A bovine coronavirus polyepitope fusion protein, encoding gene thereof and use in detecting bovine coronavirus antibody

Abstract

The application discloses a bovine coronavirus multi-epitope fusion protein, a coding gene thereof and application of the bovine coronavirus multi-epitope fusion protein in detection of bovine coronavirus antibodies. The multi-epitope fusion protein comprises at least one antigen epitope of a bovine coronavirus HE protein and at least one antigen epitope of an S protein, and the antigen epitopes are connected by flexible connecting peptides. The application further discloses a coding gene for coding the multi-epitope fusion protein, a recombinant plasmid comprising the coding gene and a kit comprising the multi-epitope fusion protein. The multi-epitope fusion protein provided by the application has the characteristics of high expression amount and good immunogenicity, and the enzyme-linked immunosorbent assay and the magnetic microparticle chemiluminescence method detection kit based on the protein have the advantages of high sensitivity, strong specificity, good repeatability and the like, and can be used for rapid detection of bovine coronavirus antibodies and epidemiological investigation.

Description

Technical Field

[0001] This application relates to the technical field of bovine coronavirus antibody detection, specifically to a bovine coronavirus multi-epitope fusion protein and its encoding gene, and its use in detecting bovine coronavirus antibodies. Background Technology

[0002] Bovine coronavirus (BCoV) is a single-stranded positive-sense RNA virus belonging to the genus Coronavirus in the family Coronaviridae. Coronavirus This virus can cause diarrhea and respiratory infections in newborn calves and winter diarrhea in adult cattle. Therefore, the detection and prevention of bovine coronavirus is of significant practical importance.

[0003] Common laboratory testing methods for bovine coronavirus include etiological detection, immunological detection, and molecular biological detection. Among these, etiological detection methods are complex and expensive, making them unsuitable for rapid clinical diagnosis. Immunological detection methods, particularly ELISA, are simple, sensitive, and specific, suitable for large-scale clinical sample testing. Molecular biological detection methods, primarily PCR and its derivatives, offer high sensitivity and specificity, but are limited by thermal cycling, requiring temperature-controlled instruments and specialized technicians, resulting in high costs and complex procedures, making them unsuitable for large-scale testing. Currently reported BCoV antibody ELISA methods mostly use prokaryotically expressed single proteins as coating antigens. However, prokaryotically expressed proteins lack post-translational modifications and processing in eukaryotes, potentially leading to non-functional or misfolded proteins that cannot specifically react with antibodies in the test serum, easily resulting in false negatives.

[0004] BCoV primarily encodes five structural proteins: nucleocapsid protein (N), envelope protein (M), small membrane protein (E), hemagglutinin esterase protein (HE), and spike protein (S). The BCoV S protein contains the main antigenic site, binds to sialic acid (SA) on the host surface, and participates in viral adsorption and membrane fusion with host cells, promoting the production of effective neutralizing antibodies. The BCoV HE protein possesses acetylesterase and hemagglutination activities, and can synergistically attach to the cell surface with the S protein to initiate infection. Both the BCoV S and HE proteins exhibit good antigenicity and can serve as target proteins for bovine coronavirus antibody detection. Summary of the Invention

[0005] In view of this, this application provides a bovine coronavirus multi-epitope fusion protein, its encoding gene, and its use in the detection of bovine coronavirus antibodies. The bovine coronavirus multi-epitope fusion protein of this application, as a coating antigen and a labeling antigen, can specifically bind to bovine coronavirus antibodies, thereby improving detection sensitivity and detection limit.

[0006] In a first aspect of this application, a bovine coronavirus multi-epitope fusion protein is provided, the bovine coronavirus multi-epitope fusion protein comprising at least one HE protein antigenic epitope selected from SEQ ID NO.19 and SEQ ID NO.20, at least one S protein antigenic epitope selected from SEQ ID NO.21 and SEQ ID NO.22, and a flexible linker peptide connecting each antigenic epitope, the amino acid sequence of the flexible linker peptide being shown in SEQ ID NO.23.

[0007] Furthermore, the amino acid sequence of the bovine coronavirus multi-epitope fusion protein is any one of SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31 or SEQ ID NO.32.

[0008] Furthermore, the amino acid sequence of the bovine coronavirus multi-epitope fusion protein is shown in SEQ ID NO.32.

[0009] Secondly, this application provides a coding gene that encodes the bovine coronavirus multi-epitope fusion protein described in the first aspect.

[0010] Furthermore, the coding gene comprises a coding sequence for at least one HE protein antigenic epitope selected from SEQ ID NO.2 and SEQ ID NO.4, a coding sequence for at least one S protein antigenic epitope selected from SEQ ID NO.6 and SEQ ID NO.8, and a gene fragment encoding a flexible linker peptide as described in the first aspect, the nucleotide sequence of the gene fragment encoding the flexible linker peptide being shown in SEQ ID NO.9.

[0011] Furthermore, the nucleotide sequence of the encoding gene is any one of SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17 or SEQ ID NO.18.

[0012] Furthermore, the nucleotide sequence of the encoding gene is shown in SEQ ID NO.18.

[0013] Thirdly, this application provides a recombinant plasmid containing the coding gene described in the second aspect.

[0014] Fourthly, this application provides a kit for detecting bovine coronavirus antibodies, the kit comprising a coated antigen and a labeled antigen; The coating antigen is the bovine coronavirus multi-epitope fusion protein described in the first aspect; The labeled antigen is the bovine coronavirus multi-epitope fusion protein described in the first aspect, which is labeled with an enzyme label or a chemiluminescent label.

[0015] Furthermore, the kit is an enzyme-linked immunosorbent assay (ELISA) kit, and the labeled antigen is a bovine coronavirus multi-epitope fusion protein labeled with horseradish peroxidase.

[0016] The labeled antigen is the bovine coronavirus multi-epitope fusion protein of the first aspect of this application labeled with HRP.

