Streptomyces nocardia NC-S4 for preventing and treating pathogenic bacteria infection, bacteriostatic agent and application thereof

Abstract

This invention discloses a Streptomyces sp. NC-S4 strain for preventing and controlling pathogenic bacterial infections, a bacteriostatic agent, and its application, belonging to the field of microbiology. The Streptomyces sp. NC-S4 strain for preventing and controlling pathogenic bacterial infections was deposited at the China Center for Type Culture Collection on December 25, 2025, with accession number CCTCC NO: M 20253007. This invention, through the isolation and screening of antagonistic bacteria against Candida albicans and its efficacy tests, isolated and screened a new Streptomyces sp. NC-S4 strain with antagonistic activity against Candida albicans. Based on this, a biocontrol agent was developed, which is of great significance for reducing the use of large amounts of antibiotics, mitigating environmental pollution, and reducing the emergence of drug-resistant bacteria.

Description

Technical Field

[0001] This invention relates to the field of microbiology, and in particular to a Streptomyces NC-S4 strain for preventing and treating pathogenic bacterial infections, a bacteriostatic agent, and its application. Background Technology

[0002] Candida is the most common fungal pathogen in clinical practice. Although Candida albicans is still the main pathogen causing candidiasis in clinical practice, infections caused by other Candida species are becoming increasingly common. For example, the detection rate of Candida hemorrhagicum, which is characterized by drug resistance and easy transmission, is increasing year by year.

[0003] Clinically isolated *Candida simulans* strains are often drug-resistant and exhibit different morphologies under specific growth conditions. These morphologies can interconvert, showing significant differences in gene expression, metabolite production, and virulence. Furthermore, *Candida simulans* can form biofilms on indwelling medical devices, reducing the effectiveness of antibiotics. Therefore, there is an urgent need to develop different control technologies, especially those targeting drug-resistant strains. The use of biocontrol strains and their active products as biocontrol microbial agents to control pathogens is receiving increasing attention. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a Streptomyces NC-S4 strain for preventing and treating pathogenic bacterial infections, an antibacterial agent, and its application. This invention selects clinically isolated Candida albicans CH001 as the target strain, and screens and identifies biocontrol strains with significant antagonistic effects against Candida albicans CH001, which is of great significance for the treatment of Candida albicans infections.

[0005] In a first aspect, the present invention provides a Streptomyces NC-S4 strain for preventing and treating pathogenic bacterial infections, which is achieved through the following technical solution.

[0006] A Streptomyces sp. NC-S4 strain for preventing and treating pathogenic bacterial infections has been classified and named Streptomyces sp.NC-S4. This Streptomyces sp.NC-S4 strain was deposited at the China Center for Type Culture Collection (CCTCC) on December 25, 2025, at Wuhan University, Wuchang District, Wuhan City, Hubei Province, China; the accession number is CCTCC NO: M 20253007.

[0007] Furthermore, when Streptomyces NC-S4 is cultured on LB agar plates, the colonies are round, milky white, opaque, slightly dry and wrinkled on the surface, with irregular edges, not easy to pick up, and embedded on the surface of the solid culture medium.

[0008] Furthermore, the fermentation medium for Streptomyces NC-S4 consisted of 20.0 g / L sucrose, 30.0 g / L soluble starch, 2.0 g / L peptone, 8.0 g / L soybean flour, 0.5 g / L MgSO4·7H2O, 0.5 g / L K2HPO4·7H2O, 2.0 g / L NaCl, 3.0 g / L CaCO3, and an initial pH of 8.0.

[0009] Secondly, the present invention provides the use of Streptomyces NC-S4 for preventing and treating pathogenic bacterial infections, which is achieved through the following technical solutions.

[0010] The application of the above-mentioned Streptomyces NC-S4 in the preparation of drugs for preventing and treating pathogenic bacterial infections.

[0011] Furthermore, the pathogens include Candida krusei (ATCC6258), Candida simulans (CH001), Candida auris (BJCA001), Candida albicans (SC5314), Bacillus belyssus (NC-B4), Bacillus cereus (ATCC14579), Staphylococcus aureus (ATCC29213), and Micrococcus luteus (ATCC 4698).

[0012] Thirdly, the present invention provides an antibacterial agent, which is achieved through the following technical solution.

[0013] An antibacterial agent comprising the aforementioned Streptomyces NC-S4.

[0014] Fourthly, the present invention provides an application of an antibacterial agent, which is achieved through the following technical solution.

[0015] The application of the above-mentioned antibacterial agent in the preparation of drugs for preventing and treating pathogenic bacterial infections.

[0016] Furthermore, the pathogens include Candida krusei (ATCC6258), Candida simulans (CH001), Candida auris (BJCA001), Candida albicans (SC5314), Bacillus belyssus (NC-B4), Bacillus cereus (ATCC14579), Staphylococcus aureus (ATCC29213), and Micrococcus luteus (ATCC 4698).

