHVP-2 antigen protein; and T-line antibody C is vNAR-VHVP-3 used to detect VHVP-3 antigen protein), and C-line antibody is goat anti-rabbit antibody. The results showed that... Figure 22 The specific test results of three essentially identical colloidal gold antigen test strips indicate that the shrimp farming water sample contains TPV virus.

[0163] Test Example 6 Referring to Test Example 2, 100 μL of pathogenic protein at a concentration of 0.1 mg / mL was tested using a colloidal gold test strip prepared with rabbit polyclonal antibody as the gold-labeled antibody, nanobody as the T-line antibody (wherein, T-line antibody number 1 is VHH-VHVP-1 used to detect VHVP-1 antigen protein; T-line antibody number 2 is VHH-VHVP-2 used to detect VHVP-2 antigen protein; and T-line antibody C is vNAR-VHVP-3 used to detect VHVP-3 antigen protein), and goat anti-rabbit antibody as the C-line antibody. The results showed that... Figure 22 The specific test results of three essentially identical colloidal gold antigen test strips indicate that the shrimp farming feed solution contains TPV virus.

[0164] Therefore, it can be concluded that the nanobodies provided by this invention bind well to colloidal gold, producing a total of three antibody combinations. The first antibody combination specifically recognizes the VHVP-1 antigen protein and includes: a rabbit polyclonal antibody as the first gold-labeled antibody, a first T-line antibody with the amino acid sequence SEQ ID NO.18, and a goat anti-rabbit antibody as the first C-line antibody. The second antibody combination specifically recognizes the VHVP-2 antigen protein and includes: a rabbit polyclonal antibody as the second gold-labeled antibody, a second T-line antibody with the amino acid sequence SEQ ID NO.19, and a goat anti-rabbit antibody as the second C-line antibody. The third antibody combination specifically recognizes the VHVP-3 antigen protein and includes: a rabbit polyclonal antibody as the third gold-labeled antibody, a third T-line antibody with the amino acid sequence SEQ ID NO.23, and a goat anti-rabbit antibody as the third C-line antibody.

[0165] The test strips prepared using the above three antibody combinations specifically identify the VHVP-1, VHVP-2, and VHVP-3 proteins of the TPV virus. Within 10 minutes, they can rapidly detect whether shrimp and other farmed aquatic animals are infected with the TPV virus, whether the aquaculture water contains the TPV virus, or whether farmed feed and live bait are contaminated with the TPV virus. This solves the problem of effective prevention and efficient monitoring of diseases in shrimp farming, laying the foundation for rapid TPV virus detection. It can also provide a reference model for the early detection of pathogens in other farmed animals and has wide applicability.

[0166] In the foregoing description of exemplary embodiments / specific implementations of this application, various features of this application are sometimes combined in a single embodiment / specification or its figures and description, with the aim of simplifying the disclosure and aiding in the understanding of one or more of the various inventive aspects. However, the descriptive approach of this application should not be construed as reflecting an intention that the claimed features are more than expressly stated in each claim, except where expressly stated otherwise or in obvious technical contradictions or exclusions are found. Rather, the inventive aspects reflected in the claims lie in not all features of a single foregoing disclosed embodiment / specification. Therefore, the claims following the detailed description are hereby expressly incorporated into this detailed description, each claim existing independently as a separate embodiment / specification of this application.

[0167] The terms and expressions used in this specification are illustrative and not limiting. Their use is not intended to exclude any equivalents of the shown and described features or portions thereof, but rather to facilitate the understanding that various modifications may be possible within the scope of the claims. Therefore, it should be understood that while this application has been specifically disclosed through preferred embodiments, exemplary embodiments, and optional features, variations or modifications of the concepts disclosed herein may be adopted by those skilled in the art, and such variations and modifications are therefore considered to be within the scope of this application as defined by the appended claims. The specific embodiments given in this specification are examples of useful embodiments of this application, and it will be apparent to those skilled in the art that this application can be implemented using many variations of the devices, device components, and method steps disclosed herein.

[0168] The foregoing description of specific embodiments has fully disclosed the general features of this application, enabling others to easily modify and / or adapt such embodiments for various applications by applying knowledge within the scope of the art, without excessive experimentation or deviation from the general concept of this application. Therefore, based on the teachings and guidance provided herein, it is intended that such modifications and alterations be included within the meaning and scope of equivalents of the disclosed embodiments. It should be understood that the wording or terminology used herein is for descriptive purposes and is not intended to be limiting; thus, the wording or terminology in this specification will be interpreted by those skilled in the art based on the foregoing teachings and guidance.

[0169] Furthermore, the scope of this application should not be limited to any of the exemplary embodiments described above, but only to the appended claims and their equivalents.

Claims

1. A nanobody for targeted detection of Vibrio parahaemolyticus virulence protein in shrimp glassy seedlings, characterized in that, The amino acid sequence of the nanobody is SEQ ID NO.18, SEQ ID NO.20, SEQ ID NO.21 or SEQ ID NO.

23.

2. The nanobody according to claim 1, characterized in that, The amino acid sequence of the anti-VHVP-1 nanobody is as stated in SEQ ID NO.18 or SEQ ID NO.21; The anti-VHVP-1 nanobody is used to detect the Vibrio parahaemolyticus virulence protein, which is the VHVP-1 protein. The nucleotide sequence of the gene encoding the VHVP-1 protein is shown in SEQ ID NO.

1.

3. The nanobody according to claim 2, characterized in that, SEQ ID NO.18 is of alpaca origin; SEQ ID NO.21 is of shark origin.

4. The nanobody according to claim 1, characterized in that, The amino acid sequence of the anti-VHVP-3 nanobody is as stated in SEQ ID NO.20 or SEQ ID NO.23; The anti-VHVP-3 nanobody is used to detect the Vibrio parahaemolyticus virulence protein, which is the VHVP-3 protein. The nucleotide sequence of the gene encoding the VHVP-3 protein is shown in SEQ ID NO.

3.

5. The nanobody according to claim 4, characterized in that, SEQ ID NO.20 is of alpaca origin; SEQ ID NO.23 is of shark origin.

6. A shrimp larvae detection product comprising nanoantibodies as described in any one of claims 1-5.

7. The shrimp larvae testing product according to claim 6, characterized in that, The product for detecting glass shrimp larvae is a reagent or test strip; The test strips include immunochromatographic test strips prepared using any one of the labeling techniques of colloidal gold labeling, colloidal carbon labeling, fluorescent microsphere labeling, and nanoparticle labeling.

8. The shrimp larvae testing product according to claim 7, characterized in that, The shrimp glass larvae testing product includes a first antibody combination or a third antibody combination; The first antibody combination is used to specifically recognize the VHVP-1 antigen protein. The first antibody combination consists of: a rabbit polyclonal antibody as the first gold-labeled antibody, a first T-line antibody with the amino acid sequence SEQ ID NO.18, and a goat anti-rabbit antibody as the first C-line antibody. The third antibody combination is used to specifically recognize the VHVP-3 antigen protein. The third antibody combination consists of: a rabbit polyclonal antibody as the third gold standard antibody, a third T-line antibody with the amino acid sequence SEQ ID NO.23, and a goat anti-rabbit antibody as the third C-line antibody.

Citation Information

Patent Citations

  • Group of shark nano antibodies targeting infectious subcutaneous and hematopoietic necrosis viruses of prawns and preparation method of shark nano antibodies

    CN119638825A

  • Camel source nano antibodies targeting pathogenic factors of acute hepatopancreatic necrosis disease of prawns and preparation method of camel source nano antibodies

    CN118515754A