[0017] The working principle of the kit for detecting bovine coronavirus antibodies based on enzyme-linked immunosorbent assay (ELISA) is as follows: A double-antigen sandwich method is used to determine whether a sample contains bovine coronavirus antibodies. An ELISA plate is coated with bovine coronavirus antigen (i.e., the multi-epitope fusion protein SEQ ID NO.32 of this application) to prepare a stationary phase. The sample is added to the wells of the coated ELISA plate and then binds to the HRP-labeled bovine coronavirus antigen (i.e., the multi-epitope fusion protein SEQ ID NO.32 of this application) to form an antigen-antibody-ELISA antigen complex. After washing, a two-component 3,3',5,5'-tetramethylbenzidine (TMB) chromogenic solution is added. TMB is converted to blue under the catalysis of HRP, and finally to yellow under acidic conditions. The color intensity is positively correlated with the content of bovine coronavirus antibodies in the sample. The absorbance (OD value) is measured at 450 nm using an ELISA reader, and the presence of bovine coronavirus antibodies in the sample is calculated based on the OD value.

[0018] Furthermore, the kit is a magnetic microparticle chemiluminescence assay kit; the coating antigen is a biotin-labeled bovine coronavirus multi-epitope fusion protein, and the labeling antigen is an acridinium-labeled bovine coronavirus multi-epitope fusion protein; the kit also includes streptavidin magnetic beads.

[0019] The coating antigen is a biotin-labeled bovine coronavirus multiepitope fusion protein as described in the first aspect of this application; The labeled antigen is an acridinium ester-labeled bovine coronavirus multi-epitope fusion protein as described in the first aspect of this application.

[0020] The working principle of the kit for detecting bovine coronavirus antibodies based on magnetic microparticle chemiluminescence is as follows: Utilizing a sandwich immunoassay combined with magnetic microparticle separation technology, the sample to be tested is mixed and incubated with biotin-labeled multi-epitope fusion protein (SEQ ID NO. 32 of this application), acrid ester-labeled multi-epitope fusion protein (SEQ ID NO. 32 of this application), and streptavidin magnetic beads to form an immune complex. After removing unbound impurities by washing with solid-phase carrier magnetic microparticles, a luminescent substrate is added to induce luminescence, and the relative luminescence intensity (RLU) is measured. Within a certain range, RLU is directly proportional to the bovine coronavirus antibody titer. The instrument's built-in standard curve outputs the RLU = corresponding bovine coronavirus antibody titer value.

[0021] Fifthly, this application provides the use of the bovine coronavirus multi-epitope fusion protein described in the first aspect, the encoding gene described in the second aspect, or the recombinant plasmid described in the third aspect in the preparation of a kit for detecting bovine coronavirus antibodies.

[0022] This application has the following beneficial effects: 1. High expression levels of multi-epitope fusion proteins This invention recombinantly fuses the dominant linear antigenic epitopes of bovine coronavirus HE and S proteins using flexible linker peptides to construct various combinations of multi-epitope fusion proteins. SDS-PAGE validation confirmed that all nine constructed multi-epitope fusion proteins (SEQ ID NO. 24-32) were successfully expressed in Pichia pastoris. The fusion protein containing four epitopes (SEQ ID NO. 32) showed significantly higher expression levels than other combinations, providing a sufficient antigen source for subsequent kit preparation.

[0023] 2. High detection sensitivity Using the multi-epitope fusion protein shown in SEQ ID NO. 32 as the coating and labeling antigen, the established enzyme-linked immunosorbent assay (ELISA) kit can detect a 1024-fold diluted bovine coronavirus antibody positive control, and the established magnetic particle chemiluminescence assay kit can detect a 2048-fold diluted positive control. This indicates that the detection method provided by this invention has extremely high sensitivity and can effectively identify low-titer antibody samples.

[0024] 3. High detection specificity The kit of this invention was used to simultaneously detect positive sera for bovine coronavirus, bovine viral diarrhea virus, brucellosis, bovine parainfluenza virus type 3, bovine infectious rhinotracheitis, and bovine rotavirus. The results showed that only bovine coronavirus sera were positive, while the other virus sera were negative. This indicates that the detection method provided by this invention has no cross-reactivity with antibodies against other common bovine pathogens and exhibits high specificity.

[0025] 4. Good repeatability Twenty repeated tests were performed on serum samples with strong positive, positive, weak positive, and negative results. The coefficient of variation (COP) for the enzyme-linked immunosorbent assay (ELISA) kit was 2.30%–4.84%, and for the magnetic microparticle chemiluminescence assay kit it was 2.18%–3.44%, both below 5%. This indicates that the detection method provided by this invention has excellent repeatability and stability.

[0026] 5. High clinical concordance rate The two detection methods established in this invention were used to simultaneously detect 170 clinical serum samples. The overall concordance rate between the two methods reached 97.65%, and the Kappa value was 0.943, indicating that the two detection methods have a high degree of consistency and can be used for clinical detection and epidemiological investigation of bovine coronavirus antibodies.

[0027] 6. Flexible testing platform The multi-epitope fusion protein provided by this invention can be applied to both enzyme-linked immunosorbent assay (ELISA) and magnetic microparticle chemiluminescence assay (MIL-C) platforms. Both platforms exhibit excellent detection performance and have promising application prospects and promotional value. Attached Figure Description

[0028] Figure 1 This is a DNA agarose gel electrophoresis image from Example 2 of this application.

[0029] Wherein, M: DNA Marker; 1: pPICZαA empty vector; 2-10: recombinant plasmids carrying the coding genes SEQ ID NO. 10-18 respectively; Figure 2 This is an SDS-PAGE protein gel electrophoresis image from Example 3 of this application.