[0017] The present invention achieves the following technical effects:

[0018] This invention addresses the lack of highly effective and safe drug treatments for Candida simulans infection. Through the isolation, screening, and efficacy testing of antagonistic bacteria against Candida simulans, a new Streptomyces strain NC-S4 with antagonistic activity against Candida simulans was isolated and screened. Based on this, a biocontrol agent was developed, which is of great significance for reducing the use of large amounts of antibiotics, mitigating environmental pollution, and reducing the emergence of drug-resistant bacteria. Attached Figure Description

[0019] Figure 1 This invention presents microbiological characteristic diagrams of Streptomyces NC-S4, including: A. Colony morphology diagram; B. Microscopic morphology diagram; C. Antibacterial effect diagram;

[0020] Figure 2 This is an antibacterial diagram of Streptomyces NC-S4 cultured for 24 hours according to the present invention. Among them, 1-12 are: Candida krusei ATCC6258, Candida simulans CH001, Candida auris BJCA001, Candida albicans SC5314, Escherichia coli ATCC25926, Shigella flexneri ATCC12022, Pseudomonas aeruginosa PAO1, Burkholderia cepacia H111, Bacillus belye NC-B4, Bacillus cereus ATCC14579, Staphylococcus aureus ATCC29213, and Micrococcus luteus ATCC 4698.

[0021] Figure 3 This is a graph showing the cytotoxicity results of different concentrations of the supernatant of Streptomyces NC-S4 in this invention.

[0022] Figure 4 This is a phylogenetic tree diagram of Streptomyces NC-S4 based on multiple genes, as presented in this invention.

[0023] Figure 5 This is a graph showing the results of the inhibition of Candida albicans growth by different concentrations of the supernatant of Streptomyces NC-S4 in this invention. Detailed Implementation

[0024] Preferred embodiments of the present disclosure will be described in detail below with reference to the accompanying drawings. Before description, it should be understood that the terminology used in the specification and appended claims should not be construed as limited to its general and dictionary meaning, but rather should be interpreted based on the principle of allowing the inventors to appropriately define the terminology for the best interpretation, and based on its meaning and concept corresponding to the technical level of the invention. Therefore, the description herein is merely a preferred example for illustrative purposes and is not intended to limit the scope of the invention; thus, it should be understood that other equivalent implementations and modifications can be made without departing from the spirit and scope of the invention.

[0025] The invention will be further described below with reference to the accompanying drawings and embodiments. Unless otherwise specified, the experimental methods used in this invention are conventional methods, and the experimental equipment, materials, reagents, etc. used can all be purchased from relevant material sales companies.

[0026] Example 1: Isolation and purification of bacterial strains

[0027] 1. Culture medium

[0028] Gao's No. 1 culture medium: KNO3 1.0 g, K2HPO4·3H2O 0.5 g, MgSO4·7H2O 0.5 g, NaCl 0.5 g, FeSO4·7H2O 0.01 g, soluble starch 20.0 g, agar 20.0 g, distilled water 1.0 L, pH 7.2-7.4, sterilized at 121℃ for 20 minutes.

[0029] 2. Experimental Procedure

[0030] 2.1 Culture medium preparation

[0031] Prepare Gao's No. 1 agar medium to make bacterial culture plates.

[0032] 2.2 Bacterial Isolation

[0033] Soil samples collected from the North Campus of Jiangxi Agricultural University were ground into small pieces, chopped, and resuspended in sterile water. A soil dilution solution was prepared at a soil-to-sterile-water mass-to-volume ratio of 1:10 (g / ml). -1 Take the supernatant and serially dilute it 10-fold (10 -2 10 -3 10 -4 10 -5 ) for later use. Put 10 -2 10 -3 10 -4 and 10 -5 0.1 ml of each of the four concentrations was spread onto prepared Gao's No. 1 solid culture medium plates containing 0.5% potassium permanganate. The culture dishes were inverted after inoculation and incubated at 28°C for 3 days. Single clones of different morphologies were picked as much as possible.

[0034] 3. Results

[0035] 550 bacterial strains were isolated using the method described above.

[0036] Example 2: Plate antagonism test of isolated bacteria against Candida albicans CH001

[0037] 1. Culture medium

[0038] 1.1 Solid Culture Media

[0039] LB solid medium: 10g tryptone, 5g yeast extract, 10g sodium chloride, 15g agar powder, add distilled water and bring the volume to 1L. Sterilize at 121℃ for 20 minutes.

[0040] 1.2 Liquid culture medium

[0041] LB liquid medium: without agar, otherwise the same as LB solid medium.

[0042] 2. Experimental Procedure

[0043] 2.1 Plate Antagonism Test - Initial Screening

[0044] 2.1.1 Activation of microbial strains

[0045] Activation of Candida albicans and other bacteria: Candida albicans CH001 and isolated bacteria were transferred to LB agar plates and Gao's No. 1 agar plates, respectively, and incubated at 35℃ and 28℃ for 2 days, respectively, for later use.

