Genetically engineered escherichia coli for high yield production of chondroitin sulfate and fermentation method thereof

Abstract

This invention relates to the field of bioengineering technology, and discloses a method for constructing and fermenting genetically engineered *E. coli* with high conversion rate for chondroitin sulfate synthesis, using *E. coli* BL21(DE3) as the host. lacZ Site-integrated multi-gene expression cassette: Introduced from E. coli K4-derived... kfoC , kfoA , kfoF Genes are used to synthesize the carbon skeleton of chondroitin; Penicillium chrysogenum was introduced as a source. cysC Gene coordination cysH Knockout, blocking the sulfur assimilation-reduction pathway and enhancing the intracellular accumulation of the active sulfate donor PAPS; utilizing deer-footed mouse-derived... Chst11 Gene-catalyzed chondroitin reacts with PAPS to specifically generate chondroitin sulfate A. Combined with optimized stepwise sterilized culture medium and fed-batch fermentation process, the challenges of substrate competition and cofactor supply are effectively solved, achieving efficient and targeted synthesis of chondroitin sulfate A, suitable for industrial production.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to the construction and fermentation method of genetically engineered Escherichia coli with high conversion rate of chondroitin sulfate synthesis. Background Technology

[0002] Chondroitin Sulfate A (CS-A) is a sulfated glycosaminoglycan widely used in pharmaceuticals, health products, and tissue engineering. Traditional production methods primarily rely on extraction from animal tissues, but these methods suffer from limitations in raw material sources, potential viral contamination risks, and poor product structural uniformity. In recent years, the use of metabolic engineering techniques to modify microorganisms for chondroitin sulfate A synthesis has become a research hotspot, with *Escherichia coli* being the preferred host due to its clear genetic background and short culture cycle. Although microbial synthesis technology has made some progress, numerous technical bottlenecks remain in achieving efficient industrial-scale production.

[0003] In terms of biosynthetic pathways, there is a natural mismatch between the intracellular metabolic environment of prokaryotes and the synthesis requirements of eukaryotic sulfated products. The synthesis of chondroitin sulfate A not only requires a specific carbon skeleton but also depends on a high intracellular concentration of the active sulfate donor 3'-adenosine-5'-phosphate sulfate (PAPS). However, *E. coli*'s own sulfur metabolism primarily utilizes an assimilation-reduction pathway to reduce ingested sulfate to sulfite, which is then used for the synthesis of sulfur-containing amino acids such as cysteine ​​to maintain cell growth. This endogenous metabolic diversion leads to a shortage of sulfur flowing to exogenous product modification pathways. Furthermore, the lack of efficient PAPS synthesis and regeneration mechanisms in prokaryotes results in a severe PAPS shortage, leading to the accumulation of non-sulfated precursors in fermentation products. Consequently, the final product's sulfation level and conversion rate fail to meet application requirements.

[0004] Regarding strain construction strategies, existing technologies mostly employ multi-copy plasmid systems to express exogenous synthetic pathway genes. While plasmid systems are easy to construct, they often exhibit genetic instability and are prone to loss during large-scale, high-density fermentation. To maintain plasmid stability, antibiotics are typically added to the culture medium, which not only increases the cost of industrial production but also leads to the risk of antibiotic residues in the final product, limiting its application in the food and pharmaceutical fields. Furthermore, the coexistence of multiple plasmids can impose a heavy metabolic burden on the host bacteria, affecting bacterial growth performance.

[0005] In terms of fermentation process control, the biosynthesis of chondroitin sulfate A is a highly energy-intensive process, especially the activation of PAPS, which requires a large amount of ATP. Conventional fermentation control strategies often struggle to balance the competition for carbon sources and energy between cell growth and product synthesis. Under high glucose concentrations, *E. coli* is prone to overflow metabolism (Crabtree effect), leading to the accumulation of the byproduct acetic acid. This not only inhibits cell growth but also wastes carbon sources and reduces ATP production efficiency. Existing general-purpose fermentation processes lack energy metabolism regulation mechanisms specifically for the energy-intensive sulfation modification process, resulting in insufficient intracellular energy supply to support the high-intensity synthetic reaction and limiting further yield increases. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a genetically engineered Escherichia coli construction and fermentation method for high-conversion chondroitin sulfate synthesis. This method solves the problems of low modification efficiency due to insufficient active sulfuric acid donor PAPS, genetic instability and antibiotic dependence of traditional plasmid expression systems, and energy shortage and accumulation of metabolic byproducts that inhibit product synthesis during fermentation in existing prokaryotic chondroitin sulfate synthesis processes.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] In a first aspect, the present invention provides a genetically engineered *Escherichia coli* strain with high conversion rate of chondroitin sulfate synthesis, employing the following technical solution: A genetically engineered *E. coli* strain with high conversion rate for chondroitin sulfate synthesis, wherein the host strain of this genetically engineered *E. coli* is *E. coli* BL21(DE3), and this genetically engineered *E. coli* strain is obtained through genetic engineering technology; the modification includes: knocking out the phosphate adenosine monophosphate reductase encoding gene in the host strain genome. cysH Integrate a metabolic pathway expression cassette containing the following exogenous gene into the genome: chondroitin synthase gene derived from E. coli K4. kfoC UDP-glucose-4-episodease gene kfoA UDP-glucose dehydrogenase gene kfoF Derived from the adenosine-5'-phosphate-sulfate kinase gene of Penicillium chrysogenum cysC And the chondroitin-4-O-sulfotransferase gene derived from the deer-footed mouse. Chst11 This genetically engineered E. coli can synthesize chondroitin sulfate A using glucose.

[0009] By adopting the above technical solution, the engineered strain constructed in this invention achieves efficient and targeted synthesis of chondroitin sulfate A through systematic metabolic engineering modification. The technical principle and effects are as follows: This invention achieves synergistic adaptation of various functional modules through a metabolic engineering strategy: at the sulfur metabolism level, by knocking out the host... cysH The gene disrupts the assimilatory sulfur reduction pathway, blocking the inefficient consumption of PAPS to sulfite, while simultaneously introducing a Penicillium chrysogenum source with higher catalytic efficiency. cysC Genes enhance PAPS synthesis throughput, thereby removing the cofactor limitation imposed by sulfation modification; at the carbon skeleton synthesis level, E. coli K4 is introduced. kfo Gene clusters ( kfoC , kfoA , kfoF ), constructing the chondroitin carbon skeleton using host glycolysis precursors; based on this, using deer-white-footed mice-derived... Chst11 The high substrate specificity of sulfotransferases, using high concentrations of PAPS accumulated intracellularly as donors, enables targeted sulfation modification of specific sites on the chondroitin backbone, achieving efficient total biosynthesis from glucose to chondroitin sulfate A.

[0010] Preferably, the metabolic pathway expression cassette is arranged in tandem, and each gene in the metabolic pathway expression cassette is composed of... trc Promoter-driven; the metabolic pathway expression cassette is integrated into the E. coli genome. lacZ Site.

[0011] By adopting the above technical solution trc The promoter is a strong promoter, which can ensure that the foreign gene cluster maintains a high level of transcriptional intensity under induction conditions, and ensure that the abundance of various metabolic enzymes in the cell meets the requirements of high-throughput synthesis. lacZ As an integration site, the site ensures the stable inheritance of foreign genes on the genome, avoiding the plasmid loss and antibiotic dependence problems associated with plasmid expression systems. Furthermore, lacZ The disruption of the site does not affect the growth performance of the strain in a glucose-based basal medium, and the site is located in a region of active genome transcription, which is conducive to the expression of exogenous genes.