[0030] Wherein, M: 180 kDa protein marker; 1-9: proteins expressed by recombinant plasmids carrying the encoding genes SEQ ID NO.10-18, respectively. Detailed Implementation

[0031] This application discloses a bovine coronavirus multi-epitope fusion protein and its encoding gene, as well as its use in detecting bovine coronavirus antibodies. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this application. The methods and applications of this application have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this application to implement and apply the technology of this application.

[0032] To make the objectives, technical solutions, and advantages of this application clearer, the implementation schemes of this application will be further described in detail below with reference to the embodiments.

[0033] Example 1 (Preparation of coding gene): In this embodiment, the method for preparing the coding gene includes the following steps: Screening and codon optimization of S101 and HE protein antigenic epitope sequences: The full-length gene sequence of the BCoV XJ-SHZ-37 strain (GenBank accession number: OR750853) was retrieved from the DNA sequence database GenBank for analysis. The HE protein gene sequence was selected, and antigenic epitope prediction analysis was performed using the online biological software ABCPred and DNAStar-Protean software. Two dominant linear antigenic epitope sequences with relatively concentrated antigenic epitopes were selected.

[0034] One of the dominant linear antigenic epitope sequences has the nucleotide sequence shown in SEQ ID NO.1; this dominant linear antigenic epitope sequence is optimized according to the Pichia pastoris preferred codons, and the codon-optimized dominant linear antigenic epitope sequence has the nucleotide sequence shown in SEQ ID NO.2.

[0035] Another dominant linear antigenic epitope sequence has the nucleotide sequence shown in SEQ ID NO.3; this dominant linear antigenic epitope sequence was optimized according to the preferences of Pichia pastoris, and the codon-optimized dominant linear antigenic epitope sequence has the nucleotide sequence shown in SEQ ID NO.4.

[0036] Screening and codon optimization of S102 and S protein gene antigenic epitope sequences: The full-length gene sequence of the BCoV XJ-SHZ-37 strain (GenBank accession number: OR750853) was retrieved from the DNA sequence database GenBank for analysis. The S protein gene sequence was selected, and antigenic epitope prediction analysis was performed using the online biological software ABCPred and DNAStar-Protean software. Two dominant linear antigenic epitope sequences with relatively concentrated antigenic epitopes were selected.

[0037] One of the dominant linear antigenic epitope sequences has the nucleotide sequence shown in SEQ ID NO.5; this dominant linear antigenic epitope sequence is optimized according to the Pichia pastoris preferred codons, and the codon-optimized dominant linear antigenic epitope sequence has the nucleotide sequence shown in SEQ ID NO.6.

[0038] Another dominant linear antigenic epitope sequence has the nucleotide sequence shown in SEQ ID NO.7; this dominant linear antigenic epitope sequence was optimized according to the preferences of Pichia pastoris, and the codon-optimized dominant linear antigenic epitope sequence has the nucleotide sequence shown in SEQ ID NO.8.

[0039] S103, Synthesis of encoding genes: In this embodiment, gene recombination is performed based on the codon-optimized nucleotide sequences SEQ ID NO.2 and SEQ ID NO.4 from step S101, and the codon-optimized nucleotide sequences SEQ ID NO.6 and SEQ ID NO.8 from step S102. The gene recombination sequence is as follows: (1) SEQ ID NO.2 and SEQ ID NO.6 in sequence; (2) SEQ ID NO.2 and SEQ ID NO.8 in sequence; (3) SEQ ID NO.4 and SEQ ID NO.6 in sequence; (4) SEQ ID NO.4 and SEQ ID NO.8 in sequence; (5) SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.6 in sequence; (6) SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.8 in sequence; (7) SEQ ID NO.2, SEQ ID NO.6 and SEQ ID NO.8 in sequence; (8) SEQ ID NO.4, SEQ ID NO.6 and SEQ ID NO.8 in sequence; (9) SEQ ID NO.2, SEQ ID NO.6 and SEQ ID NO.8 in sequence. NO.4, SEQ ID NO.6 and SEQ ID NO.8.

[0040] During the recombinant nucleotide sequence process, a nucleotide sequence encoding a flexible linker peptide, SEQ ID NO.9, is inserted between two adjacent nucleotide sequences. Therefore, by repeating the tandem recombination sequence of SEQ ID NO.2 and SEQ ID NO.6, a coding gene with the nucleotide sequence shown in SEQ ID NO.10 is formed; by repeating the tandem recombination sequence of SEQ ID NO.2 and SEQ ID NO.8, a coding gene with the nucleotide sequence shown in SEQ ID NO.11 is formed; by repeating the tandem recombination sequence of SEQ ID NO.4 and SEQ ID NO.6, a coding gene with the nucleotide sequence shown in SEQ ID NO.12 is formed; by repeating the tandem recombination sequence of SEQ ID NO.4 and SEQ ID NO.8, a coding gene with the nucleotide sequence shown in SEQ ID NO.13 is formed; by repeating the tandem recombination sequence of SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6, a coding gene with the nucleotide sequence shown in SEQ ID NO.14 is formed; by repeating the tandem recombination sequence of SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.8, a coding gene with the nucleotide sequence shown in SEQ ID NO.15 is formed; by repeating the tandem recombination sequence of SEQ ID NO.2, SEQ ID NO.6, and SEQ ID NO.6 ...0 is formed; by repeating the tandem recombination sequence of SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6, a coding gene with the nucleotide sequence shown in SEQ ID NO.15 is formed; by repeating the tandem recombination sequence of SEQ ID NO.2, SEQ ID NO.6, and SEQ ID NO.6, a coding gene with the nucleotide sequence shown in SEQ ID NO.10 is formed; by Repeated tandem recombination of SEQ ID NO. 8 yields a coding gene with the nucleotide sequence shown in SEQ ID NO. 16; repeated tandem recombination of SEQ ID NO. 4, SEQ ID NO. 6, and SEQ ID NO. 8 yields a coding gene with the nucleotide sequence shown in SEQ ID NO. 17; repeated tandem recombination of SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, and SEQ ID NO. 8 yields a coding gene with the nucleotide sequence shown in SEQ ID NO. 18.