[0046] 2.1.2 Preparation of Candida albicans agar plates

[0047] Activated Candida albicans was inoculated into LB liquid medium and cultured in shake flasks at 35°C and 200 rpm / min. The next day, LB medium was poured into plates, and after cooling to 45°C, 0.1 ml of Candida albicans fermentation broth (OD) was added to every 15 ml of solid LB medium. 600 =2.0), mix well, pour into a petri dish, and let it dry for later use.

[0048] 2.1.3 Initial screening using plate antagonism test

[0049] Use a sterilized toothpick to pick up a single colony of the activated isolated bacteria and spot it onto a Candida albicans plate. Perform three replicates for each bacterial strain and incubate at 35°C. Observe the experimental results at 24h, 36h, and 48h, mainly observing the presence or absence of inhibition zones.

[0050] 2.2 Plate Antagonism Test - Secondary Screening

[0051] 2.2.1 Activation of microbial strains

[0052] As in Example 2, section 2.1.1, activate and select isolated bacteria with inhibition zones in the initial screening.

[0053] 2.1.2 Preparation of Candida albicans agar plates

[0054] As in Example 2, section 2.1.2, after the flat plate is dried, holes are punched with a 5mm diameter punch for later use.

[0055] 2.2.3 Isolation of bacteria for liquid fermentation

[0056] The fermentation medium was prepared with the following formula: 20.0g sucrose, 30.0g soluble starch, 2.0g peptone, 8.0g soybean flour, 0.5g MgSO4·7H2O, 0.5g K2HPO4·7H2O, 2.0g NaCl, and 3.0g CaCO3, with an initial pH of 8.0. After preparation, it was sterilized by conventional autoclaving.

[0057] The activated and isolated bacteria were transferred to a liquid fermentation culture and cultured in shake flasks at 28°C and 200 rpm / min until the OD reached. 600 =2.0.

[0058] 2.2.4 Plate Antagonism Test for Secondary Screening

[0059] The bacterial fermentation broth was centrifuged at high speed, and the supernatant was collected. 50 μL of the fermentation supernatant was placed into the wells of a Candida albicans agar plate, dried, and cultured in triplicate at 35°C. The experimental results were observed at 24 h, 36 h, and 48 h, mainly focusing on the presence and size of inhibition zones.

[0060] 3. Results

[0061] Bacteria with antagonistic effects were obtained through initial screening tests, and then further screened by perforating plates in a plate antagonism test to obtain bacteria with relatively good antagonistic effects. Strain NC-S4 is one of these strains. See [link to relevant documentation]. Figure 1 , Figure 1 In the middle, A represents the colony morphology of strain NC-S4. Figure 1 Image B shows the microscopic morphology of strain NC-S4. Figure 1 C is obtained by adding 0.1 ml of *Candida simulans* fermentation broth to a plate, then punching holes with a punch, placing the fermentation broth of strain NC-S4 into the holes, drying it, and incubating at 35°C. Figure 1 As can be seen from the C-value, strain NC-S4 exhibits a clear inhibition zone, indicating that it has a significant antagonistic effect against Candida albicans.

[0062] Example 3: Determination of the antibacterial spectrum of fermentation broth of strain NC-S4

[0063] 1. Experimental steps:

[0064] 1.1 Preparation of test bacterial plates

[0065] The *Candida krusei* ATCC6258, *Bacillus cereus* ATCC14579, *Staphylococcus aureus* ATCC29213, *Escherichia coli* ATCC25926, *Shigella flexneri* ATCC12022, and *Micrococcus luteus* ATCC4698 of this invention were purchased from Biofeng (https: / / www.biofeng.com / ).

[0066] Candida auris BJCA001, Candida albicans SC5314, and Bacillus velezensis NC-B4 were selected from the strains described in (Yang C, Cui C, Chen Y, Peng Z. Bacillus velezensis NC-B4 as a promising antifungal agent for biocontrol of Candida auris. Front Cell Infect Microbiol. 2025 Sep 2;15:1515537. doi: 10.3389 / fcimb.2025.1515537.).

[0067] The strain of *Candida auris* CH001 was the one described in (Deng Yuchen. Study on the regulatory mechanism of yeast-hyphae transition in *Candida auris* and *Candida auris* [D]. Naval Medical University of the Chinese People's Liberation Army, 2023. DOI:10.26998 / d.cnki.gjuyu.2023.000085.).

[0068] Pseudomonas aeruginosa PAO1 was selected from the strain described in (Grace A, Sahu R, Owen DR, Dennis VA. Pseudomonas aeruginosa reference strains PAO1 and PA14: A genomic, phenotypic, and therapeutic review. Front Microbiol. 2022 Oct 13;13:1023523. doi: 10.3389 / fmicb.2022.1023523.).

