Construction method and application of engineered escherichia coli for producing pre-lupulin
By constructing a complete biosynthetic pathway for hop hair gland genes in Escherichia coli, the problems of raw material dependence and insufficient synthesis efficiency in the method of extracting prohume from hops were solved, and efficient, low-cost synthesis and stable supply of prohume were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- QINGDAO UNIV OF SCI & TECH
- Filing Date
- 2026-04-28
- Publication Date
- 2026-07-31
AI Technical Summary
Existing methods for extracting prohumein from hops suffer from problems such as strong dependence on raw materials, unstable supply, incomplete pathways, and insufficient synthesis efficiency, making it difficult to achieve stable supply and efficient preparation.
An engineered Escherichia coli strain for the production of prohumein was constructed. Genes related to hop hairy glands were introduced into E. coli using gene recombination technology to construct a complete biosynthetic pathway. The specific synthesis of prohumein was achieved in E. coli using the CCL2, VPS, PT1/PT2, and IDI genes.
This method enables the efficient biosynthesis of prohumein, eliminating dependence on hops as a raw material, reducing costs, improving synthesis efficiency, preserving bioactivity, and providing a stable supply platform.
Smart Images
Figure CN122484015A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of humulone technology, and more specifically to a method for constructing engineered Escherichia coli for humulone production and its application. Background Technology
[0002] Hops (Humulus lupulus), also known as hops, are dioecious bittering agents essential in beer brewing and have long been used in traditional medicine as a medicinal plant. Humulone is one of the important secondary metabolites in hops, possessing pharmacological effects such as antibacterial, anti-inflammatory, sedative, hypnotic, and antitumor properties.
[0003] Currently, the acquisition of prohumcous mainly relies on plant extraction, which still has significant limitations. First, plant extraction routes are greatly affected by the variety of hops used, the growing environment, and batch variations. Furthermore, bitter acids often exist as a mixture of multiple homologues, leading to difficulties in separating the target product, significant raw material fluctuations, long preparation cycles, and high organic solvent consumption, making stable supply difficult. Second, chemical synthesis routes, due to the multifunctional and complex substitution structures of the target molecule, often require lengthy reaction steps and high purification costs, limiting both economic efficiency and scale-up. Third, existing biosynthetic research largely focuses on upstream precursor construction and total β-acid pathway synthesis, but yields are extremely low. Specialized systems are still lacking for the targeted synthesis of prohumcous, a specific target molecule. In particular, its formation process requires effective matching and synergy between CCL4, VPS, PT1 / PT2, and isoprenoid donor modules. Insufficient chassis design or pathway organization can easily lead to pathway interruption, precursor accumulation, or low final product formation efficiency, thus failing to meet the needs of targeted preparation and engineering applications of prohumcous. Summary of the Invention
[0004] The purpose of this invention is to provide a method for constructing engineered Escherichia coli for the production of prohumnisolone and its application, aiming to solve the problems of strong dependence on raw materials, unstable supply, incomplete pathways and insufficient synthesis efficiency in the existing chemical methods for extracting prohumnisolone from hops.
[0005] This invention provides a method for constructing engineered Escherichia coli for the production of humulone. The method includes transforming the pTrcHis2B-IDI plasmid and the pACYDuet-1-CCL2-VPS-PT1-linker-PT2 plasmid into Trc-low competent cells to obtain engineered Escherichia coli for the production of humulone.
[0006] The method for constructing engineered Escherichia coli for the production of prohumein in this invention starts from the existing engineered Escherichia coli Trc-low strain in the laboratory. Using gene recombination technology, the evolved gene of isoprene pyrophosphate isomerase (IDI) from Escherichia coli itself and the evolved gene of isoprene transferase (PT1) from hop trichomes are constructed into the vector plasmid pTrcHis2B. The evolved gene of phloroglucinol synthase (VPS) from hop trichomes, the evolved gene of cytoplasmic coenzyme A ligase (CCl2), and another evolved gene of isoprene transferase (PT2) are constructed into the vector plasmid pACYCDuet-1. Then, the two plasmids are transferred into the original engineered Escherichia coli strain, thereby constructing a complete prohumein biosynthetic pathway in the target strain. Compared with other expression systems (such as yeast, protozoan cells, etc.), Escherichia coli has many advantages, such as: clear genetic background, simple culture method, fast reproduction speed, strong resistance to contamination and high expression level of target gene. Moreover, this method is short in process, low in cost, not limited by raw materials, and easy to operate, whether for culture preparation or isolation and purification.