[0041] Unless otherwise stated, the coding gene of this application was synthesized by General Biotechnology (Anhui) Co., Ltd., and nine positive strains containing the coding gene were obtained, namely bovine coronavirus fusion protein gene positive strains (AMP+).

[0042] Table 1. Sequence information of nucleotide sequences:

[0043] The nucleotide sequence SEQ ID NO.2 encodes the amino acid sequence shown in SEQ ID NO.19; The nucleotide sequence SEQ ID NO.4 encodes the amino acid sequence shown in SEQ ID NO.20; The nucleotide sequence SEQ ID NO.6 encodes the amino acid sequence shown in SEQ ID NO.21; The nucleotide sequence SEQ ID NO. 8 encodes the amino acid sequence shown in SEQ ID NO. 22; The nucleotide sequence SEQ ID NO.9 encodes the amino acid sequence shown in SEQ ID NO.23; The nucleotide sequence SEQ ID NO.10 encodes the amino acid sequence shown in SEQ ID NO.24; The nucleotide sequence SEQ ID NO.11 encodes the amino acid sequence shown in SEQ ID NO.25; The nucleotide sequence SEQ ID NO.12 encodes the amino acid sequence shown in SEQ ID NO.26; The nucleotide sequence SEQ ID NO.13 encodes the amino acid sequence shown in SEQ ID NO.27; The nucleotide sequence SEQ ID NO.14 encodes the amino acid sequence shown in SEQ ID NO.28; The nucleotide sequence SEQ ID NO.15 encodes the amino acid sequence shown in SEQ ID NO.29; The nucleotide sequence SEQ ID NO.16 encodes the amino acid sequence shown in SEQ ID NO.30; The nucleotide sequence SEQ ID NO.17 encodes the amino acid sequence shown in SEQ ID NO.31; The nucleotide sequence SEQ ID NO.18 encodes the amino acid sequence shown in SEQ ID NO.32.

[0044] Table 2. Sequence information of amino acid sequences:

[0045] Example 2 (Construction of recombinant plasmid): In this embodiment, the method for constructing the recombinant plasmid includes the following steps: S201. Nine bovine coronavirus fusion protein gene-positive strains (Amp+) and an E. coli strain containing pPICZαA (Zeocin+) were cultured according to the E. coli culture method. Bovine coronavirus fusion protein gene-positive plasmid and pPICZαA plasmid were extracted according to the TARAKA plasmid extraction kit.

[0046] S202. PCR reaction was performed using a bovine coronavirus fusion protein gene positive plasmid as a template. The reaction procedure was as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 1 min, 72℃ for 1 min, 30 cycles; 72℃ for 10 min.

[0047] S203, agarose gel electrophoresis (120 v 30 min): Bovine coronavirus fusion protein nucleic acid was recovered according to the Tiangen agarose gel DNA recovery kit.

[0048] S204. Following the instructions of the restriction enzyme (Full Gold), double digest the bovine coronavirus fusion protein DNA and pPICZαA plasmid. Perform agarose gel electrophoresis (120 v 30 min) on the products. Recover the bovine coronavirus fusion protein nucleic acid and pPICZαA vector using the Tiangen agarose gel DNA recovery kit.

[0049] S205. Following the instructions for T4 DNA ligase (Full Gold), ligate the digested bovine coronavirus fusion protein nucleic acid and the pPICZαA vector, respectively.

[0050] S206. The ligation product was transferred into DH5α competent cells (Full Gold) for culture. The cultured DH5α cells were then plated on LLB plates (Zeocin+) and cultured overnight.

[0051] S207. Selecting single-clone bacterial strains: PCR amplification of single-clone bacterial strains using the universal primer AOX1 for vector pPICZαA, followed by DNA agarose gel electrophoresis. Figure 1 It can be seen that the insertion direction of the encoding genes SEQ ID NO.10~18 in the recombinant plasmid is correct and the size of the product fragment is confirmed to be in line with expectations.

[0052] Table 3. Sequence information of the universal primer AOX1 for the pPICZαA vector:

[0053] Example 3 (Expression and Identification of Multi-Epitope Fusion Proteins): In this embodiment, the expression and identification of the multi-epitope fusion protein includes the following steps: S301. Preparation of competent yeast cells: Pick cells into YPD culture medium (5 mL) and incubate overnight at 30℃; take 0.1–0.5 mL of the bacterial culture and incubate overnight in 500 mL of fresh YPD culture medium, and measure the bacterial density (OD). 600 =1.3~1.5; Centrifuge at 1500g for 5 min at 4℃, and resuspend the bacterial cells in 500 mL of ice-cold sterile water; Centrifuge at 1500g for 5 min at 4℃, and resuspend in 250 mL of ice-cold sterile water; Centrifuge at 1500g for 5 min at 4℃, and resuspend in 20 mL of ice-cold sorbitol (1M); Centrifuge at 1500g for 5 min at 4℃, and resuspend in 1 mL of ice-cold sorbitol. Aliquot into 1 mL tubes, 100 µL per tube, and store at -80℃.

[0054] S302, linearization of recombinant plasmid: digestion at 37℃ for 2 h, inactivation at 65℃ for 20 min.

[0055] S303, Electroporation Transformation of Yeast: Add 15 µL of linearized recombinant plasmid to 100 µL of prepared competent yeast cells, mix well, pre-cool on ice for 5 min, transfer to a 0.2 cm electroporation cup (pre-cooled on ice), place on ice for 10 min, place in an electroporator, electroporate, remove, quickly return to ice and add 1 mL of pre-cooled 1M sorbitol, mix well, place on a shaker at 30℃ and shake for 40 min, take 300 µL and spread on MD plates, incubate at 30℃ for 2 days.