[0069] Burkholderia cenocepacia H111 was obtained using the strain described in (Yang C, Cui C, Ye Q, Kan J, Fu S, Song S, Huang Y, He F, Zhang LH, Jia Y, Gao YG, Harwood CS, Deng Y. Burkholderiacenocepacia integrates cis-2-dodecenoic acid and cyclic dimeric guanosinemonophosphate signals to control virulence. Proc Natl Acad Sci US A. 2017 Dec 5;114(49):13006-13011. doi: 10.1073 / pnas.1709048114.).

[0070] First, four representative yeast-like fungi (Candida krusei ATCC6258, Candida hemorrhagicum CH001, Candida auris BJCA001, Candida albicans SC5314), four Gram-positive bacteria (Bacillus bereaves NC-B4, Bacillus cereus ATCC14579, Staphylococcus aureus ATCC29213, Micrococcus luteus ATCC 4698), and four Gram-negative bacteria (Escherichia coli ATCC25926, Shigella flexneri ATCC12022, Pseudomonas aeruginosa PAO1, Burkholderia cepacia H111) were selected. Then, following the steps in 2.1.2 of Example 2, plates for each test bacteria were prepared. After the plates solidified, holes were punched for later use.

[0071] 1.2 Preparation of fermentation broth for strain NC-S4

[0072] Same as step 2.2.3 in Example 2.

[0073] 1.3 Detection of the inhibitory effect of NC-S4 fermentation broth on each tested bacteria

[0074] The fermentation broth of strain NC-S4 was centrifuged at high speed, and the supernatant was collected. 50 μL of the fermentation supernatant was placed into the wells of each test bacterial plate, dried, and incubated in triplicate at 35 °C. The experimental results were observed at 24 h, 36 h, and 48 h, mainly focusing on the presence and size of inhibition zones.

[0075] 2. Experimental Results

[0076] Plate inhibition tests on various tested strains revealed that the supernatant of the NC-S4 fermentation broth exhibited significant inhibitory activity against fungi (Candida krusei ATCC6258, Candida shimodiniformis CH001, Candida auris BJCA001, Candida albicans SC5314) and Gram-positive bacteria (Bacillus bereaves NC-B4, Bacillus cereus ATCC14579, Staphylococcus aureus ATCC29213, Micrococcus luteus ATCC 4698), but no inhibitory activity against Gram-negative bacteria (Escherichia coli ATCC25926, Shigella flexneri ATCC12022, Pseudomonas aeruginosa PAO1, Burkholderia cepacia H111). Figure 2 ).

[0077] Example 4: Cytotoxicity detection of fermentation supernatant of strain NC-S4

[0078] 1. Experimental steps:

[0079] 1.1 Cell resuscitation

[0080] The frozen A549 and SK-MEL-28 cells were taken out of the liquid nitrogen tank and directly immersed in 37°C warm water, and shaken from time to time to thaw them quickly. The cells were collected by centrifugation at 1000 rpm for 5 minutes, and then resuspended in 1640 medium with 10% FBS. The cells were then seeded into culture flasks and incubated at 37°C in a 5 (v / v)% CO2 incubator. The culture medium was changed once the next day and the culture was continued.

[0081] 1.2 Cell Plating

[0082] Two cell suspensions, A549 and SK-MEL-28, were prepared and counted. The cells were then seeded into 96-well plates, and 100 μL of 1 (v / v)% FBS 1640 medium containing 1×10⁻⁶ cells was added to each well. 4 Cells were incubated overnight at 37°C in a 5 (v / v)% CO2 incubator.

[0083] 1.3 Preparation of fermentation broth for strain NC-S4

[0084] Same as step 2.2.3 in Example 2.

[0085] 1.4 Toxicity test of antagonistic bacteria fermentation supernatant

[0086] This experiment included a blank control group with no cells, i.e., 1640 containing only 1 (v / v)% FBS; a sample control (natural release) well, i.e. containing only cells without treatment; a well with maximum cell enzyme activity, i.e. containing lysis buffer; and treatment with fermentation supernatant of strain NC-S4: the fermentation broth prepared in 1.3 was used to treat cells at a final concentration of 0% (with an equal volume of blank medium added to the experimental group), 20%, and 50%.

[0087] 1.5 Detection of Lactate Dehydrogenase (LDH) Release from Cells

[0088] Twelve hours later, the supernatant of each cell group was collected and the LDH release was detected (the specific method is based on the Lactate Dehydrogenase Cytotoxicity Detection Kit C0017 from Shanghai Beyotime Biotechnology Co., Ltd.).

[0089] Calculation formula: Cytotoxicity or mortality rate (%) = (Absorbance of treated sample - Absorbance of sample control well) / (Absorbance of maximum enzyme activity of cells - Absorbance of sample control well) × 100. Note: The absorbance of the background blank control well should be subtracted from the absorbance of each group.