[0007] In some embodiments of the present invention, Trc-low competent cells are thawed on ice, pACYDuet-1-CCL2-VPS-PT1-linker-PT2 plasmid and pTrcHis2B-IDI plasmid are added, mixed well, and then incubated on ice for 20-30 min; heat-shocked at 42℃ for 45-75 s, then transferred to ice and incubated for 3-5 min; 900 μL of LB liquid medium is added, and the cells are revived and cultured at 37℃ and 220 rpm for 1 h; after revival, 50-100 μL of bacterial culture is spread on LB solid medium plates containing ampicillin and chloramphenicol, and inverted in a 37℃ incubator for 12-16 h.
[0008] In some embodiments of the present invention, the LB liquid culture medium is prepared as follows: Take a 250 mL Erlenmeyer flask, add 1.0 g sodium chloride, 1.0 g tryptone, and 0.5 g yeast extract in sequence, and then add 100 mL RO water to dissolve it completely; seal the flask mouth with sealing film and rubber band, place it in an autoclave, add RO water to the high water level mark, and set the autoclave to 121 ℃ for 25 min for sterilization.
[0009] In some embodiments of the present invention, the LB solid culture medium is prepared as follows: Take a 250 mL Erlenmeyer flask, add 1.0 g sodium chloride, 1.0 g tryptone, 0.5 g yeast extract and 1.5 g agar in sequence, and then add 100 mL RO water to dissolve it completely; seal the mouth of the flask with sealing film and rubber band and place it in an autoclave, add RO water to the high water level mark in the autoclave, and set it to sterilize at 121 ℃ for 25 min.
[0010] In some embodiments of the present invention, the method for preparing the Trc-low competent cells includes: activation of the host strain: taking out the Trc-low Escherichia coli stored at -80℃ in glycerol and thawing it in an ice box; under aseptic conditions, taking the bacterial solution and streaking it on an LB solid medium plate for separation, and inverting it in a 37℃ constant temperature incubator for 12-16 hours to obtain single colonies; Preparation of competent cells: Take a 50 mL centrifuge tube and add 25 mL of LB liquid medium; pick a suitable single colony from the medium plate and inoculate it into a centrifuge tube, and culture it with shaking at 37℃ and 220 rpm. Stop the culture when the OD600 of the bacterial solution grows to 0.35-0.50; aliquot the culture medium into pre-chilled centrifuge tubes and centrifuge at 4℃ and 4000 rpm for 5 min, and discard the supernatant; add pre-chilled competent cell preparation solution Solution A to the bacterial pellet, gently resuspend it by pipetting, and centrifuge again at 4℃ and 4000 rpm for 5 min, and discard the supernatant; add pre-chilled resuspended bacterial solution Solution B, aliquot and store at -80℃ to obtain Trc-low competent cells.
[0011] This invention provides an engineered Escherichia coli for the production of prohumein, wherein the engineered Escherichia coli for the production of prohumein is an engineered Escherichia coli obtained by the method described above for constructing the engineered Escherichia coli for the production of prohumein.
[0012] The engineered Escherichia coli used in the production of prohumein of this invention can be directly used to synthesize prohumein, thus providing a novel synthetic method for prohumein synthesis. This is a biosynthetic method that avoids the limitations of hop raw materials, achieves the preservation of biological activities that are difficult to achieve through chemical synthesis, and has higher selectivity and efficiency in synthesizing prohumein using engineered strains compared to the natural product method.
[0013] This invention provides an application of engineered Escherichia coli in the biosynthesis of prehumulone, comprising the following steps: taking the engineered Escherichia coli obtained by the method for constructing engineered Escherichia coli for prehumulone production and performing shake-flask fermentation.
[0014] This invention starts with existing engineered strains in the laboratory and utilizes metabolic engineering technology to introduce key enzyme genes of the humulone synthesis pathway into engineered Escherichia coli strains via vectors, constructing a fermentation strain capable of fully biosynthesizing humulone. The resulting engineered E. coli then ferments prohumulone, representing a novel method for prohumulone synthesis. This method is simple to operate, has a short process, low cost, eliminates dependence on hops as a raw material, enables large-scale production, has high synthesis efficiency, avoids excessive solvent consumption, fully preserves the bioactivity of prohumulone, and exhibits high selectivity.