[0012] Preferably, the nucleotide sequence of the exogenous gene is as follows: kfoC The gene is shown in SEQ ID NO:1. kfoA The gene is shown in SEQ ID NO:2. kfoF The gene is shown in SEQ ID NO:3. cysC The gene is shown in SEQ ID NO:4. cysH The nucleotide sequence of the gene is shown in SEQ ID NO:5. Chst11 The gene is shown in SEQ ID NO:6.

[0013] By adopting the above technical solution, the nucleotide sequences shown in SEQ ID NO:1 to SEQ ID NO:6 have undergone codon preference optimization and screening for the Escherichia coli BL21(DE3) host. Specific sequences eliminate translation pauses caused by rare codons, reduce the risk of ribosome binding inhibition due to the formation of stable secondary structures of mRNA, thereby improving the soluble expression level and enzyme activity stability of exogenous proteins, and ensuring the stable catalytic performance of the engineered strain during fermentation.

[0014] Secondly, the present invention provides a method for constructing and fermenting genetically engineered Escherichia coli with high conversion rate of chondroitin sulfate synthesis, employing the following technical solution: A method for constructing and fermenting genetically engineered Escherichia coli with high conversion rate of chondroitin sulfate using the above-mentioned genetically engineered Escherichia coli includes the following steps: Knockout of host bacteria using CRISPR / Cas9 gene editing technology cysH Genes were extracted, and metabolic pathway expression cassettes were integrated into the host bacterial genome using homologous recombination technology, and engineered strains were obtained through screening. The engineered strain was inoculated into seed culture medium and cultured until the logarithmic growth phase to obtain seed solution; The seed culture was inoculated into a fermenter containing fermentation medium, and aerobic fermentation was carried out under controlled pH, temperature and dissolved oxygen conditions. During fermentation, glucose solution is added according to the residual sugar concentration until fermentation is completed, and the fermentation broth containing chondroitin sulfate A is collected.

[0015] By adopting the above technical solution, this invention establishes a fermentation process adapted to the metabolic characteristics of genetically engineered strains, achieving synergistic regulation of cell growth and product synthesis: This invention utilizes CRISPR / Cas9 and homologous recombination technology to achieve traceless genome editing. By precisely integrating exogenous genes into the host genome, it eliminates the instability, metabolic burden, and dependence on antibiotics of traditional plasmid expression systems, thereby improving biosafety and production stability. Combined with a two-stage fermentation strategy, a high-activity seed culture is prepared in the early stage, and during the fermentation stage, the competitive demands of cell growth and product synthesis on carbon sources, precursors, and energy cofactors are precisely balanced through environmental parameter and feed regulation, achieving efficient and stable biomanufacturing.

[0016] Preferably, the solvent of the fermentation medium is water, and each liter of fermentation medium contains the following components in the following proportions: glucose: 18.0-22.0g; yeast extract: 8.0-12.0g; potassium dihydrogen phosphate: 3.0-4.0g; dipotassium hydrogen phosphate: 4.5-5.5g; diammonium hydrogen phosphate: 3.0-4.0g; magnesium sulfate heptahydrate: 1.2-1.8g; citric acid: 1.5-2.5g; vitamin B1: 4.0-5.0mg.

[0017] By adopting the above technical solution, the culture medium formulation has been specifically optimized for the synthesis of chondroitin sulfate A: The culture medium system constructed in this invention maintains a stable pH environment for fermentation through a high-concentration phosphate buffer system and provides sufficient phosphorus source for the synthesis of ATP, PAPS and nucleotide sugar precursors. At the same time, citric acid is added to replenish the flux of the tricarboxylic acid cycle, enhance the level of oxidative phosphorylation to ensure the high demand for ATP in the sulfuric acid activation process, and vitamin B1 is added to promote the metabolic flow of glucose to the TCA cycle and reduce the accumulation of byproduct acetic acid. Thus, it is fully adapted to the high-energy-consuming synthetic metabolism of engineered bacteria in terms of both material and energy.

[0018] Preferably, the fermentation medium is prepared using a stepwise sterilization process, specifically including: dissolving glucose separately and sterilizing it at 110-120℃; dissolving magnesium sulfate heptahydrate separately and sterilizing it at 120-125℃; dissolving vitamin B1 and then filtering it through a filter membrane for sterilization; mixing and dissolving the remaining components and sterilizing them at 120-125℃; and mixing the components under aseptic conditions after they have cooled to room temperature.

[0019] By adopting the above technical solution, the stepwise sterilization process solves the problem of chemical reactions during high-temperature treatment of complex culture media: This invention employs a stepwise sterilization process. By sterilizing glucose separately at a lower temperature, it effectively avoids the Maillard reaction between glucose and nitrogen sources, which would otherwise generate inhibitory byproducts. Simultaneously, magnesium salts are sterilized separately to prevent them from combining with phosphate ions at high temperatures to form insoluble precipitates, thus ensuring an effective supply of magnesium ions, a cofactor for kinases. Furthermore, heat-sensitive vitamin B1 is sterilized using membrane filtration to preserve its biological activity, thereby ensuring the stability and bioavailability of the culture medium components.

[0020] Preferably, the seed culture medium is LB medium, with the following formula: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride. The seed culture is terminated when the OD600 reaches 3.8-4.2, and the volume of the seed culture is 100-150 mL.

[0021] By adopting the above technical solution, the seed culture medium was adjusted to adapt to the shake flask culture environment: This invention, combined with strict control over the timing of transplantation (mid-to-late logarithmic growth phase), ensures that the inoculated cells have vigorous metabolic activity and strong adaptability, thereby shortening the lag period after entering the fermentation tank and enabling rapid initiation of fermentation growth and metabolism.

[0022] Preferably, the control parameters in the fermentation process include: temperature control at 35-37℃; pH value maintenance at 7.0-7.2 by adding ammonia water; and dissolved oxygen concentration control at 20%-40% by adjusting the stirring speed and aeration rate.

[0023] By adopting the above technical solutions, precise control of environmental parameters ensures the efficient conduct of biochemical reactions. This invention achieves the coupling of pH regulation and nitrogen supply through an ammonia-water feeding strategy. While maintaining a suitable neutral environment for enzyme activity, it continuously provides the inorganic nitrogen required for the synthesis of proteins and amino sugar precursors. Combined with dissolved oxygen cascade control to maintain a high dissolved oxygen level, it guides carbon metabolism to the aerobic respiration energy production pathway, effectively inhibits acid-producing fermentation and maximizes ATP generation efficiency, thereby meeting the huge demand for high-energy phosphate bonds in the chondroitin sulfate A synthesis process.

[0024] Preferably, the glucose solution is added during fermentation according to the residual sugar concentration as follows: when the glucose concentration in the fermentation broth is lower than 5 g / L, a glucose solution with a concentration of 500-800 g / L is added to control the residual sugar concentration during fermentation to be maintained at 0.5-5 g / L.

[0025] By adopting the above technical solution, this restrictive feeding strategy effectively inhibits the Crabtree effect (glucose repression effect): This invention employs a restricted feeding strategy, strictly controlling the residual sugar concentration during fermentation within a low range of 0.5-5 g / L. This forces cells to utilize the tricarboxylic acid cycle for oxidative metabolism, effectively relieving the inhibition of cell growth caused by overflow metabolism and acetic acid accumulation due to the high-sugar environment. Simultaneously, the use of a high-concentration feeding solution of 500-800 g / L ensures sufficient carbon source supply while minimizing the increase in fermentation broth volume, thus preventing a decrease in product concentration due to dilution effects.

[0026] Preferably, the CRISPR / Cas9 gene editing technology includes the introduction of expression targets. cysH The pTarget plasmid for the gene's sgRNA and the pCas plasmid for expressing the Cas9 protein; the donor DNA used in homologous recombination technology contains lacZ The upstream and downstream homologous arms of the site, as well as the structures located between the upstream and downstream homologous arms, are trc-kfoC-trc-kfoA-trc-kfoF-trc- cysC-trc-Chst11 Gene expression cassettes.