[0090] 2. Results

[0091] like Figure 3 As shown in the figure, two cell types were selected for testing: lung cancer cells A549 and melanoma cells SK-MEL-28. 0%, 20%, and 50% represent the amounts of LDH released by the cells after treatment with different concentrations of the supernatant from the strain of this invention. Higher LDH release indicates greater cell death; therefore, the toxicity of a substance to cells can be determined by detecting the amount of LDH released. In this figure, for both cell types, the LDH release after treatment with different concentrations of the strain's supernatant was very low (below 10%), indicating that the fermentation supernatant of this biocontrol bacteria has very weak or even non-toxic cytotoxicity. This demonstrates that the fermentation broth of this strain, when used to make a biological agent, is safe and has good reproducibility.

[0092] Example 5: Identification of strain NC-S4

[0093] Physiological and biochemical experiments of strain 1

[0094] (1) Salt tolerance test:

[0095] The strains were inoculated onto Gao's No. 1 medium with NaCl concentrations ranging from 0 to 13% (w / v) and an interval of 1% concentration gradient. The culture was carried out at 28°C for 7 to 14 days, and the growth status of the test strains was observed and recorded.

[0096] (2) Temperature tolerance test:

[0097] The test strains were inoculated onto sterilized Gao's No. 1 medium and incubated at constant temperatures of 4, 10, 16, 20, 25, 28, 30, 37, 40 and 45°C for 2 weeks, respectively. The growth of the strains under different temperature conditions was observed and recorded.

[0098] (3) pH tolerance test:

[0099] Gao's No. 1 medium was used as the basal medium for pH tolerance testing. The pH value of the medium was adjusted using NaOH and HCl solutions, with a pH range of 4.0-13.0 and a gradient of 1.0 pH increments. The test strains were inoculated onto the medium, and the pH growth range of the strains was observed and recorded.

[0100] (4) Experiment on the utilization of the sole carbon source:

[0101] A single carbon source (0.5%, w / v) was added to the basal medium for carbon source utilization, with a blank control included. The medium was sterilized at 115℃ for 10 min. The tested single carbon sources included inositol, D-trehalose, D-fructose, D-raffinose, D-sorbitol, D-galactose, D-mannitol, D-glucose, rhamnose, xylose, sucrose, and ribose. After inoculation, the strains were cultured in shake flasks at 28℃ for 1-2 weeks, and the growth of the strains was observed and recorded.

[0102] The formula for the basic culture medium utilizing carbon source is as follows: KH2PO4 2.38 g, (NH4)2SO4 2.64 g, K2HPO4 5.65 g, MgSO4·7H2O 1.0 g, MnCl2·4H2O 0.0079 g, CuSO4·5H2O 0.0064 g, ZnSO4·7H2O 0.0015 g, FeSO4·7H2O 0.0011 g, distilled water 1.0 L, pH 6.8-7.0.

[0103] (5) Experiment on the utilization of the sole nitrogen source:

[0104] A single nitrogen source (0.5%, w / v) was added to the nitrogen-utilizing basal medium, with a blank control included, and the medium was sterilized at 112℃ for 20 min. The tested single nitrogen sources included L-asparagine, L-lysine, L-cysteine, L-threonine, L-valine, L-methionine, L-serine, D-arginine, and creatine. The inoculated strains were cultured in shake flasks at 28℃ for 1-2 weeks, and the growth of the strains was observed and recorded.

[0105] The formula for the basal culture medium for nitrogen source utilization is as follows: 10.0 g D-glucose, 0.5 g MgSO4·7H2O, 0.5 g NaCl, 0.01 g FeSO4·7H2O, 1.0 L distilled water, pH 7.2.

[0106] (6) Nitrate reduction test:

[0107] Inoculate the test strain into nitrate-reducing medium and incubate at 28°C for 1-2 weeks. After incubation, take a small amount of culture medium, add one drop each of Griess's reagent A and B, and observe. If the solution turns pink or orange, the result is positive. If there is no color change, add a small amount of zinc powder to the solution. If it turns red, the result is negative. If there is no color change, it is considered that the nitrate has been reduced to other substances and treated as a positive result.

[0108] The formula for nitrate-reducing medium is as follows: 20.0 g sucrose, 0.5 g MgSO4, 0.5 g NaCl, 0.5 g K2HPO4, 1.0 g KNO3, 1.0 L distilled water, pH 7.2-7.4.

[0109] (7) Gelatin liquefaction test:

[0110] The test strains were inoculated into gelatin liquefaction medium and incubated at 30°C for 1-3 weeks. The gelatin liquefaction was observed on days 7, 14, and 21. The test tubes were first cooled at 4°C for 20 minutes before being removed to observe the liquefaction. A positive result was indicated by a liquid upper layer on the gelatin liquefaction medium, while a negative result was indicated by a liquid upper layer.

[0111] The formula for gelatin liquefaction culture medium is as follows: 200.0 g gelatin, 20.0 g glucose, 5.0 g peptone, 1.0 L distilled water, pH 7.2-7.4.

[0112] (8) Milk coagulation and peptone test:

[0113] The test strains were inoculated into milk coagulation and peptonization medium and incubated at 28°C. Observations were taken on days 5, 10, 20, and 30. The presence of clumps in the medium indicates coagulation, while the appearance of liquid after coagulation indicates peptonization.