[0056] S304, Mut+ phenotype induction expression: Select a single colony and place it in a 250 mL shake flask containing BMGY medium (25 mL), and incubate at 30℃ / 250 rpm until OD. 600 =2~6; Centrifuge at 1500~3000 g for 5 min at room temperature, collect the bacterial cells, resuspend the bacterial cells in BMMY medium, and adjust OD... 600 =Approximately 1.0; Place the obtained bacterial culture in a 1 L shake flask, seal it with double-layer gauze, and place it on a shaker at 30℃ / 250 rpm for further cultivation; Add methanol to the culture medium every 24 h until the final concentration is 0.5%; After 72 h, centrifuge the bacterial culture at 12000 rpm for 3 min and collect the supernatant.

[0057] The following multi-epitope fusion proteins expressed by the encoding gene SEQ ID NO. 10 (SEQ ID NO. 24), SEQ ID NO. 11 (SEQ ID NO. 11), SEQ ID NO. 12 (SEQ ID NO. 12), SEQ ID NO. 13 (SEQ ID NO. 13), SEQ ID NO. 14 (SEQ ID NO. 14), SEQ ID NO. 15 (SEQ ID NO. 15), SEQ ID NO. 16 (SEQ ID NO. 16), SEQ ID NO. 17 (SEQ ID NO. 17), and SEQ ID NO. 18 (SEQ ID NO. 18) were identified by SDS-PAGE protein gel electrophoresis: SEQ ID NO. 24, SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 28, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 30, SEQ ID NO. 17, SEQ ID NO. 18, and SEQ ID NO. 32. Figure 2 It can be seen that the multi-epitope fusion proteins expressed by genes SEQ ID NO.10–13, namely SEQ ID NO.24–27, have obvious protein bands of 17 kDa; the multi-epitope fusion proteins expressed by genes SEQ ID NO.14–17, namely SEQ ID NO.28–31, have obvious protein bands of 24 kDa; and the multi-epitope fusion protein expressed by gene SEQ ID NO.18, namely SEQ ID NO.32, has obvious protein bands of 31 kDa, which is the same as expected.

[0058] Furthermore, the expression level of the multi-epitope fusion protein SEQ ID NO.32 expressed by the gene encoding SEQ ID NO.18 was superior to the expression levels of the multi-epitope fusion proteins SEQ ID NO.24–27 and SEQ ID NO.28–31 expressed by the genes encoding SEQ ID NO.10–13 and SEQ ID NO.14–17.

[0059] The amino acid sequences of the nine multi-epitope fusion proteins successfully verified by SDS-PAGE in Example 3 were determined, and the results are shown in Table 2. Each fusion protein is composed of a flexible linker peptide (SEQ ID NO. 23) tandemly linked from HE protein antigenic epitopes (SEQ ID NO. 19 and / or SEQ ID NO. 20) and S protein antigenic epitopes (SEQ ID NO. 21 and / or SEQ ID NO. 22), with the specific composition as follows: SEQ ID NO.24: Consists of 3 alternating repeats of the HE epitope (SEQ ID NO.19) and the S epitope (SEQ ID NO.21) (a total of 6 epitope units), with the linker peptide being SEQ ID NO.23.

[0060] SEQ ID NO.25: Consists of 3 alternating repeats of the HE epitope (SEQ ID NO.19) and the S epitope (SEQ ID NO.22) (a total of 6 epitope units), with the linker peptide being SEQ ID NO.23.

[0061] SEQ ID NO.26: Consists of 3 alternating repeats of HE epitope (SEQ ID NO.20) and S epitope (SEQ ID NO.21) (a total of 6 epitope units), with the linker peptide being SEQ ID NO.23.

[0062] SEQ ID NO.27: Consists of 3 alternating repeats of HE epitope (SEQ ID NO.20) and S epitope (SEQ ID NO.22) (a total of 6 epitope units), with the linker peptide being SEQ ID NO.23.

[0063] SEQ ID NO.28: Composed of HE epitope (SEQ ID NO.19), HE epitope (SEQ ID NO.20) and S epitope (SEQ ID NO.21) repeated 3 times in sequence (a total of 9 epitope units), with the linker peptide being SEQ ID NO.23.

[0064] EQ ID NO.29: Composed of HE epitope (SEQ ID NO.19), HE epitope (SEQ ID NO.20) and S epitope (SEQ ID NO.22) repeated 3 times in sequence (a total of 9 epitope units), with the linker peptide being SEQ ID NO.23.

[0065] SEQ ID NO.30: Composed of HE epitope (SEQ ID NO.19), S epitope (SEQ ID NO.21) and S epitope (SEQ ID NO.22) repeated 3 times in sequence (a total of 9 epitope units), with the linker peptide being SEQ ID NO.23.

[0066] SEQ ID NO.31: Composed of HE epitope (SEQ ID NO.20), S epitope (SEQ ID NO.21) and S epitope (SEQ ID NO.22) repeated 3 times in sequence (a total of 9 epitope units), and the linker peptide is SEQ ID NO.23.

[0067] SEQ ID NO.32: Composed of HE epitope (SEQ ID NO.19), HE epitope (SEQ ID NO.20), S epitope (SEQ ID NO.21) and S epitope (SEQ ID NO.22) repeated 3 times in sequence (a total of 12 epitope units), with the linker peptide being SEQ ID NO.23.

[0068] The sequence determination results were completely consistent with the expected amino acid sequence, confirming that each multi-epitope fusion protein had been successfully expressed and that the sequence was correct.