[0027] By employing the above technical solution, the editing efficiency was improved using a dual plasmid system (pTarget / pCas). In donor DNA design, homologous arms guide the precise targeted integration of exogenous gene clusters into the donor DNA. lacZ Sites, while destroying lacZ Gene function enables convenient blue-white screening or PCR identification, ensuring the accuracy of engineered strain construction.

[0028] This invention provides a method for constructing and fermenting genetically engineered *E. coli* strains with high conversion rates for chondroitin sulfate synthesis. It offers the following advantages: 1. This invention achieves its goal by knocking out the host. cysH Genes were introduced and Penicillium chrysogenum was introduced. cysC Genes that block the assimilatory sulfur reduction pathway force sulfur metabolism to accumulate at PAPS synthesis nodes; combined with highly specific Chst11 Sulfonyltransferase has solved the problem of insufficient active sulfuric acid donors in prokaryotes, enabling the high-conversion synthesis of chondroitin sulfate A.

[0029] 2. This invention uses CRISPR / Cas9 technology to integrate exogenous gene clusters into the genome. lacZ This site eliminates the instability of plasmid expression systems and their dependence on antibiotics, reducing production costs and safety risks; combined with trc The strong promoter ensures that the engineered bacteria maintain a high level of transcription even without antibiotics, making them suitable for long-term industrial production.

[0030] 3. This invention constructs a suitable high-efficiency fermentation system. By adding citric acid to enhance the level of oxidative phosphorylation, sufficient ATP is provided for PAPS synthesis. Combined with stepwise sterilization and restricted feeding process, byproduct accumulation and substrate inhibition are effectively avoided, and cell density and product yield are improved. Detailed Implementation

[0031] The technical solutions of the present invention will be clearly and completely described below with reference to embodiments, comparative examples, and test examples. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0032] Preparation Examples 1-5: Preparation Example 1: This preparation example provides a method for preparing a genetically engineered strain that produces chondroitin sulfate A (denoted as engineered strain BL21-CS-A), including the following steps: cysH Gene knockout: Using the Escherichia coli BL21(DE3) genome as a template, high-fidelity DNA polymerase was used to amplify... cysH The upstream and downstream homologous arms of gene (SEQ ID NO:5) were identified, and the upstream and downstream homologous arms were ligated by overlap extension PCR (Fusion PCR) to obtain... cysH Homologous arm fragment; Using pTarget plasmid as a template, specific primers were designed for reverse PCR amplification to introduce primers capable of expressing the target plasmid. cysH The sgRNA sequence of the gene was used to obtain the linearized pTarget backbone; Using a one-step cloning kit (based on the principle of homologous recombination), the molar ratio of vector to insert fragment was controlled at 1:2 to 1:5, and the reaction was carried out at 37°C for 30 min. cysH Homologous arm fragments were ligated to the linearized pTarget backbone to obtain the recombinant plasmid pTarget. -cysH ; Recombinant plasmid pTarget -cysH Transformed into Escherichia coli BL21(DE3) competent cells containing pCas plasmid, plated on LB agar plates containing 50 mg / L spectinomycin hydrochloride and 50 mg / L kanamycin sulfate, incubated at 30°C for 16-18 h, and positive clones were obtained by colony PCR verification. Positive clones were inoculated into LB liquid medium containing 50 mg / L kanamycin sulfate and 5 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and cultured at 30°C with shaking for 12 h to induce pCas cleavage and eliminate pTarget. -cysH plasmids; Will eliminate pTarget -cysH The plasmid-free bacterial culture was transferred to antibiotic-free LB medium and cultured overnight at 42°C to eliminate the temperature-sensitive pCas plasmid, ultimately yielding plasmid-free culture. cysH Gene knockout strain (designated BL21) -ΔcysH ); The general procedure for the above PCR reaction is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension (extension time set at 30 s-60 s / kb), repeat for 30-35 cycles; 72℃ final extension for 10 min.

[0033] Preparation of integrated donors for metabolic pathway genes: respectively Escherichia coli Using the K4 strain genome, Penicillium chrysogenum cDNA, and deer-footed mouse cDNA as templates, amplification was obtained kfoC Gene (SEQ ID NO:1) kfoA Gene (SEQ ID NO:2) kfoF Gene (SEQ ID NO:3) cysC Gene (SEQ ID NO:4) and Chst11 Gene (SEQ ID NO:6); Using DNA in vitro assembly techniques (such as Gibson Assembly or multi-fragment overlap extension PCR), the above five genes were respectively coupled with... trc The promoter and ribosome binding site (RBS) sequences were assembled to construct the structure as follows: trc-kfoC- trc-kfoA-trc-kfoF-trc-cysC-trc-Chst11 Tandem gene expression cassettes; With BL21 -ΔcysH Using the strain genome as a template, amplification lacZ Upstream and downstream homologous arms of the site; PCR was used to... lacZ Upstream homologous arm, the aforementioned gene expression cassette, lacZ Downstream homologous arms are joined to obtain long donor DNA fragments for genome integration; Gene replacement and strain acquisition: Build Target lacZ Recombinant plasmid pTarget at the site -lacZ (Construction method is the same) cysH The gene knockout steps differ only in the sgRNA target sequence; the donor DNA fragment (500-1000 ng) obtained from the metabolic pathway gene integration donor preparation step is combined with pTarget... -lacZ The plasmid (100-200 ng) was co-transformed into BL21 containing the pCas plasmid. -ΔcysH competent cells; Subsequent screening, validation, and plasmid elimination steps are the same as those for... cysH After the gene knockout step was verified to be correct by sequencing, the engineered bacterium BL21-CS-A, which integrates a complete set of metabolic pathways, was finally obtained.

[0034] Preparation Example 2: This preparation example provides a non-knockout cysH The method for preparing the engineered strain of the gene (denoted as control strain 1) includes the following steps: Using the original Escherichia coli BL21(DE3) as the starting strain, the preparation method in Example 1 was not performed. cysH Gene knockout step, i.e., preservation cysH Gene; Following the method described in the preparation steps of the metabolic pathway gene integration donor in Example 1, an integrator containing... trc-kfoC- trc-kfoA-trc-kfoF-trc-cysC-trc-Chst11 Gene expression cassettes and integrated donor DNA; Following the method described in Preparation Example 1, gene replacement and strain acquisition steps, the integrative donor DNA was integrated into Escherichia coli BL21(DE3). lacZ The site was identified, and plasmid elimination was completed, resulting in control strain 1.

[0035] Preparation Example 3: This preparation example provides a method without introducing... cysC The method for preparing the engineered strain of the gene (denoted as control strain 2) includes the following steps: According to Preparation Example 1 cysH The gene knockout procedure was obtained using the method described above. cysH Gene knockout strain BL21 -ΔcysH ; When constructing the gene expression cassette using the integrated donor preparation steps of the metabolic pathway gene preparation in Example 1, no [introduction / introduction] was introduced. cysC Gene (SEQ ID NO:4), that is, assembled into a structure with trc-kfoC-trc-kfoA-trc-kfoF-trc-Chst11 The gene expression cassette is used, and the rest of the operations remain unchanged; Following the method described in Preparation Example 1, gene replacement and strain acquisition steps, the expression cassette was integrated into BL21. -ΔcysH In the genome, control strain 2 was obtained.

[0036] Preparation Example 4: This preparation example provides a method without introducing... Chst11 The method for preparing the engineered strain of the gene (denoted as control strain 3) includes the following steps: According to Preparation Example 1 cysH The gene knockout procedure was obtained using the method described above. cysH Gene knockout strain BL21 -ΔcysH ; When constructing the gene expression cassette using the integrated donor preparation steps of the metabolic pathway gene preparation in Example 1, no [introduction / introduction] was introduced. Chst11 Gene (SEQ ID NO:6), that is, assembled into a structure of trc-kfoC-trc-kfoA-trc-kfoF-trc-cysC The gene expression cassette is used, and the rest of the operations remain unchanged; Following the method described in Preparation Example 1, gene replacement and strain acquisition steps, the expression cassette was integrated into BL21. -ΔcysH In the genome, control strain 3 was obtained.