[0114] The formula for the milk coagulation and peptone medium is: 200.0 g milk powder, 0.2 g CaCO3, 1.0 L distilled water, pH 7.2-7.4.

[0115] (9) Aescin hydrolysis test:

[0116] The test strain was inoculated into aesculin medium and cultured at 28°C for 1-3 weeks. The result was positive if the culture medium turned black, and negative if it did not turn black. A medium without inoculation of the strain was set up as a control.

[0117] The formula for aescin medium is as follows: 10.0 g peptone, 1.0 g aescin, 0.5 g ferric citrate, 5.0 g NaCl, 1.0 L distilled water, pH 7.2.

[0118] (10) H2S generation test:

[0119] Inoculate the test strain onto Chesna medium and incubate at 28°C for 5-14 days. If the culture turns black, it indicates that the generated H2S combines with ferric citrate to form FeS, which is a positive result. If the culture does not change color, it is a negative result. Set up a control.

[0120] The formula for Chesna medium is: 0.5 g ferric citrate, 10.0 g peptone, 1.0 L distilled water, pH 7.2.

[0121] (11) Catalase test:

[0122] Add 3% H2O2 to the colonies of the test strain that have grown well after a period of incubation, and observe the results. If a large number of bubbles are produced within 30 seconds, the result is positive; if no bubbles are produced, the result is negative.

[0123] (12) Melanin production test:

[0124] Inoculate the test strain into ISP6 medium and incubate at 28°C for 1-2 weeks. If black, diffusible pigment is observed on the medium, the result is positive; otherwise, it is negative.

[0125] The formulation of peptone-yeast extract iron medium (ISP6) is as follows: 15.0 g peptone, 5.0 g ferric ammonium citrate, 0.5 g ferric ammonium citrate, 1.0 g K2HPO4, 0.08 g Na2S2O3, 15.0 g agar, 1.0 L distilled water, pH 7.0-7.2.

[0126] Strain NC-S4 grew well in Gao's No. 1 medium. When cultured on LB agar plates, the colonies were round, milky white, opaque, slightly dry and wrinkled, with irregular edges, difficult to pick up, and embedded in the surface of the solid medium. The morphological, cultural, physiological, and biochemical characteristics of this strain are shown in Table 1.

[0127] Table 1. Physicochemical experimental results of strain NC-S4

[0128]

[0129] Note: "++" indicates excellent growth, "+" indicates growth or a positive result, and "-" indicates no growth or a negative result.

[0130] 2. Molecular identification of strains by combining multi-gene phylogenetic analysis.

[0131] 2.1 Extraction of bacterial genome

[0132] Single colonies were picked from Gao's No. 1 plates and inoculated into fresh Gao's No. 1 liquid medium. The culture was incubated at 28°C with shaking at 200 rpm for 2 days. 1 mL of the bacterial suspension was collected by centrifugation. Genomic DNA was extracted according to the instructions of the fungal genomic DNA extraction kit (CW0552S, Jiangsu Kangwei Century Biotechnology Co., Ltd., China).

[0133] 2.2 Amplification of each gene

[0134] Using genomic DNA as a template, genomic DNA was used as a template to amplify various gene fragments using primers 16S-F / 16S-R, atpD-F / atpD-R, gyrB-F / gyrB-R, recA-F / recA-R, rpoB-F / rpoB-R, and trpB-F / trpB-R, respectively.

[0135] 16S-F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1)

[0136] 16S-R: CTACGGCTACCTTGTTACGA (SEQ ID NO.2), Tm 55℃

[0137] atpD-F:ATGACCACCACTGTTGAGACCGCGA (SEQ ID NO.3)

[0138] atpD-R: TCAGGAGACGCCCAGCTCCTTGGCG (SEQ ID NO.4), Tm 70℃

[0139] gyrB-F: GTGGCCGATTCCGGCAACCCCAACG (SEQ ID NO.5)

[0140] gyrB-R:TCAGATGTCGAGGAAGCGGACGTCC (SEQ ID NO. 6), Tm 60℃

[0141] recA-F: ATGGCAGGAACCGACCGCGAGAAGG (SEQ ID NO.7)

[0142] recA-R: TCAGCTCTTGGCCGCCGCGGCCTG (SEQ ID NO. 8), Tm 65°C

[0143] rpoB-F: TTGGCCGCCTCGCGCAATGCCTCGA (SEQ ID NO.9)

[0144] rpoB-R: TCAGACCTCTTCGACGCTGCTCGGC (SEQ ID NO. 10), Tm 67℃

[0145] trpB-F: AGGACCTGAACCACACCGGCT (SEQ ID NO.11)

[0146] trpB-R: TCGATGGCCGGGATGATGC (SEQ ID NO. 12), Tm 65℃

[0147] The amplification system consisted of: 50 ng genomic DNA, 0.4 μM forward primer, 0.4 μM reverse primer, 25 μL 2 × TaqMaster Mix, and H2O to a final volume of 50 μL. The DNA amplification program was as follows: pre-denaturation at 95℃ for 3 minutes, denaturation at 95℃ for 10 seconds, annealing at Tm for 10 seconds, extension at 72℃ for 1 minute 30 seconds, for 35 cycles, followed by a final extension at 72℃ for 5 minutes. The amplified fragment, after being detected as a single band by 1% (g / ml) agarose gel electrophoresis, was sent to a sequencing company (Hunan Qingke Biotechnology Co., Ltd., China) for sequencing.