[0015] In some embodiments of the present invention, shake-flask fermentation includes the following steps: The primary seed culture was prepared using 10 mL of LB liquid medium, with 9 μL of chloramphenicol and 9 μL of ampicillin added respectively. Then, single colonies of engineered Escherichia coli that had been verified by PCR were picked and added to the primary seed culture for 12 h. The secondary seed culture was prepared using 100 mL of LB liquid medium, with 90 μL of chloramphenicol and 90 μL of ampicillin added respectively. It was cultured at 37℃ and 220 rpm, and then 5 mL of the primary seed culture was added and cultured for 12 h. The secondary seed culture was transferred into the fermentation medium at an inoculation volume of 10 mL, and 400 μL of magnesium sulfate, 180 μL of chloramphenicol, 180 μL of ampicillin and 200 μL of trace elements were added at the same time. The culture was carried out at 37 ℃ and 220 rpm.
[0016] After culturing for 12 h, 100 μL of IPTG was added for induction, followed by 1 mL of isobutyric acid, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement. The mixture was then cultured with shaking. Subsequently, 1 mL of isobutyric acid, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement were added again at 24 h and 36 h of fermentation, respectively; 5 mL of glucose supplement was added every 24 h for a total of 2 times; OD600 and pH were measured every 12 h during fermentation, and the pH was adjusted to near neutral. Fermentation was terminated when OD600 decreased twice consecutively; the fermentation broth was centrifuged at 10,000 rpm for 15 min at 4℃, the cells were collected, and after washing, prohumein was obtained.
[0017] Compared with the prior art, the advantages and positive effects of the present invention are: This invention utilizes a Trc-low competent cell host and constructs a prohumdelin-engineered bacterium using pACYDuet-1-CCL2-VPS-PT1-linker-PT2 and pTrcHis2B-IDI. By coordinating the CCL2 side-chain precursor activation function with the IDI / DMAPP donor module and further connecting the VPS-mediated backbone construction and the PT1 / PT2-mediated continuous isoprenylation process, the prohumdelin-targeted pathway can operate relatively completely within the same host, thereby improving the specificity, continuity, and targeted nature of the product's biosynthesis. Furthermore, this invention establishes an engineered prohumdelin supply platform that can replace natural trace-level isolation, and also provides a strain basis for subsequent activity studies, structural modifications, and the development of related derivatives. Attached Figure Description
[0018] Figure 1 This is a liquid chromatography-mass spectrometry (LC-MS) diagram of isovaleryl phloroglucinol, an intermediate of humulone in this invention. Figure 2 This is a liquid chromatography-mass spectrometry (LC-MS) diagram of the deoxyprohumulone precursor of the present invention. Figure 3 This is a liquid chromatography-mass spectrometry (LC-MS) diagram of hummus before the invention. Detailed Implementation
[0019] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. Those skilled in the art should understand that the specific description below is illustrative rather than restrictive and should not be construed as limiting the scope of protection of this invention.
[0020] The method for constructing engineered Escherichia coli for hummus production according to the present invention includes the following steps: The pTrcHis2B-IDI plasmid and pACYDuet-1-CCL2-VPS-PT1-linker-PT2 plasmid were transformed into Trc-low competent cells to obtain engineered E. coli for prohumdelinton.
[0021] This invention utilizes a Trc-low competent cell host and constructs a prohumdelin-engineered bacterium using pACYDuet-1-CCL2-VPS-PT1-linker-PT2 and pTrcHis2B-IDI. By coordinating the CCL2 side-chain precursor activation function with the IDI / DMAPP donor module and further connecting the VPS-mediated backbone construction and the PT1 / PT2-mediated continuous isoprenylation process, the prohumdelin-targeted pathway can operate relatively completely within the same host, thereby improving the specificity, continuity, and targeted nature of the product's biosynthesis. Furthermore, this invention establishes an engineered prohumdelin supply platform that can replace natural trace-level isolation, and also provides a strain basis for subsequent activity studies, structural modifications, and the development of related derivatives.
[0022] This invention uses engineered Escherichia coli Trc-low as the chassis, CCL2 as the side chain introduction enzyme, and constructs a dual plasmid co-expression system of pACYDuet-1-CCL2-VPS-PT1-linker-PT2 and pTrcHis2B-IDI to reconstruct a specific heterologous synthetic route for prohumein in Trc-low.