[0037] Preparation Example 5: This preparation example provides a method without introducing... kfoC , kfoA and kfoF The method for preparing the engineered strain of the gene (denoted as control strain 4) includes the following steps: According to Preparation Example 1 cysH The gene knockout procedure was obtained using the method described above. cysH Gene knockout strain BL21 -ΔcysH ; When constructing the gene expression cassette using the integrated donor preparation steps of Example 1 (metaboloid pathway gene preparation), only the sulfation modification and donor module were included, resulting in a structure as follows: trc-cysC-trc-Chst11 The gene expression cassette is used, and the rest of the operations remain unchanged; Following the method described in Preparation Example 1, gene replacement and strain acquisition steps, the expression cassette was integrated into BL21. -ΔcysH In the genome, control strain 4 was obtained.

[0038] Examples 1-4: Example 1: This embodiment provides a method for constructing and fermenting genetically engineered Escherichia coli with high conversion rate of chondroitin sulfate, including the following steps: Preparation of fermentation medium: Prepare a special culture medium for a 5L fermenter using deionized water as the solvent. Each liter of culture medium contains the following components: 20.0g glucose, 10.0g yeast extract, 3.5g potassium dihydrogen phosphate, 5.0g dipotassium hydrogen phosphate, 3.5g diammonium hydrogen phosphate, 1.5g magnesium sulfate heptahydrate, 2.0g citric acid, and 4.5mg vitamin B1. To prevent precipitation and browning during sterilization, the following preparation process was adopted: glucose was dissolved separately and sterilized at 115°C for 20 min; magnesium sulfate heptahydrate was dissolved separately and sterilized at 121°C for 20 min; vitamin B1 was dissolved and then filtered through a 0.22 μm filter membrane for sterilization; the remaining components were dissolved and mixed, and sterilized at 121°C for 20 min; after each solution cooled to room temperature, it was mixed into the fermenter under aseptic conditions. Seed liquid preparation: The engineered bacteria BL21-CS-A obtained from Preparation Example 1 and stored at -80℃ were streaked onto LB agar plates and activated by incubation at 37℃ for 12 h. Single colonies were picked and inoculated into 500 mL Erlenmeyer flasks containing 100-150 mL of LB medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) and cultured at 37℃ and 220 rpm for 12 h with shaking until the OD600 reached approximately 4.0 to obtain the seed culture. Fermentation culture: The seed culture was inoculated into a 5L fermenter containing 3L of fermentation medium at an inoculation rate of 5% (v / v); the temperature was controlled at 36℃ during fermentation, and the pH was maintained at 7.0-7.2 by automatically adding ammonia water (25%-28% v / v); the dissolved oxygen (DO) in the fermentation broth was maintained at about 30% by adjusting the stirring speed (300-800 rpm with correlation control) and the aeration rate (1-3 vvm). Replenishment strategy: During fermentation, glucose concentration was sampled and tested at regular intervals. When the glucose concentration in the fermentation broth was below 5 g / L, a glucose solution with a concentration of 600 g / L (sterilized separately) was added to control the residual sugar concentration in the fermentation broth to be maintained between 0.5 and 5 g / L. The fermentation cycle was 60 hours. After fermentation, the fermentation broth was collected for product testing.

[0039] Example 2: This embodiment provides a method for constructing and fermenting genetically engineered Escherichia coli with high conversion rate of chondroitin sulfate, including the following steps: Preparation of fermentation medium: Prepare a 5L fermenter-specific culture medium using deionized water as the solvent. Each liter of the culture medium contains the following components: 18.0g glucose, 8.0g yeast extract, 3.0g potassium dihydrogen phosphate, 4.5g dipotassium hydrogen phosphate, 3.0g diammonium hydrogen phosphate, 1.2g magnesium sulfate heptahydrate, 1.5g citric acid, and 4.0mg vitamin B1. The preparation and sterilization methods are the same as those for the fermentation culture medium in Example 1. Seed liquid preparation: The engineered bacteria BL21-CS-A obtained in Preparation Example 1 was used to prepare a seed culture according to the method described in Example 1. The culture temperature was 36℃, the shaking speed was 200rpm, and the culture was carried out for 14h to obtain the seed culture. Fermentation culture: The seed culture was inoculated at a rate of 2% (v / v) into a 5L fermenter containing 3L of fermentation medium; the temperature was controlled at 35℃ during fermentation, and the pH was maintained at 7.0 by automatically adding ammonia or phosphoric acid; the dissolved oxygen (DO) was controlled at 20%-30%. Replenishment strategy: When the glucose concentration in the fermentation broth is below 5 g / L, a glucose solution with a concentration of 500 g / L is added to maintain the residual sugar concentration; the fermentation cycle is 72 h, and the fermentation broth is collected after the fermentation is completed.

[0040] Example 3: This embodiment provides a method for constructing and fermenting genetically engineered Escherichia coli with high conversion rate of chondroitin sulfate, including the following steps: Preparation of fermentation medium: Prepare a 5L fermenter-specific culture medium using deionized water as the solvent. Each liter of the culture medium contains the following components: 22.0g glucose, 12.0g yeast extract, 4.0g potassium dihydrogen phosphate, 5.5g dipotassium hydrogen phosphate, 4.0g diammonium hydrogen phosphate, 1.8g magnesium sulfate heptahydrate, 2.5g citric acid, and 5.0mg vitamin B1. The preparation and sterilization methods are the same as those for the fermentation culture medium in Example 1. Seed liquid preparation: The engineered bacteria BL21-CS-A obtained in Preparation Example 1 was used to prepare a seed culture according to the method described in Example 1. The culture temperature was 38℃, the shaking speed was 230 rpm, and the culture was carried out for 10 h to obtain the seed culture. Fermentation culture: The seed culture was inoculated into a 5L fermenter containing 3L of fermentation medium at an inoculation rate of 5% (v / v); the temperature was controlled at 37℃ during fermentation, and the pH was maintained at 7.2 by automatic ammonia addition; dissolved oxygen (DO) was controlled at 30%-40%. Replenishment strategy: When the glucose concentration in the fermentation broth is below 5 g / L, a glucose solution with a concentration of 800 g / L is added to maintain the residual sugar concentration; the fermentation cycle is 48 hours, and the fermentation broth is collected after the fermentation is completed.

[0041] Example 4: This embodiment provides a method for constructing and fermenting genetically engineered Escherichia coli with high conversion rate of chondroitin sulfate, including the following steps: Preparation of shake-flask fermentation medium: Prepare shake flask fermentation medium using deionized water as the solvent. Each liter of medium contains the following components: 20.0g glucose, 5.0g yeast extract, 2.5g potassium dihydrogen phosphate, 2.0g citric acid, 1.0g magnesium sulfate heptahydrate, 2.0mg vitamin B1, and 30.0g calcium carbonate. The sterilization process is as follows: calcium carbonate is separately dispensed into Erlenmeyer flasks and sterilized by dry heat at 160℃ for 2 hours; glucose and magnesium sulfate heptahydrate are separately prepared into mother liquors and sterilized separately; vitamin B1 is filtered and sterilized; the remaining components are dissolved and then sterilized by moist heat; under aseptic conditions, all liquid components are added to the Erlenmeyer flask containing calcium carbonate and mixed evenly. Seed liquid preparation: The engineered strain BL21-CS-A obtained in Preparation Example 1 was inoculated into 50 mL of LB liquid medium and cultured overnight at 37 °C for activation; then it was transferred to fresh seed medium and cultured at 37 °C and 220 rpm for 12 h to the logarithmic growth phase to obtain the seed culture. Fermentation culture: Inoculate 3.3% (v / v) (i.e., 1 mL of seed culture) into a 500 mL Erlenmeyer flask containing 30 mL of shake-flask fermentation medium; place it in a constant temperature shaker and culture at 37 °C and 220 rpm for 72 h; calcium carbonate acts as a pH buffer during fermentation, so no additional feed is required; after fermentation, centrifuge and collect the supernatant for testing.