[0148] 2.3 Gene sequencing and phylogenetic tree analysis

[0149] 2.3.1 Gene Sequence

[0150]

[0151]

[0152]

[0153] recA:CGGCAATTCGGCAAGGGTGCGGTCATGCGCCTCGGCGACAAGCCGAACGACCCCATCGAGGTCATCCCCACCGGGTCGACCGCGCTGGACATCGCCCTCGGCGTCGGCGGGCTGCCCCGCGGCCGTGTGATCGAGGTGTACGGCCCGGAGTCCTCCGGTAAGACGACCCTGACCCTGCACGCCGTGGCCAACGCGCAGAAGGCCGGCGGCACCGTCGCCTTCGTGGACGCCGAGCACGCGCTCGACCCCGAGTACGCCAAGGCTCTCGGCGTCGACACCGACAACCTCATCCTGTCGCAGCCGGACACCGGCGAGCAGGCGCTGGAGATCGTGGACATGCTGGTCCGCTCCGGTGCCCTCGACCTGATCGTCATCGACTCCGTGGCGGCCCTCGTGCCGCGCGCGGAGATCGAGGGTGAGATGGGCGACTCGCACGTCGGCCTCCAGGCCCGACTGATGAGCCAGGCGCTCCGGAAGATCACCGGTGCGCTCAACCAGTCCAAGACCACCGCGATCTTCATCAACCAGCTCCGCGAGAAGATCGGTGTCATGTTCGGCTCGCCCGAGACCACCACCGGCGGTCGCGCGCTGAAGTTCTACGCCTCGGTGCGCATCGACATCCGCCGTATCGAGACCCTGAAGGACGGCACGGAGGCGGTCGGTAACCGCACCCGCTGCAAGGTCGTCAAGAACAAGGTCGCGCCCCCGTTCAAGCAGGCCGAGTTCGACATCCTCTACGGCCAGGGCATCAGCCGCGAGGGCGGCCTGATCGACATGGGTGTGGAGCACGGCTTCATCCGCAAGGCCGGCGCCTGGTACACGTACGAGGGCGACCAGCTCGGCCAGGGCAAGGAGAACGCCCGCAACTTCCTGAAGGACAACCCCGACCTCGCC(SEQID NO.16)

[0154]

[0155] trpB: CACGCTCGCACAAGATCAACAACGTGCTGGGCCAGGCGCTCCTCACCAAGCGCATGGGCAAGACCCGCGTCATCGCCGAGACCGGCGCCGGGCAGCACGGCGTGGCCACCGCCACCGCCTGCGCGCTCTTCGGCCTCGACTGCACCATCTACATGGGCGAGATCGACACCCAGCGCCAGGCCCTCAACGTGGCCCGCATGCGCATGCTGGGCGCCGAGGTCATCGCCGTGAAGTCCGGCTCCCGGACGCTCAAGGACGCGATCAACGAGGCGTTCCGCGACTGGGTCGCCAATGTGGACCGGACCCACTACCTCTTCGGTACGGTCGCCGGCCCCCACCCCTTCCCGGCCATGGTCCGCGACTTCCACCGGGTCATCGGCGTCGAGGCCCGCCGCCAGATCCTGGAGCGCGCCGGCCGGCTGCCGGACGCCGTCGCTGCCTGCGTCGGCGGCGGCTCCAACGCCATCGGCCTCTTCCACGCCTTCATCCCGGACGCCGACGTCCGCCTGGTCGGCTTCGAGCCCGCCGGGCACGGCGTCGAGACCGGCGAGCACGCGGCCACGCTGACCGCCGGCGAGCCCGGGATCCTGCACGGATCCCGCTCCTACGTCCTCCAGGACGAGGAGGGACAGATCACCGAGCCGTACTCCATCTCGGCCGGCCTGGACTACCCGGGCATCGGCCCGGAGCACTCCTACCTCAAGGACTCCGGCCGCGGCGAGTACCGCGCGGCCACCGACGACGCGGCGATGCAGGCCCTGCGCCTGCTCTCGCGCACTGA (SEQ ID NO.18)

[0156] 2.3.2 Phylogenetic tree construction and analysis

[0157] The original gene sequences obtained were assembled and verified using DNAStar analysis software, and then submitted to GenBank. The corresponding gene sequences of the relevant strains were downloaded, and a phylogenetic tree was constructed using the neighbor-joining method in MEGA 7.0 software. Based on sequence homology and phylogenetic relationships, the species classification of the strains was preliminarily determined. Results are shown below. Figure 4 .