[0023] The core idea of this invention is to use CCL2 to enable the engineered bacteria to have the side-chain directing ability towards prohumein, while retaining VPS, PT1 / PT2 and IDI as common core modules, thereby realizing the specific biosynthesis of prohumein in Escherichia coli.
[0024] In this invention, CCL2 is responsible for activating the corresponding side-chain precursor of prohumcous to acyl-CoA; VPS is responsible for constructing the acyl-phloroglucinol backbone; PT1 / PT2 is responsible for continuous isoprene ylation; and IDI is responsible for increasing the availability of dimethylallyl pyrophosphate. CCL2 has high activity for longer branched-chain fatty acids, and is particularly suitable for the introduction of prohumcous side-chain precursors; CCL2 is an important short-chain acyl-CoA in the picric acid pathway, and the difference in substrate recognition of the upstream side-chain precursor is one of the keys to the formation of different β-acid homologues.
[0025] This invention employs a dual-plasmid co-expression scheme: the first expression vector is pACYDuet-1-CCL2-VPS-PT1-linker-PT2; the second expression vector is pTrcHis2B-IDI. The first expression vector undertakes the main reaction portion of the prohumderine target pathway, while the second expression vector undertakes the isoprene group supply regulation portion. When both are introduced into Trc-low, a continuous biocatalytic reaction is formed: CCL2 activates the prohumderine side-chain precursor into acyl-CoA; VPS uses this acyl-CoA to construct an aromatic intermediate with malonyl-CoA; PT1 / PT2 completes continuous aromatic isoprene ylation; and IDI enhances the supply of dimethylallyl pyrophosphate (DMAPP), working in conjunction with the host mevalonate module to promote the formation of the final product.
[0026] Specifically, the method for constructing engineered Escherichia coli for hummus production according to the present invention includes the following steps: 1) Take Trc-low competent cells and thaw them on ice. Add pACYDuet-1-CCL2-VPS-PT1-linker-PT2 plasmid and pTrcHis2B-IDI plasmid, mix well and let stand on ice for 20-30 minutes. 2) Heat shock at 42℃ for 45-75 seconds, then transfer to ice and let stand for 3-5 minutes; 3) Add 900 μL of LB liquid medium and revive the culture at 37°C and 220 rpm for 1 h; 4) After resuscitation, take 50-100 μL of bacterial culture and spread it on LB double-antibiotic solid medium plates containing ampicillin and chloramphenicol, and invert them in a 37℃ incubator for 12-16 h.
[0027] In this invention, the method for preparing Trc-low competent cells includes: Activation of host strain: Take out the Trc-low Escherichia coli stored at -80℃ in glycerol and thaw it in an ice box; under aseptic conditions, take the bacterial culture and streak it on LB solid medium plates for isolation, and incubate it upside down in a 37℃ constant temperature incubator for 12-16 hours to obtain single colonies; Preparation of competent cells: Take a 50 mL centrifuge tube and add 25 mL of LB liquid medium; pick a single colony with suitable growth from the medium plate and inoculate it into a centrifuge tube, and incubate with shaking at 37℃ and 220 rpm until the bacterial culture OD... 600Stop culturing when the cell growth reaches 0.35-0.50; aliquot the culture medium into pre-chilled centrifuge tubes, centrifuge at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled competent cell preparation solution A to the cell pellet, gently resuspend by pipetting, and centrifuge again at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled resuspended cell solution B, aliquot and store at -80℃ to obtain Trc-low competent cells.
[0028] The pACYDuet-1-CCL2-VPS-PT1-linker-PT2 expression vector uses pACYDuet-1 as its backbone. This vector contains a chloramphenicol resistance selection marker, two multiple cloning sites, a T7 promoter, and a ribosome binding site, making it suitable for multi-gene expression in *E. coli*. Hops-derived ccl2, vps, pt1, and pt2 were selected as target genes. pt1 and pt2 underwent further optimization for *E. coli* expression by removing their N-terminal transport peptide / signal peptide sequences, resulting in pt1r and pt2r, respectively. Subsequently, a flexible linker peptide (Gly-Gly-Gly-Gly-Ser)3 was used to tandemly connect pt1r and pt2r to construct a fusion gene. The stop codon of pt1r was removed, while the stop codon of pt2r was retained, allowing the two gene segments to be expressed continuously within the same open reading frame, resulting in the pt1r-linker-pt2r fusion fragment. Then, ccl2, vps, and pt1r-linker-pt2r were integrated into the pACYDuet-1 vector to construct the recombinant expression plasmid pACYDuet-1-CCL2-VPS-PT1-linker-PT2.