[0042] Comparative Examples 1-5: Comparative Example 1: Compared with Example 1, the difference is that the strains mentioned in the seed culture preparation step and the fermentation culture step are replaced with the control strain 1 obtained in Preparation Example 2 (i.e., strain 1 that was not knocked out). cysH (For the strain containing the gene), the remaining steps and parameters are the same.

[0043] Comparative Example 2: Compared with Example 1, the difference is that the strains mentioned in the seed culture preparation step and the fermentation culture step are replaced with the control strain 2 obtained in Preparation Example 3 (i.e., without the introduction of strain 2). cysC (For the strain containing the gene), the remaining steps and parameters are the same.

[0044] Comparative Example 3: Compared with Example 1, the difference is that the strains mentioned in the seed culture preparation step and the fermentation culture step are replaced with the control strain 3 obtained in Preparation Example 4 (i.e., without the introduction of strain 3). Chst11 (For the strain containing the gene), the remaining steps and parameters are the same.

[0045] Comparative Example 4: Compared with Example 1, the difference is that the strains mentioned in the seed culture preparation step and the fermentation culture step are replaced with the control strain 4 obtained in Preparation Example 5 (i.e., lacking the control strain 4). kfoC , kfoA and kfoF (For the strain containing the gene), the remaining steps and parameters are the same.

[0046] Comparative Example 5: Compared with Example 1, the difference is that the fermentation medium in the preparation step of the fermentation medium is replaced with conventional TB medium (solvent is water, per liter contains: 12g tryptone, 24g yeast extract, 4mL glycerol, 2.3g dipotassium hydrogen phosphate, 12.5g potassium dihydrogen phosphate), and no glucose feeding is performed during the fermentation process. All other steps and parameters are the same.

[0047] Test Example 1-3: Test Example 1: Genotyping Verification of Engineered Strains Experimental steps: Picking single colonies for testing: Pick the engineered strain BL21 constructed in Preparation Examples 1-5 from LB plates respectively. - Single colonies of CS-A, control strain 1, control strain 2, control strain 3, control strain 4, and the original strain BL21 (DE3) were placed in PCR tubes containing 50 μL of sterile water.

[0048] Preparation of PCR template: Place the PCR tube containing the bacterial culture into a PCR instrument, heat at 99°C for 10 min to lyse, then centrifuge at 12000 rpm for 2 min, and take the supernatant as the template for colony PCR verification.

[0049] PCR amplification reaction: targeting cysH Design and validate primer pair P1 / P2 (P1 is located at the gene knockout site) cysH The gene is located in the upstream genomic region, while P2 is located in the downstream genomic region. Primer pair P3 / P4 was designed to validate the integration site (to amplify the critical linking region of the inserted gene expression cassette; due to the long insertion fragment, multiple primer pairs were designed for validation in segments, but here we focus on amplification). trc-kfoC (Taking the linker segment as an example). Prepare a 50 μL PCR reaction system: 25 μL 2×Taq Master Mix, 2 μL each of forward and reverse primers (10 μM), 2 μL template DNA, and 19 μL ddH2O. The PCR program is set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension (set the time according to the length of the amplified fragment), 30 cycles; 72℃ extension for 10 min.

[0050] Gel electrophoresis detection: Mix 5 μL of PCR amplification product with 1 μL of 6× Loading Buffer, and spot the mixture into the wells of a 1.0% agarose gel. Electrophoresis was performed at 120V for 25 min. After electrophoresis, the DNA band size was observed and recorded using a gel imaging system.

[0051] Sequencing verification: After purifying the PCR product, it was sent to a sequencing company for Sanger sequencing. The sequencing results were compared with the theoretical sequence, and the sequence matching degree was calculated.

[0052] Experimental results: The genotype verification results for each strain are shown in Table 1. Primers P1 / P2 were used for verification. cysH At the site, if the gene is not knocked out, the amplified fragment contains the complete gene. cysH The gene (approximately 800 bp) and flanking sequences are theoretically about 1450 bp in length; if the gene is knocked out, the amplified fragment will only contain flanking sequences and residual scar tissue, with a theoretical length of approximately 680 bp. Primers P3 / P4 are used to verify the integration of the metabolic pathway. trc-kfoC Taking a region as an example, the theoretical length is 2100bp.

[0053] Table 1. Summary of Genotype Validation Data for Each Example and Comparative Example Strains

[0054] Note: P5 / P6 are for... cysC Gene-specific primers, P7 / P8 are for targeting Chst11 For gene-designed specific primers, "-" in the Electrophoresis Measured Size (bp) column indicates that no specific amplification band was observed in the gel electrophoresis experiment; "-" in the Sequencing Match (%) column indicates that sequencing alignment could not be performed; and "-" in the Theoretical Fragment Size (bp) column indicates that it is not applicable or absent / non-existent.

[0055] Conclusion Analysis: Based on the data in Table 1, the engineered bacteria BL21 constructed in Example 1 - CS-A in cysH The PCR amplification product at this site was 685 bp, consistent with the theoretically knocked-out fragment size, and significantly smaller than the 1455 bp and 1442 bp of the original strain BL21(DE3) and control strain 1, respectively. Sequencing results showed that the sequence at this site was a perfect match for the designed sequence. This result confirms at the genomic level that the CRISPR / Cas9 system used in this invention successfully mediated the sequencing of the phosphoadenylate-sulfate reductase gene in the chassis strain. cysH Targeted eradication.

[0056] From the perspective of metabolic mechanisms cysH The deletion of this gene blocked the reduction pathway of PAPS to sulfite (PAP). PAPS is a shared node in the cellular sulfur metabolism network, encompassing both sulfur assimilation and sulfation pathways. This was confirmed through genotyping. cysH Knockout physically blocks the pathway for sulfur to flow to cysteine ​​synthesis, forcing intracellularly synthesized PAPS to flow only to exogenously introduced sulfonyltransferases. Chst11 The sulfation reaction is catalyzed by [a specific chemical process]. This forced redirection of metabolic flux is the genetic basis for the high sugar-acid conversion rate and product sulfation level obtained in subsequent fermentation tests in Example 1.

[0057] Meanwhile, validation data for the integration site showed that the engineered strain BL21-CS-A and all control strains amplified the expected specific bands. Specifically, the engineered strain BL21-CS-A contained... kfoC , cysC and Chst11 Correct bands were detected in the connection regions of key genes, with a sequencing match rate close to 100%.

[0058] This indicates that the invention is designed trc-kfoC-trc-kfoA-trc-kfoF-trc-cysC-trc-Chst11 The multi-gene expression cassette has been fully and accurately integrated into the *E. coli* genome. All exogenous genes are expressed through the same strong promoter. trc Driven by this, an artificially coupled metabolic module is formed: kfoC / A / F Responsible for providing the carbon skeleton of chondroitin. cysC It is responsible for increasing the PAPS supply flux through phosphorylation. Chst11 It is responsible for transferring sulfate groups from PAPS to the chondroitin backbone. The successful genotype validation provided conclusive molecular biological evidence for the high production of chondroitin sulfate A observed in subsequent phenotypic tests, demonstrating the feasibility of reconstructing microbial cell factories through systems metabolic engineering.