[0069] Example 4 (Reagent kit for detecting bovine coronavirus antibodies based on enzyme-linked immunosorbent assay): In this embodiment, the main components of the kit for detecting bovine coronavirus antibodies based on enzyme-linked immunosorbent assay (ELISA) are: a microplate coated with a multi-epitope fusion protein, horseradish peroxidase-labeled multi-epitope fusion protein (HRP-labeled antigen), diluent, washing buffer, luminescent substrate solution A, luminescent substrate solution B, and stop solution.

[0070] The preparation method of the coated ELISA plate specifically includes the following steps: S401. Antigen Coating: Dilute the multi-epitope fusion protein to a final concentration of 2 μg / mL using CBS buffer (pH=9.6). Add 100 μL of the coating solution to each well of the ELISA plate and coat at 4℃ for 12–18 h. Discard the solution in the wells of the ELISA plate. Wash with 300 μL of PBST buffer (0.05% Tween-20, pH=7.4) 5 times, 3 min each time.

[0071] S402. Blocking: Add BSA blocking solution, 200 μL / well, to the microplate obtained in step S401, and block at 37℃ for 2 h. Discard the solution in the wells of the microplate. Add PBST buffer (0.05% Tween-20, pH=7.4) to wash, 300 μL / well, wash 5 times, 3 min / time; to obtain the coated microplate.

[0072] The BSA blocking solution was prepared by diluting bovine serum albumin (BSA) with PBS buffer (pH=7.4), and the concentration of the BSA blocking solution was 2% (w / v).

[0073] Luminescent substrate solution A: prepared from 3,3',5,5'-tetramethylbenzidine (200 mg) and anhydrous ethanol (100 mL).

[0074] Luminescent substrate solution B: Add water for injection to 900 mL of Na2HPO4 (14.6 g) and citric acid (9.33 g), adjust the pH to 5.0-5.4, and then add water for injection to bring the volume to 1000 mL.

[0075] In this embodiment, the working principle of the kit for detecting bovine coronavirus antibodies based on enzyme-linked immunosorbent assay (ELISA) is as follows: A double-antigen sandwich method is used to determine whether a sample contains bovine coronavirus antibodies. An ELISA plate is coated with bovine coronavirus antigen to form a stationary phase. The sample is added to the wells of the coated plate and then binds to HRP-labeled bovine coronavirus antigen, forming an antigen-antibody-enzyme-labeled antigen complex. After washing, a two-component 3,3',5,5'-tetramethylbenzidine (TMB) chromogenic solution is added. TMB is converted to blue under the catalysis of HRP, and finally to yellow under acidic conditions. The color intensity is positively correlated with the content of bovine coronavirus antibodies in the sample. The absorbance (OD value) is measured at 450 nm using an ELISA reader, and the presence of bovine coronavirus antibodies in the sample is calculated based on the OD value.

[0076] In this embodiment, the bovine coronavirus antigen is the multi-epitope fusion protein shown in SEQ ID NO.32 (i.e., a fusion protein containing four epitopes: HE protein epitopes SEQ ID NO.19 and SEQ ID NO.20, and S protein epitopes SEQ ID NO.21 and SEQ ID NO.22).

[0077] The working process of the kit for detecting bovine coronavirus antibodies based on enzyme-linked immunosorbent assay (ELISA) includes the following steps: S501. Preparation of the test sample: Dilute the serum sample to be tested 10 times with PBST buffer (0.05 v / v Tween-20, pH=7.4); specifically: 20 μL of serum sample to be tested and 180 μL of PBST buffer.

[0078] S502. Incubation: Add negative control, positive control and test sample to the coated microplate, 100 μL / well, and mix well; then add HRP-labeled multi-epitope fusion protein solution, 50 μL / well, and mix well; seal the microplate with sealing film and incubate at 37℃ for 10 min.

[0079] The HRP-labeled multi-epitope fusion protein solution was prepared by diluting the HRP-labeled multi-epitope fusion protein with PBST buffer (0.05 v / v Tween-20, pH=7.4) at a dilution ratio of 1:10000 (w / v).

[0080] S503, Washing: Discard the solution in the wells of the microplate, add PBST buffer (0.05% Tween-20, pH=7.4) to wash, 300 μL / well, wash 5 times, 3 min / wash.

[0081] S504, color development and termination: Add 100 μL of two-component TMB color development solution (prepared by mixing luminescent substrate solution A and luminescent substrate solution B in a 1:1 volume ratio) to the microplate, mix well, and develop color at 37°C in the dark for 10 min; then add 50 μL of 2 M concentrated sulfuric acid to the microplate and gently shake the microplate until the color development is uniform.

[0082] S505, Reading: Place the microplate into the microplate reader and measure and read the absorbance OD value under dual wavelength conditions of 450 nm for testing and 630 nm for reference.

[0083] Result determination: The OD value of negative control samples is denoted as ODN, the OD value of positive control samples is denoted as ODP, and the OD value of the test sample is denoted as ODS; Cut-off value (threshold) = ODN + 0.15; The test is valid if the ODN value is ≤0.1 and the ODP value is ≥0.5; otherwise, the test must be repeated. Result determination: If the ODS value of the sample to be tested is less than or equal to the Cut-Off value, the result is judged as negative; if the ODS value of the sample to be tested is greater than or equal to the Cut-Off value, the result is judged as positive.

[0084] Example 5 (Reagent kit for detecting bovine coronavirus antibodies based on magnetic particle chemiluminescence method): In this embodiment, the working principle of the kit for detecting bovine coronavirus antibodies based on magnetic microparticle chemiluminescence is as follows: The kit combines the double-antigen sandwich immunoassay principle with magnetic microparticle separation technology. The sample to be tested is mixed with biotin-labeled bovine coronavirus antigen, acrid ester-labeled bovine coronavirus antigen, and streptavidin magnetic beads and incubated to form an immune complex. After removing unbound impurities by washing with solid-phase carrier magnetic microparticles, a luminescent substrate is added to induce luminescence, and the relative luminescence intensity (RLU) is measured. Within a certain range, RLU is directly proportional to the bovine coronavirus antibody titer. The instrument's built-in standard curve outputs the RLU = corresponding bovine coronavirus antibody titer value.