[0158] 3. Whole genome sequencing of strains and numerical analysis of ANI and ddH.

[0159] 3.1 Experimental Methods

[0160] The entire process of creating a bacterial genome includes steps such as bacterial DNA quality control, library construction, sequencing, data quality control, genome assembly, and genome annotation. First, bacterial cells are collected and DNA is extracted via liquid fermentation. DNA quality control is then performed to ensure nucleic acid quality, followed by library construction to convert the DNA sample into a suitable sequencing library. Next, sequencing is performed. Then, the sequencing data undergoes quality control to remove low-quality sequences and adapters, ensuring data accuracy. After assembly using the Unicycler tool and Flye software, the assembly results are corrected using Pilon software with Illumina second-generation data correction, ultimately yielding a high-quality assembled genome. The assembled genome is then used to predict coding genes using Prokka (Version: 1.14.6) software. Finally, the genome data is submitted to NCBI (Sequence Submission No. SUB15880154).

[0161] Using the online systems (https: / / ggdc.dsmz.de / faq.php#qggdc21 and https: / / ggdc.dsmz.de / ggdc.php#), the ANI and ddH values ​​of the most closely related species were calculated based on the genome sequence information, and the results are shown in Table 2.

[0162] Table 2. Calculation of ANI and ddH values ​​between strain NC-S4 and similar species

[0163]

[0164] This application conducted Blast analysis using physiological and biochemical methods and 16S rDNA gene sequences. No strains with high similarity were found. Further analysis using whole-genome sequencing, ANI, and ddH values ​​revealed that the ANI (≤95%) and ddH (≤75%) values ​​of the series of known strains most closely related to this strain met the range for identification of new bacterial species. Therefore, this strain is a new species and is named Streptomyces sp.NC-S4.

[0165] Example 6: Determination of the growth inhibition curve of fermentation supernatant of strain NC-S4 against Candida albicans

[0166] 1. Experimental Methods

[0167] Candida albicans was cultured in LB liquid medium and grown to OD. 600 =2.0, then diluted 100 times with LB liquid medium for later use. Add the prepared fermentation supernatant of strain NC-S4 to the diluted Candida albicans culture solution to make the final concentrations of NC-S4 fermentation supernatant 0%, 20%, and 50%, respectively. Then, culture was carried out, and OD was measured at regular intervals. 600 And with time as the horizontal axis, OD 600 Plot the growth curve on the ordinate.

[0168] 2. Results and Analysis

[0169] The inhibitory effects of different final concentrations of NC-S4 fermentation supernatant on the growth curves of *Candida simulans* are shown in the figure. Figure 5 The horizontal axis represents time, and the vertical axis represents OD (Original Demand). 600 (i.e., Candida albicans turbidity), OD 600 The higher the value, the more turbid the bacterial solution, and the better the bacterial growth. Compared with the 0% group, the growth of Candida albicans in the 20% and 50% groups was significantly inhibited, and the inhibition effect was more obvious as the concentration of the NC-S4 fermentation supernatant increased.

[0170] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A Streptomyces sp. NC-S4 strain for preventing and treating pathogenic bacterial infections, which was deposited at the China Center for Type Culture Collection on December 25, 2025, with accession number CCTCC NO: M 20253007.

2. The Streptomyces of claim 1, wherein: When Streptomyces NC-S4 is cultured on LB agar plates, the colonies are round, milky white, opaque, slightly dry and wrinkled on the surface, with irregular edges, not easy to pick up, and embedded on the surface of the solid culture medium.

3. The Streptomyces according to claim 1, characterized in that: The fermentation medium for Streptomyces NC-S4 consisted of 20.0 g / L sucrose, 30.0 g / L soluble starch, 2.0 g / L peptone, 8.0 g / L soybean flour, 0.5 g / L MgSO4·7H2O, 0.5 g / L K2HPO4·7H2O, 2.0 g / L NaCl, 3.0 g / L CaCO3, and an initial pH of 8.

0.

4. The use of the Streptomyces NC-S4 of claim 1 in the preparation of drugs for preventing and treating pathogenic bacterial infections.

5. The application according to claim 4, characterized in that: The pathogens include one or more of the following: Candida krusei, Candida simulans, Candida auris, Candida albicans, Bacillus belysae, Bacillus cereus, Staphylococcus aureus, and Micrococcus luteus.

6. An antibacterial agent, characterized in that: Includes the Streptomyces NC-S4 as described in claim 1.

7. The use of the antibacterial agent according to claim 6 in the preparation of a drug for preventing and treating pathogenic bacterial infections.

8. The application according to claim 7, characterized in that: The pathogens include one or more of the following: Candida krusei, Candida simulans, Candida auris, Candida albicans, Bacillus belysae, Bacillus cereus, Staphylococcus aureus, and Micrococcus luteus.

Images