[0059] Test Example 2: Fermentation Yield and Conversion Rate Determination and Metabolic Flux Analysis Experimental steps: Fermentation Sampling and Sample Pretreatment: After the fermentation process was completed, 50 mL of fermentation broth was aseptically taken from the fermenters or shake flasks of Examples 1-4 and Comparative Examples 1-5, respectively. The fermentation broth was placed in centrifuge tubes and centrifuged at 4°C and 12000 rpm for 15 min, and the supernatant was collected. A portion of the supernatant was filtered through a 0.22 μm filter membrane for glucose content determination; another portion of the supernatant was subjected to enzymatic hydrolysis of chondroitin sulfate A (CS-A).

[0060] Product enzymatic derivatization: Take 1 mL of the centrifuged supernatant, add 100 μL of 10× enzyme digestion buffer (500 mM Tris-HCl, pH 8.0, 300 mM NaAc) and 50 mIU of chondroitinase ABC, and react in a 37℃ water bath for 2 h. This enzyme can specifically degrade chondroitin sulfate A into unsaturated disaccharides (ΔDi-4S). After the reaction, boil for 10 min to inactivate the enzyme, centrifuge at 12000 rpm for 5 min, and use the supernatant as the HPLC sample.

[0061] HPLC chromatographic conditions: A high-performance liquid chromatograph equipped with a UV detector (VWD) was used. A strong anion exchange column (SAX, 4.6 mm × 250 mm, 5 μm) was selected; mobile phase A was water (pH 3.5, adjusted with HCl), and mobile phase B was 2 mol NaCl solution (pH 3.5); linear gradient elution was used, with the proportion of mobile phase B increasing linearly from 0% to 100% within 0-20 min; flow rate was 1.0 mL / min; column temperature was 40℃; and detection wavelength was 232 nm.

[0062] Standard curve construction and quantification: ΔDi-4S standard solutions of varying concentrations were prepared and analyzed by HPLC. A standard curve was plotted with peak area on the ordinate and concentration on the abscissa. Based on the retention time and peak area of ​​the samples, combined with the dilution factor, the concentration of chondroitin sulfate A in the fermentation broth was calculated.

[0063] Residual sugar determination and conversion rate calculation: The residual glucose concentration at the fermentation endpoint was determined using an SBA-40E biosensor analyzer. The total glucose consumption was calculated based on the initial glucose input, the total glucose added during the feeding process, and the residual sugar content after fermentation.

[0064] Calculation formula: Sugar-acid conversion rate (%) = [Chondroitin sulfate A yield (g / L) × fermentation volume (L)] / [Total glucose consumed (g)] × 100%.

[0065] Experimental results: The final test data of each group of fermentation experiments are summarized in Table 2.

[0066] Table 2. Test data of fermentation performance parameters under different strains and process conditions

[0067] Note: Example 4 is based on shake flask data, and the total consumption is calculated based on 30 mL of fermentation broth; ND indicates Not Detected. Comparative Example 3 detected a large amount of non-sulfated disaccharide ΔDi-0S, but not ΔDi-4S; Comparative Example 5 is based on conventional TB medium without supplementation, and the total consumption is estimated based on 3 L of fermentation broth and the carbon source provided by the medium; "-" in the sugar-acid conversion rate (%) column indicates that it is not applicable or cannot be calculated.

[0068] Conclusion Analysis: Based on the data in Table 2, Example 1 used the complete set of genetically engineered strains constructed according to the present invention. BL21-CS-A With optimized 5L fermenter technology, chondroitin sulfate A ( ) can be produced within a 60-hour fermentation cycle. CS-A The yield reached 8.63 g / L, with a sugar-acid conversion rate of 3.30%. This result is significantly higher than all comparative examples, and the yields of each parallel parameter verification group (Examples 2 and 3) were consistently above 7.9 g / L, demonstrating the robustness of the technology system.

[0069] Comparing the data from Example 1 and Comparative Example 1 reveals that their bacterial biomass (OD600) is very similar (68.4 vs 69.1), indicating that the genetic modification did not impose a significant burden on cell growth. However, Comparative Example 1 (retaining...) cysH The CS-A yield of the gene was only 4.21 g / L, less than half that of Example 1. This difference directly confirms... cysH The necessity of gene knockout. At the metabolic flux level, cysH The encoded PAPS reductase acts as a diversion valve for sulfur flow to cysteine ​​synthesis. When this gene is present, the valuable precursor PAPS synthesized by the cell is largely used to maintain the cell's own sulfur assimilation needs, resulting in insufficient PAPS for product modification, making it the rate-limiting step. Knocking out this gene physically blocks the inefficient consumption of PAPS, forcing the intracellularly accumulated PAPS to [the enzyme / reductase]. Chst11 The catalytic sulfation reaction resulted in a doubling of yield.

[0070] Comparative Example 1 and Comparative Example 2 (not introduced) cysC Data from [the study] showed that CS-A production decreased to 5.15 g / L in the absence of exogenous APS kinase enhancement. This indicates that the endogenous PAPS synthesis capacity of *E. coli* alone cannot support the high-intensity sulfation modification requirements under high-density fermentation conditions. The *Penicillium chrysogenum* source introduced in this invention... cysC Genes are like adding a booster pump to the PAPS synthesis pathway, increasing the precursor supply throughput.

[0071] Comparative Example 3 showed that CS-A (ΔDi-4S) was not detected, and only a chromatographic peak corresponding to non-sulfated chondroitin disaccharide (ΔDi-0S) was observed in the HPLC chromatogram. This confirms the structural identification of the method introduced in this invention. Chst11 The gene exhibits specificity of function. The sulfonyltransferase encoded by this gene precisely performs the modification task at the 4-O-site, and is a crucial element in the synthesis of the specific CS-A structure, rather than ordinary chondroitin.

[0072] Furthermore, Comparative Example 5, using conventional TB medium without a fed-batch strategy, yielded only 0.84 g / L, with a conversion rate as low as 0.70%. This demonstrates that simply constructing the strain is insufficient to achieve high-yield industrial-scale production. The specialized culture medium formulation provided by this invention, by adjusting the C / N ratio and phosphate buffer system, and in conjunction with a glucose-fed process, alleviates carbon source limitations and pH stress in the later stages of fermentation, ensuring the engineered bacteria's continuous synthetic capacity at high cell densities. Although the shake-flask data (2.15 g / L) of Example 4 is lower than that of the fermenter, considering the limitations of no fed-batch and pH control, its conversion rate (3.29%) is basically the same as that of the fermenter, proving that the strain's efficient synthetic characteristics are consistent across different scale-up operations.

[0073] In summary, this invention, through a systematic integration of three dimensions—gene knockout to block competition, exogenous gene enhancement to increase throughput, and fermentation process adaptation—successfully solves the key technical challenges of insufficient PAPS supply and metabolic flux dispersion in the heterologous synthesis of chondroitin sulfate A, thus achieving efficient and targeted synthesis of the target product.

[0074] Test Example 3: Product Structure Confirmation and Sulfation Degree Analysis Experimental steps: Product purification: Take 200 mL each of the fermentation supernatant from Example 1, Comparative Example 2 (low PAPS supply), and Comparative Example 3 (sulfotransferase-free). Add 3 volumes of anhydrous ethanol, allow to stand at 4°C for 12 h to precipitate, and collect the precipitate by centrifugation at 5000 rpm. Redissolve the precipitate in deionized water, and remove proteins using the Sevag method (chloroform:n-butanol = 4:1), repeating 3 times until no protein layer precipitates. Transfer the supernatant to a dialysis bag with a molecular weight cutoff (MWCO) of 3500 Da, and dialyze against flowing deionized water for 48 h to remove small molecule impurities. Freeze-dry the dialysate to obtain a white powdery purified polysaccharide sample.