[0085] In this embodiment, the bovine coronavirus antigen is the multi-epitope fusion protein shown in SEQ ID NO.32 (i.e., a fusion protein containing four epitopes: HE protein epitopes SEQ ID NO.19 and SEQ ID NO.20, and S protein epitopes SEQ ID NO.21 and SEQ ID NO.22).

[0086] In this embodiment, the main components of the kit for detecting bovine coronavirus antibodies based on magnetic microparticle chemiluminescence are: magnetic bead working solution, biotin-labeled working solution, acrid ester-labeled working solution, pre-excitation solution, excitation solution, calibrator 1, and calibrator 2.

[0087] The working solution for magnetic beads was prepared by mixing 225 µL of streptomycin affinity magnetic beads with 4275 µL of PBS-BSA solution (pH=7.4).

[0088] Biotin-labeled working solution: prepared from 5.5 µg of biotin-labeled multi-epitope fusion protein and 10994.5 µL of PBS-BSA solution (pH=7.4).

[0089] Acridinium ester labeled working solution: prepared from 1.1 µg of acridinium ester labeled multi-epitope fusion protein and 10998.9 µL of PBS-BSA solution (pH=7.4).

[0090] Calibrator 1: Bovine coronavirus-positive bovine serum Calibrator 2: Healthy, non-immunized bovine serum Pre-activation solution: 0.1 mol / L hydrochloric acid solution containing 0.1% hydrogen peroxide.

[0091] Activation solution: 0.25 M sodium hydroxide solution containing 2% Triton X-100.

[0092] The working process of the kit for detecting bovine coronavirus antibodies based on magnetic particle chemiluminescence includes the following steps: Sample (50 μL) and biotin-labeled working solution (50 μL) + magnetic bead working solution (20 μL) were reacted at 37°C for 10 min, washed with 0.1 mol / L PBS buffer, acridinium ester-labeled working solution (50 μL) was added, reacted at 37°C for 10 min, washed with 0.1 mol / L PBS buffer, pre-excitation solution (100 μL) and excitation solution (100 μL) were added, and luminescence was instantaneously detected. The luminescence value was measured.

[0093] Validation condition: If the average luminescence value of calibrator 1 / the average luminescence value of calibrator 2 > 8, the test result is valid; otherwise, the test should be repeated.

[0094] Result determination: S / N value = luminescence value of the sample to be tested / average luminescence value of calibrator 2 A S / N value > 2.5 indicates a positive result; a S / N value ≤ 2.5 indicates a negative result.

[0095] The following are the performance tests of the reagent kit: Example 6 (Sensitivity Test): First, the bovine coronavirus antibody-positive quality control sample was serially diluted 2-fold using PBST buffer (0.05% Tween-20, pH=7.4) to obtain sensitivity control samples diluted 2-fold, 4-fold, 8-fold, 16-fold, 32-fold, 64-fold, 128-fold, 256-fold, 512-fold, 1024-fold, 2048-fold, and 4096-fold, respectively.

[0096] Using sensitive control samples, the sensitivity of the enzyme-linked immunosorbent assay (ELISA) kit based on the SEQ ID NO.32 antigen prepared in Example 4 and the magnetic particle chemiluminescence immunoassay kit based on the SEQ ID NO.32 antigen prepared in Example 5 were tested, and the test results were compared and analyzed. The test results are shown in Table 4. The kit for detecting bovine coronavirus antibodies based on ELISA in this application can detect 1024 times the sensitivity of the control sample, and the kit for detecting bovine coronavirus antibodies based on magnetic particle chemiluminescence immunoassay in this application can detect 2048 times the sensitivity of the control sample.

[0097] Table 4. Sensitivity Test Comparison Results

[0098]

[0099] Example 7 (Specificity Test): The enzyme-linked immunosorbent assay kit based on SEQ ID NO.32 antigen prepared in Example 4 and the magnetic particle chemiluminescence assay kit based on SEQ ID NO.32 antigen prepared in Example 5 were used to simultaneously detect positive sera of the following pathogens: bovine coronavirus, bovine viral diarrhea virus (BVDV), brucellosis (Bru), bovine parainfluenza virus type 3 (BPIV3), bovine infectious rhinotracheitis (IBRV), and bovine rotavirus (BRV). The results are shown in Table 5. This method showed no cross-reactivity with other susceptible animal viruses and had good specificity.

[0100] Table 5. Specificity test results

[0101] Example 8 (Repeatability Test): Four bovine serum samples with known background (one strongly positive bovine coronavirus serum sample, one positive bovine coronavirus serum sample, one weakly positive bovine coronavirus serum sample, and one negative bovine coronavirus serum sample) were selected and tested 20 times using the enzyme-linked immunosorbent assay (ELISA) kit based on the SEQ ID NO.32 antigen prepared in Example 4 and the magnetic particle chemiluminescence immunoassay kit based on the SEQ ID NO.32 antigen prepared in Example 5, respectively. The coefficient of variation (COP) was calculated based on the absorbance or luminescence values ​​of the serum samples. The results are shown in Table 6. The COP of the kit for detecting bovine coronavirus antibodies based on ELISA in this application was 2.30% for strongly positive samples, 3.21% for positive samples, 4.84% for weakly positive samples, and 3.51% for negative serum samples. The COP of the kit for detecting bovine coronavirus antibodies based on magnetic particle chemiluminescence immunoassay in this application was 2.18% for strongly positive samples, 2.90% for positive samples, 3.44% for weakly positive samples, and 3.22% for negative samples. This indicates that the bovine coronavirus antibody detection method established in this application has high reproducibility.