[0029] pTrcHis2B-IDI uses pTrcHis2B as another backbone expression vector. This vector is ampicillin resistant, contains only one multiple cloning site, and has its own Trc promoter, making it suitable for high-copy expression in *E. coli*. The idi gene was selected as the target gene, optimized for expression in *E. coli*, and then inserted into the multiple cloning site of pTrcHis2B to construct the recombinant expression plasmid pTrcHis2B-IDI.
[0030] The nucleotide sequence of CCL2 is shown in SEQ ID NO:1, the nucleotide sequence of VPS is shown in SEQ ID NO:2, the nucleotide sequence of Pt1linkerPt2 is shown in SEQ ID NO:3, the nucleotide sequence of IDI is shown in SEQ ID NO:4, the nucleotide sequence of PT1 is shown in SEQ ID NO:5, the nucleotide sequence of PT2 is shown in SEQ ID NO:6, and the nucleotide sequence of Linker is shown in SEQ ID NO:7.
[0031] The present invention discloses an engineered Escherichia coli for use in the production of humulone, wherein the engineered Escherichia coli for use in the production of humulone is obtained according to the above-described method for constructing engineered Escherichia coli for use in the production of humulone.
[0032] The present invention relates to the application of engineered Escherichia coli in the biosynthesis of prehumulone, comprising the following steps: taking engineered Escherichia coli obtained by the above-described method for constructing engineered Escherichia coli for prehumulone production and performing shake-flask fermentation.
[0033] Shake-flask fermentation includes the following steps: The primary seed culture was prepared using 10 mL of LB liquid medium, with 9 μL of chloramphenicol and 9 μL of ampicillin added respectively. Then, single colonies of engineered Escherichia coli that had been verified by PCR were picked and added to the primary seed culture for 12 h. The secondary seed culture was prepared using 100 mL of LB liquid medium, with 90 μL of chloramphenicol and 90 μL of ampicillin added respectively. It was cultured at 37℃ and 220 rpm, and then 5 mL of the primary seed culture was added and cultured for 12 h. The secondary seed culture was transferred into the fermentation medium at an inoculation volume of 10 mL, and 400 μL of magnesium sulfate, 180 μL of chloramphenicol, 180 μL of ampicillin and 200 μL of trace elements were added at the same time. The culture was carried out at 37 ℃ and 220 rpm.
[0034] After culturing for 12 h, 100 μL of IPTG was added for induction, followed by 1 mL of isobutyric acid, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement. The mixture was then cultured with shaking. Subsequently, at 24 h and 36 h of fermentation, 1 mL of isobutyric acid supplement, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement were added again, respectively; glucose supplement was added 5 mL every 24 h, for a total of 2 times; OD was measured every 12 h during fermentation. 600 And pH, and adjust the pH to near neutral.
[0035] When OD 600Fermentation was terminated when the temperature dropped twice in a row. The fermentation broth was centrifuged at 10,000 rpm for 15 min at 4°C, and the cells were collected. After washing, prohumein was obtained.
[0036] The following figures illustrate the reaction process of the method for constructing engineered Escherichia coli for the production of humulone according to the present invention, and the reaction process of the application of engineered Escherichia coli in the biosynthesis of humulone.
[0037]
[0038] Example 1 The method for constructing engineered Escherichia coli for hummus production in Example 1 includes the following steps: 1) Activation of host strain Trc-low Escherichia coli stored at -80 ℃ in glycerol was removed and thawed in an ice box; under aseptic conditions, the bacterial culture was streaked onto LB solid medium plates for separation, and then incubated upside down in a 37 ℃ constant temperature incubator for 12-16 h to obtain single colonies.