[0075] Infrared spectroscopy analysis (FT-IR): 2 mg of dried polysaccharide sample was mixed and ground with 200 mg of dried potassium bromide (KBr) powder, and then pressed into transparent thin films. Fourier transform infrared spectroscopy was used at 4000-400 cm⁻¹. -1 Scanning was performed within the wavenumber range, with a resolution of 4 cm. -1 The infrared absorption spectrum was recorded 32 times, with a focus on observing the characteristic absorption peaks of the sulfate group.

[0076] Enzymatic hydrolysis analysis (LC-MS): A 1 mg / mL aqueous solution of purified polysaccharide sample was prepared, and chondroitin ABC was added. The solution was thoroughly hydrolyzed at 37°C for 4 hours to completely degrade the polysaccharide chains into unsaturated disaccharide units. The hydrolysate was filtered through a 10 kDa ultrafiltration centrifuge tube and then analyzed using LC-MS. Mass spectrometry conditions: Electrospray ionization (ESI), negative ion mode; scan range m / z 200-1000; capillary voltage 3.5 kV; drying gas temperature 350°C. The mass-to-charge ratio (m / z) of the major disaccharide fragments was detected, including unsaturated non-sulfated disaccharides (ΔDi-OS, theoretical m / z [MH]). - 378.3) and unsaturated 4-sulfated disaccharide (ΔDi-4S, theoretical m / z [MH]) - 458.3).

[0077] Nuclear magnetic resonance analysis (NMR) 1 H-NMR): 20 mg of sample was dissolved in 0.5 mL of heavy water (D2O) and placed in a 5 mm NMR tube. The NMR was then analyzed using a 600 MHz NMR spectrometer. 1 H-NMR spectra were acquired at a test temperature of 298 K. The chemical shifts of protons in the sugar ring were analyzed using the heavy water peak (HDO, δ 4.79 ppm) as an internal standard, particularly identifying shifts in the H-4 signal of GalNAc residues to determine sulfation sites.

[0078] Experimental results: The structural characterization data of the products from each experimental group are summarized in Table 3.

[0079] Table 3. Summary of structural characterization and component analysis data of fermentation products

[0080] Note: In the mass spectrum of Comparative Example 2, ion peaks of comparable intensity at 458.2 (sulfated) and 378.1 (unsulfated) appear simultaneously; the chemical shifts δ4.73-4.75 ppm are assigned to the GalNAc H-4 signal after C4 sulfation, and δ4.14-4.15 ppm are assigned to the unmodified GalNAc H-4 signal; "-" in Comparative Example 2 (without cysC The column ")" indicates that it is not applicable or has been merged into the main peak row; "-" is in Comparative Example 3 (without Chst11 The column indicates that it was not detected.

[0081] Conclusion Analysis: Based on the test data in Table 3, the chemical structures of the products of Example 1 and the comparative example can be clearly determined.

[0082] First, in the Fourier transform infrared (FT-IR) analysis, the product of Example 1 was at 1241 cm⁻¹. -1 It exhibits a strong S=O asymmetric stretching vibration absorption peak at 854 cm⁻¹, and at 854 cm⁻¹ -1 A characteristic COS axial stretching vibration absorption peak appeared at 850-860 cm⁻¹. According to spectroscopic literature, this peak is located at 850-860 cm⁻¹. -1 The absorption peak in the range is a specific fingerprint peak of the sulfate group at the C-4 position of galactosamine (distinguishing it from the C-6 sulfation peak, which usually appears at 820 cm⁻¹). -1 (Nearby). This result confirms that the product synthesized in Example 1 not only contains a sulfate group, but that this group is specifically attached to the C-4 position of GalNAc, and its structure is consistent with that of the standard chondroitin sulfate A. In contrast, the product spectrum of Comparative Example 3 did not show the above two characteristic peaks, indicating that its product is a sulfur-free chondroitin precursor.

[0083] Secondly, liquid chromatography-mass spectrometry (LC-MS) and enzymatic hydrolysis component analysis quantified the efficiency of sulfation modification. In the enzymatic hydrolysis products of Example 1, ΔDi-4S (m / z 458.1), representing the 4-sulfated disaccharide, accounted for as high as 94.2%, while the non-sulfated disaccharide ΔDi-0S (m / z 378.2) accounted for only 5.8%, indicating that the vast majority of the chondroitin skeleton underwent sulfation modification. This is attributed to the engineered strain BL21-CS-A... cysC The ample PAPS pool provided by overexpression and cysH Knock out the blockade of PAPS loss.

[0084] By comparing Example 1 with Comparative Example 2 (without) cysC The data from Comparative Example 2 further highlight the differences in mechanisms. In the product of Comparative Example 2, the proportion of sulfated disaccharide ΔDi-4S was only 41.5%, while the proportion of non-sulfated disaccharide ΔDi-0S was as high as 58.5%. 1 In the H-NMR spectrum, Comparative Example 2 showed resonance signals representing both sulfated H-4 (δ 4.74) and unsulfated H-4 (δ 4.15). This indicates that, in the absence of exogenous APS kinase enhancement, the endogenous PAPS supply rate in *E. coli* is much lower than the rate of chondroitin polymerase synthesis of the backbone, resulting in a large number of synthesized chondroitin chains not having enough time to be modified, forming an undersulfated mixture. This data conversely confirms the introduction of the present invention... cysC Genes play a crucial role in achieving the synthesis of products with high sulfation (>90%).

[0085] Finally, comparative example 3 (without) Chst11 Mass spectrometry and NMR data both showed that the product was entirely non-sulfated chondroitin (ΔDi-OS content 100%). This verifies the use of deer-white-footed rat as the source introduced in this invention. Chst11 Genes are the only functional elements that determine the conformation of the product, and their strict substrate specificity ensures that the synthesized product is pure chondroitin sulfate A, rather than other isomers (such as CS-C) or hybrids.

[0086] In summary, Test Example 3 confirmed, from three dimensions—chemical bond linkage mode (FT-IR), functional group sites (NMR), and molecular composition (LC-MS)—that the product prepared by the method of this invention is high-purity chondroitin sulfate A with a high degree of sulfation, and quantitatively revealed the decisive influence of the PAPS supply module and the sulfation modification module on the product structure and quality.

[0087] Appendix: kfoC Nucleotide sequence: SEQ ID NO:1:

[0088] kfoA Nucleotide sequence: SEQ ID NO:2:

[0089] kfoF Nucleotide sequence: SEQ ID NO:3:

[0090] cysC Nucleotide sequence: SEQ ID NO:4: ATGTCTACGTGAGTACAATACCCAATGGCAATCCATACCCGAATCTAACCTAACCAAAAACAGCAACATCACCTTCCACGCTAGCGCCCTGACCCGCAGCGAGCGCACCGAGCTGCGCAACCAGCGAGGTCTCACAATCTGGCTGACCGGACTCTCCGCCTCCGGCAAGTCAACTCTAGCCGTCGAGCTGGAGCACCAGCTCGTCCGCGACCGCGGTGTCCACGCCTACCGCCTGGACGGCGACAACATCCGCTTCGGACTGAACAAGGACCTTGGATTCAGCGAGGCCGACCGCAACGAGAACATCCGCCGCATTGCCGAGGTCGCCAAGCTGTTCGCCGACTCCAACTCCATCGCCATTACTTCCTTCATCTCGCCCTACCGGAAGGATCGTGACACTGCCCGCCAGCTGCACGAGGTTGCCACGCCCGGCGAGGAGACCGGTCTGCCTTTCGTCGAGGTCTATGTTGATGTCCCCGTTGAGGTGGCCGAGCAGCGTGACCCCAAGGGTCTGTACAAGAAGGCTCGTGAGGGTGTTATTAAGGAGTTCACTGGTATCTCGGCTCCTTATGAGGCACCGGCCAACCCTGAGGTTCATGTGAAGAACTATGAGTTGCCTGTTCAGGATGCTGTGAAGCAGATTATTGATTACCTTGACACCAAGGGTTACTTGCCTGCCAAGAAGGAGTAA。