[0102] Table 6. Repeatability Test Results

[0103] Example 9 (Clinical Sample Compliance Test): The enzyme-linked immunosorbent assay kit based on SEQ ID NO.32 antigen prepared in Example 4 and the magnetic particle chemiluminescence assay kit based on SEQ ID NO.32 antigen prepared in Example 5 were used to simultaneously detect 170 clinical samples with known backgrounds. The detection results of the two methods were compared, and the concordance rate between the two methods was calculated. The results are shown in Table 7. The Kappa value of the two methods was 0.943, and the overall concordance rate was 97.65%, indicating that the concordance rate of the two methods was high.

[0104] Table 7. Results of the comparative trial of 170 serum clinical samples

[0105] Clinical samples have validated that the immunoassay kit based on the sandwich method of this invention has high detection sensitivity and strong specificity, and can be used for rapid diagnosis and epidemiological investigation of bovine coronavirus.

[0106] The foregoing provides a detailed description of a bovine coronavirus multi-epitope fusion protein, its encoding gene, and its use in detecting bovine coronavirus antibodies. Specific examples have been used to illustrate the principles and implementation methods of this application. The descriptions of the embodiments above are merely for the purpose of helping to understand the method and core ideas of this application. It should be noted that those skilled in the art can make various improvements and modifications to this application without departing from its principles, and these improvements and modifications also fall within the protection scope of the claims of this application.

Claims

1. A bovine coronavirus multi-epitope fusion protein, characterized in that, The amino acid sequence of the bovine coronavirus multi-epitope fusion protein is: YVGVYDINHGDAGFTS GGGGSGGGGS NVSSVWPLYPYGRCPT GGGGSGGGGS TCAVNYTKAPDVMLNI GGGGSGGGGS TGSGYYYPEPITGNNV GGGGSGGGGS YVGVYDINHGDAGFTS GGGGSGGGGS NVSSVWPLYPYGRCPT GGGGSGGGGS TCAVNYTKAPDVMLNI GGGGSGGGGS TGSGYYYPEPITGNNV GGGGSGGGGS YVGVYDINHGDAGFTS GGGGSGGGGS NVSSVWPLYPYGRCPT GGGGSGGGGS TCAVNYTKAPDVMLNI GGGGSGGGGS TGSGYYYPEPITGNNV; The multi-epitope fusion protein is used for the detection of bovine coronavirus antibodies using a double-antigen sandwich method.

2. A gene encoding a gene, characterized in that, The coding gene encodes the bovine coronavirus multi-epitope fusion protein of claim 1.

3. The encoding gene according to claim 2, characterized in that, The nucleotide sequence of the encoding gene is as follows: TATGTTGGTGTCTACGATATCAACCATGGTGACGCTGGTTTCACAAGT GGTGGTGGTGGTTCTGGTGGTGGT GGTTCT AATGTTTCCTCTGTTTGGCCTTTGTACCCTTATGGTAGATGTCCAACC GGTGGTGGTGGTTCTGGTGGTG GTGGTTCT ACTTGTGCCGTTAACTACACCAAGGCTCCAGACGTCATGCTTAACATC GGTGGTGGTGGTTCTGGTGG TGGTGGTTCT ACTGGTAGTGGTTACTACTACCCAGAGCCTATTACTGGTAACAACGTT GGTGGTGGTGGTTCTGGT GGTGGTGGTTCT TATGTTGGTGTCTACGATATCAACCATGGTGACGCTGGTTTCACAAGT GGTGGTGGTGGTTCTG GTGGTGGTGGTTCT AATGTTTCCTCTGTTTGGCCTTTGTACCCTTATGGTAGATGTCCAACC GGTGGTGGTGGTTC TGGTGGTGGTGGTTCT ACTTGTGCCGTTAACTACACCAAGGCTCCAGACGTCATGCTTAACATC GGTGGTGGTGGT TCTGGTGGTGGTGGTTCT ACTGGTAGTGGTTACTACTACCCAGAGCCTATTACTGGTAACAACGTT GGTGGTGGTG GTTCTGGTGGTGGTGGTTCT TATGTTGGTGTCTACGATATCAACCATGGTGACGCTGGTTTCACAAGT GGTGGTGG TGGTTCTGGTGGTGGTGGTTCT AATGTTTCCTCTGTTTGGCCTTTGTACCCTTATGGTAGATGTCCAACC GGTGGT GGTGGTTCTGGTGGTGGTGGTTCT ACTTGTGCCGTTAACTACACCAAGGCTCCAGACGTCATGCTTAACATC GGTG GTGGTGGTTCTGGTGGTGGTGGTTCT ACTGGTAGTGGTTACTACTACCCAGAGCCTATTACTGGTAACAACGTT。 4. A recombinant plasmid, characterized in that, The recombinant plasmid contains the encoding gene as described in claim 3.

5. A kit for detecting bovine coronavirus antibodies, characterized in that, The kit contains coated antigen and labeled antigen; The coating antigen is the bovine coronavirus multi-epitope fusion protein of claim 1; The labeled antigen is the bovine coronavirus multi-epitope fusion protein of claim 1, labeled with an enzyme marker or a chemiluminescent marker.

6. The reagent kit according to claim 5, characterized in that, The kit is an enzyme-linked immunosorbent assay (ELISA) kit, which contains a microplate coated with the coated antigen, wherein the labeled antigen is a horseradish peroxidase-labeled bovine coronavirus multi-epitope fusion protein.

7. The reagent kit according to claim 5, characterized in that, The kit is a magnetic microparticle chemiluminescence assay kit; the coating antigen is a biotin-labeled bovine coronavirus multi-epitope fusion protein, and the labeling antigen is an acridinium-labeled bovine coronavirus multi-epitope fusion protein; the kit also includes streptavidin magnetic beads.

8. Use of the bovine coronavirus multi-epitope fusion protein of claim 1 in the preparation of a kit for detecting bovine coronavirus antibodies.

Images