[0039] 2) Preparation of Trc-low competent cells Take two 50 mL centrifuge tubes and add 25 mL of LB liquid medium to each. Pick two suitable single colonies from the medium plate and inoculate them into the two centrifuge tubes respectively. Incubate at 37°C and 220 rpm with shaking until the bacterial growth rate reaches OD. 600 Stop culturing when the cell growth reaches 0.35-0.50; aliquot the culture medium into pre-chilled centrifuge tubes, centrifuge at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled competent cell preparation solution A to the cell pellet, gently resuspend by pipetting, and centrifuge again at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled resuspended cell solution B, aliquot and store at -80℃ to obtain Trc-low competent cells.
[0040] 3) Two-plasmid transformation Take the Trc-low competent cells obtained in step 2 and thaw them on ice. Add 3 μL of pACYDuet-1-CCL2-VPS-PT1-linker-PT2 plasmid and 3 μL of pTrcHis2B-IDI plasmid, respectively, mix gently, and incubate on ice for 20-30 min. Then heat shock at 42 ℃ for 45-75 s, and immediately transfer to ice and incubate for 3-5 min. Add 900 μL of LB liquid medium and resuscitate at 37 ℃ and 220 rpm for 1 h. After resuscitation, spread 50-100 μL of bacterial culture onto LB solid medium plates containing ampicillin and chloramphenicol, invert the plates, and incubate at 37 ℃ for 12-16 h to obtain double-resistant transformants.
[0041] 4) PCR verification of positive transformants Single colonies were picked from LB solid agar plates and inoculated into LB liquid medium containing ampicillin and chloramphenicol. After incubation at 37 °C and 220 rpm for 4-5 h with shaking, the bacterial culture was used as a template for colony PCR verification. Preferably, specific primers designed for pACYDuet-1-CCL2-VPS-PT1-linker-PT2 and pTrcHis2B-IDI were used for amplification to simultaneously verify that both expression vectors had been introduced into the host bacteria. Positive clones detected by PCR amplification were considered successfully constructed engineered *E. coli* for hummus production.
[0042] The primers used for the prohummus route are: CCL2-VPS-PT1-linker-PT2-F:GTGCTGACCAAATTATCAAATTC; CCL2-VPS-PT1-linker-PT2-R:GCTGTAATGGGATTCTTCTTCC; pTrcHis2B-IDI-F:GAGCGTGACACCACGATGC; pTrcHis2B-IDI-R:GCGTGGCGCTTTCTCATAG.
[0043] Positive clone verification: Primers were designed based on the plasmid map to perform PCR amplification and verification of positive strains.
[0044] PCR conditions can be as follows: 95 ℃ pre-denaturation for 3 min; 95 ℃ for 16 s, 59 ℃ for 16 s, 72 ℃ for 30 s, for a total of 32 cycles. Loop; final extension at 72 ℃ for 5 min. Agarose gel electrophoresis showed that the pre-humulone route bacterial culture sample could amplify a band consistent with the plasmid positive control, and the transformants could be observed to grow normally on LB solid medium plates, indicating that the strain was successfully constructed.
[0045] LB liquid medium: Take a 250 mL Erlenmeyer flask and add 1.0 g sodium chloride, 1.0 g tryptone, and 0.5 g yeast extract in sequence. Then add 100 mL RO water to dissolve them completely. Seal the flask with sealing film and rubber band and place it in an autoclave. Add RO water to the high water level mark and set the autoclave to 121 °C for 25 min.
[0046] LB liquid medium contains 0.09 g / L ampicillin and 0.031 g / L chloramphenicol.
[0047] LB solid medium: Take a 250 mL Erlenmeyer flask and add 1.0 g sodium chloride, 1.0 g tryptone, 0.5 g yeast extract, and 1.5 g agar in that order. Then add 100 mL RO water to dissolve the contents completely. Seal the flask with sealing film and a rubber band, place it in an autoclave, add RO water to the high water level mark, and set the autoclave to 121 °C for 25 min.
[0048] LB solid medium contains 0.09 g / L ampicillin and 0.031 g / L chloramphenicol. Example 2
[0049] The present invention discloses the application of engineered Escherichia coli in the biosynthesis of prehumulone, comprising the following steps: The recombinant strain that tested positive for both antibiotics and PCR was identified as the prohumnisolone engineered strain. The obtained positive engineered strain was used for shake-flask fermentation. First, primary and secondary seed cultures were prepared: the primary seed culture consisted of 10 mL LB broth with 9 μL chloramphenicol and 9 μL ampicillin added, respectively. Single colonies validated by PCR were then added to the primary seed culture and cultured for 12 h. The secondary seed culture consisted of 100 mL LB broth with 90 μL chloramphenicol and 90 μL ampicillin added, cultured at 37 ℃ and 220 rpm, and then 5 mL of the primary seed culture was added and cultured for 12 h. Subsequently, the secondary seed culture was transferred to the fermentation medium at an inoculum size of 10 mL, along with 400 μL magnesium sulfate, 180 μL chloramphenicol, 180 μL ampicillin, and 200 μL trace elements, and cultured at 37 ℃ and 220 rpm.