[0091] cysH Nucleotide sequence: SEQ ID NO:5: ATGTCCAAACTCGATCTAAACGCCCTGAACGAACTGCCGAAGGTAGATCGCATTCTGGCGCTGGCGGAAACTAACGCCCAACTGGAAAAACTGGACGCTGAAGGCCGCGTAGCCTGGGCGCTGGATAATCTGCCCGGTGAATATGTGCTTTCTTCCAGCTTCGGCATTCAGGCGGCGGTGAGCCTGCATCTGGTGAATCAGATTCGGCCGGATATTCCAGTGATCCTCACCGATACCGGTTATCTGTTTCCGGAAACCTACCGCTTTATTGACGAGTTAACGGACAAACTCAAGCTCAACCTGAAAGTGTACCGTGCTACCGAAAGCGCCGCCTGGCAGGAAGCACGCTACGGCAAACTGTGGGAACAGGGCGTTGAAGGCATTGAAAAGTACAATGACATCAACAAAGTCGAACCGATGAACCGGGCGCTGAAAGAACTTAACGCGCAAACCTGGTTTGCTGGCCTGCGCCGCGAACAATCCGGCAGCCGCGCCAATTTACCGGTGCTGGCAATTCAGCGTGGCGTATTTAAAGTGCTGCCGATTATCGACTGGGATAACCGAACTATTTATCAGTACCTGCAAAAACATGGCCTGAAATATCACCCATTATGGGATGAAGGATATTTATCGGTCGGTGATACCCATACAACCCGTAAATGGGAACCTGGCATGTCGGAAGAAGAAACACGTTTCTTTGGCTTAAAAAGGGAATGTGGATTGCACGAAGGGTAA。

[0092] Chst11 Nucleotide sequence: SEQ ID NO:6:

Claims

1. Genetically engineered Escherichia coli for high conversion rate chondroitin sulfate synthesis, characterized in that, The host bacterium of the genetically engineered Escherichia coli is Escherichia coli BL21(DE3), and the genetically engineered Escherichia coli is obtained through genetic engineering technology; the modification includes: knocking out a gene encoding phosphoadenylylsulfate reductase in the genome of the host bacterium cysH ; A metabolic pathway expression cassette containing the following exogenous gene was integrated into the genome: a chondroitin synthase gene derived from Escherichia coli K4. kfoC UDP-glucose-4-epimerase gene kfoA UDP-glucose dehydrogenase gene kfoF Derived from the adenosine-5'-phosphate-sulfate kinase gene of Penicillium chrysogenum cysC And the chondroitin-4-O-sulfotransferase gene derived from the deer-footed mouse. Chst11 ; The genetically engineered Escherichia coli can synthesize chondroitin sulfate A using glucose.

2. The genetically engineered *Escherichia coli* with high conversion rate of chondroitin sulfate synthesis according to claim 1, characterized in that, The metabolic pathway expression cassette is arranged in tandem, each gene in the metabolic pathway expression cassette is driven by trc a promoter; and the metabolic pathway expression cassette is integrated into the lacZ site of the E. coli genome.

3. The genetically engineered *Escherichia coli* with high conversion rate of chondroitin sulfate synthesis according to claim 1, characterized in that, The nucleotide sequence of the exogenous gene is as follows: The kfoC The gene is shown in SEQ ID NO:1, the kfoA The gene is shown in SEQ ID NO:2, the kfoF The gene is shown in SEQ ID NO:3, the cysC The gene is shown in SEQ ID NO:4, the cysH The nucleotide sequence of the gene is shown in SEQ ID NO:

5. Chst11 The gene is shown in SEQ ID NO:

6.

4. A method for constructing and fermenting genetically engineered *E. coli* with high conversion rate for chondroitin sulfate synthesis, characterized in that, The genetically engineered *Escherichia coli* used to prepare the high-conversion-rate chondroitin sulfate synthesis according to claims 1-3 comprises the following steps: Knockout of host bacteria using CRISPR / Cas9 gene editing technology cysH Genes were obtained, and metabolic pathway expression cassettes were integrated into the host bacterial genome using homologous recombination technology, and engineered strains were screened to obtain them. The engineered strain was inoculated into a seed culture medium and cultured until the logarithmic growth phase to obtain a seed solution; The seed liquid was inoculated into a fermenter containing a fermentation medium, and aerobic fermentation was carried out under controlled pH, temperature and dissolved oxygen conditions. During fermentation, glucose solution is added according to the residual sugar concentration until fermentation is completed, and the fermentation broth containing chondroitin sulfate A is collected.

5. The genetically engineered Escherichia coli construction and fermentation process for high yield chondroitin sulfate synthesis as claimed in claim 4 wherein, The solvent of the fermentation medium is water, and each liter of the fermentation medium contains the following components in parts by weight: Glucose: 18.0-22.0g; Yeast extract: 8.0-12.0g; Potassium dihydrogen phosphate: 3.0-4.0g; Dipotassium hydrogen phosphate: 4.5-5.5g; Diammonium hydrogen phosphate: 3.0-4.0g; Magnesium sulfate heptahydrate: 1.2-1.8g; Citric acid: 1.5-2.5g; Vitamin B1: 4.0-5.0mg.

6. The genetically engineered Escherichia coli construction and fermentation process for high conversion rate chondroitin sulfate synthesis according to claim 5, characterized in that, The fermentation medium is prepared using a stepwise sterilization process, specifically including: The glucose was dissolved separately and sterilized at 110-120°C; The magnesium sulfate heptahydrate was dissolved separately and sterilized at 120-125°C; The vitamin B1 is dissolved and then filtered through a filter membrane to remove bacteria. Mix and dissolve the remaining components and sterilize at 120-125°C; After each component has cooled to room temperature, it is mixed under aseptic conditions.

7. The genetically engineered Escherichia coli construction and fermentation process for high conversion rate chondroitin sulfate synthesis as claimed in claim 4 wherein, The seed culture medium is LB medium, with the following formula: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride. The seed culture is terminated when the OD600 reaches 3.8-4.2, and the volume of the seed culture is 100-150 mL.

8. The genetically engineered Escherichia coli construction and fermentation process for high conversion rate chondroitin sulfate synthesis as claimed in claim 4 wherein, The control parameters during the fermentation process include: The temperature is controlled at 35-37℃; The pH value was maintained at 7.0-7.2 by adding ammonia water. The dissolved oxygen concentration is controlled to be 20%-40% by adjusting the stirring speed and aeration rate.

9. The genetically engineered Escherichia coli construction and fermentation process for high conversion rate chondroitin sulfate synthesis as claimed in claim 4 wherein, The specific method of adding glucose solution according to residual sugar concentration during fermentation is as follows: when the glucose concentration in the fermentation broth is lower than 5 g / L, a glucose solution with a concentration of 500-800 g / L is added to control the residual sugar concentration during fermentation to be maintained at 0.5-5 g / L.

10. The method for constructing and fermenting genetically engineered *Escherichia coli* with high conversion rate for chondroitin sulfate synthesis according to claim 4, characterized in that, The CRISPR / Cas9 gene editing technology includes the introduction of expression targeting. cysH The pTarget plasmid containing the sgRNA of the gene and the pCas plasmid expressing the Cas9 protein; the donor DNA used in the homologous recombination technology contains lacZ The upstream and downstream homologous arms of the site, as well as the structure located between the upstream and downstream homologous arms, are trc-kfoC-trc-kfoA-trc- kfoF-trc-cysC-trc-Chst11 Gene expression cassettes.

Images