[0050] After 12 h of culture, 100 μL of IPTG was added for induction, followed by 1 mL of 4-methylvaleric acid, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement, and the culture was continued with shaking. 4-Methylvaleric acid served as a precursor to the prohumgue side chain. Subsequently, at 24 h and 36 h of fermentation, 1 mL of 4-methylvaleric acid, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement were added again, respectively; glucose supplement was added twice, 5 mL every 24 h. OD was measured every 12 h during fermentation. 600 And pH, and adjust the pH to near neutral.
[0051] When OD 600 Fermentation was terminated after two consecutive drops. The fermentation broth was centrifuged at 10,000 rpm for 15 min at 4 ℃, and the cells were collected. After washing, the cells were extracted and analyzed, thus enabling the biosynthesis of prohumein.
[0052] Product detection and application effects of prohumgue: In a 200 mL shake flask system, after optimized feeding, the weight of crude prohumgue product increased from the initial 0.141 g / L to 0.434 g / L; LC-MS detected the molecular signals of prohumgue intermediates, precursors, and products. The deprotonated ion [MH] signal corresponding to prohumgue is consistent with the theoretical molecular weight of 427.2854 g / mol. These results indicate that the engineered *E. coli* strain constructed in this invention possesses the ability to biosynthesize prohumgue and can be used as a prohumgue preparation strain. However, since there is currently no prohumgue standard available on the market, accurate quantification is not possible at this stage.
[0053] Figure 1 This is a liquid chromatography-mass spectrometry (LC-MS) image of isovaleryl phloroglucinol, an intermediate of prohumein. Figure 2 This is a liquid chromatography-mass spectrometry (LC-MS) image of deoxyprohumulone, the precursor of prohumulone. Figure 3 This is a liquid chromatography-mass spectrometry (LC-MS) image of prohumein; by Figure 1 , Figure 2 , Figure 3 It can be seen that the corresponding liquid chromatography-mass spectrometry signals of isovaleryl phloroglucinol, deoxyprohumulone, and prohumulone were detected in the fermentation sample, indicating that the engineered Escherichia coli constructed in this invention has the ability to biosynthesize prohumulone, and the key intermediates, precursors, and final products in the target pathway can be continuously detected; among them, the [M−H] signal corresponding to prohumulone is consistent with the theoretical molecular weight, indicating that the obtained product has good consistency with the target compound.
[0054] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A method for constructing engineered Escherichia coli for the production of hummus, characterized in that, The method includes: Take Trc-low competent cells and thaw them on ice. Add pACYDuet-1-CCL2-VPS-PT1-linker-PT2 plasmid and pTrcHis2B-IDI plasmid, mix well and let stand on ice for 20-30 minutes. Heat shock at 42℃ for 45-75 seconds, then transfer to ice and let stand for 3-5 minutes; Add 900 μL of LB liquid medium and revive the culture at 37°C and 220 rpm for 1 h. After resuscitation, take 50-100 μL of bacterial culture and spread it on LB solid medium plates containing ampicillin and chloramphenicol, then invert the plates and incubate them at 37°C for 12-16 hours.
2. The method for constructing engineered Escherichia coli for hummus production according to claim 1, characterized in that, The LB liquid culture medium is prepared by adding sodium chloride, tryptone, yeast extract, and RO water to a bottle and dissolving them thoroughly. The bottle opening is then sealed with sealing film and rubber bands and placed in an autoclave. RO water is added to the autoclave up to the high water level mark, and the autoclave is set to 121°C for 25 minutes for sterilization.
3. The method for constructing engineered Escherichia coli for hummus production according to claim 2, characterized in that, The concentrations of sodium chloride, tryptone, and yeast extract were 1% g / mL and 0.5% g / mL, respectively.
4. The method for constructing engineered Escherichia coli for hummus production according to claim 1, characterized in that, The LB solid culture medium is prepared by adding sodium chloride, tryptone, yeast extract, agar, and RO water to a bottle and dissolving them thoroughly. The bottle opening is then sealed with sealing film and rubber bands and placed in an autoclave. RO water is added to the autoclave up to the high water level mark, and the autoclave is set to 121°C for 25 minutes for sterilization.
5. The method for constructing engineered Escherichia coli for hummus production according to claim 4, characterized in that, The concentrations of sodium chloride, tryptone, yeast extract, and agar were 1.5% g / mL.
6. The method for constructing engineered Escherichia coli for hummus production according to claim 1, characterized in that, The method for preparing the Trc-low competent cells includes: Activation of host strain: Take out the Trc-low Escherichia coli stored at -80℃ in glycerol and thaw it in an ice box; under aseptic conditions, take the bacterial culture and streak it on LB solid medium plates for isolation, and incubate it upside down in a 37℃ constant temperature incubator for 12-16 hours to obtain single colonies; Preparation of competent cells: Take a centrifuge tube and add 25 mL of LB liquid medium; pick a single colony with suitable growth from the medium plate and inoculate it into a centrifuge tube, and incubate with shaking at 37℃ and 220 rpm until the bacterial culture OD... 600 Stop culturing when the cell growth reaches 0.35-0.50; aliquot the culture medium into pre-chilled centrifuge tubes, centrifuge at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled competent cell preparation solution A to the cell pellet, gently resuspend by pipetting, and centrifuge again at 4℃ and 4000rpm for 5 min, and discard the supernatant; add pre-chilled resuspended cell solution B, aliquot and store at -80℃ to obtain Trc-low competent cells.
7. An engineered Escherichia coli for the production of hummus, characterized in that, The engineered Escherichia coli for pre-production hummus is the engineered Escherichia coli obtained by the method for constructing engineered Escherichia coli for pre-production hummus according to any one of claims 1-6.
8. The application of an engineered Escherichia coli in the biosynthesis of prehumulone, characterized in that, Includes the following steps: The engineered Escherichia coli obtained by the method for constructing engineered Escherichia coli for hummus production according to claim 1 was subjected to shake-flask fermentation.
9. The application of the engineered Escherichia coli according to claim 8 in the biosynthesis of prehumulone, characterized in that, Shake-flask fermentation includes the following steps: The primary seed culture was prepared using 10 mL of LB liquid medium, with 9 μL of chloramphenicol and 9 μL of ampicillin added respectively. Then, single colonies of engineered Escherichia coli that had been verified by PCR were picked and added to the primary seed culture for 12 h. The secondary seed culture was prepared using 100 mL of LB liquid medium, with 90 μL of chloramphenicol and 90 μL of ampicillin added respectively. It was cultured at 37℃ and 220 rpm, and then 5 mL of the primary seed culture was added and cultured for 12 h. The secondary seed culture was transferred into the fermentation medium at an inoculation volume of 10 mL, and 0.00984 g magnesium sulfate, 180 μL chloramphenicol, 180 μL ampicillin and 200 μL trace elements were added at the same time. The culture was carried out at 37 ℃ and 220 rpm. After culturing for 12 h, 100 μL of isopropyl-β-D-thiogalactoside IPTG was added for induction, and 1 mL of isobutyric acid, 1 mL of mevalonic acid supplement and 1 mL of yeast extract supplement were added, and the mixture was continued to be shaken and cultured. Subsequently, at 24 h and 36 h of fermentation, 1 mL of isobutyric acid supplement, 1 mL of mevalonic acid supplement, and 1 mL of yeast extract supplement were added again, respectively; glucose supplement was added 5 mL every 24 h, for a total of 2 times; OD was measured every 12 h during fermentation. 600 And pH, and adjust the pH to near neutral; When OD 600 Fermentation was terminated when the temperature dropped twice in a row. The fermentation broth was centrifuged at 10,000 rpm for 15 min at 4°C, and the cells were collected. After washing, prohumein was obtained.
10. The application of the engineered Escherichia coli according to claim 9 in the biosynthesis of prehumulone, characterized in that, The trace elements include 0.0037 g / L ammonium molybdate tetrahydrate, 0.0025 g / L copper sulfate pentahydrate, 0.0029 g / L zinc sulfate heptahydrate, 0.0158 g / L manganese chloride tetrahydrate, and 0.0247 g / L boric acid.