Application of acyr gene in improving plant tolerance to cadmium stress

Abstract

This invention discloses the application of the ACYR gene in enhancing the tolerance of plants to cadmium stress. The amino acid sequence of the ACYR protein is shown in SEQ ID NO. 7-10. Knockout of the ACYR gene in Arabidopsis thaliana, rice, and alfalfa... ACRY Genes that enhance cadmium tolerance, overexpressed in alfalfa ACRY The gene increases its sensitivity to cadmium stress. This invention provides key gene resources and technical support for improving heavy metal resistance in crops and ensuring food safety.

Description

Technical Field

[0001] This invention relates to the application of the ACYR gene in enhancing the plant's tolerance to cadmium stress. Background Technology

[0002] Soil pollution from the heavy metal cadmium (Cd) has become a significant environmental problem hindering sustainable agricultural development and threatening food security. Cadmium inhibits plant root development, damages photosynthetic systems, and interferes with mineral nutrient absorption, leading to reduced crop yields and lower quality. Furthermore, it can accumulate through the food chain and harm human health.

[0003] RNA chemical modification, as an important aspect of epigenetic transcriptional regulation, plays a crucial role in life information transmission, gene expression regulation, and environmental stress response. Among these modifications, N4-acetylated cytosine (ac...) 4 C) is a novel type of mRNA chemical modification that has attracted much attention in plants in recent years, mainly catalyzed by acetyltransferases ACYRs. 4 C modification has been reported to participate in processes related to growth and development and abiotic stress response, such as leaf development, flowering regulation, photosynthesis, and plant disease resistance, suggesting that this modification plays an important regulatory role in stress adaptation.

[0004] Currently, the discovery of cadmium-tolerant genes in plants mainly focuses on genes related to transport proteins, transcription factors, and antioxidants. 4 C-modification encoding genes ACRY Whether it is involved in cadmium stress tolerance remains to be explored. Therefore, further investigation is needed. ACRY The study aims to explore the function and application of cadmium stress response in plants, thereby improving the epigenetic regulatory network of cadmium stress and providing new gene resources and technical pathways for molecular breeding of cadmium-tolerant and low-cadmium-accumulating crops. Summary of the Invention

[0005] Purpose of the invention: This invention provides the application of the ACYR gene in enhancing the plant's tolerance to cadmium stress.

[0006] Technical solution: The present invention provides an ACYR protein, the amino acid sequence of which is shown in SEQ ID NO.10.

[0007] The present invention also provides a gene encoding the ACYR protein.

[0008] Its nucleotide sequence is shown in SEQ ID NO.6.

[0009] The present invention also provides the application of the ACYR protein or the gene encoding the ACYR protein in regulating the ability of plants to tolerate cadmium stress, wherein the amino acid sequence of the ACYR protein is shown in any one of SEQ ID NO. 7 to 10.

[0010] Among them, the ability of plants to tolerate cadmium stress is regulated by inhibiting or promoting the expression of ACYR protein.

[0011] Among them, by knocking out or overexpressing plant genes ACRY Genes enable plants to regulate their tolerance to cadmium stress.

[0012] The nucleotide sequence of the gene is shown in any one of SEQ ID NO.1~2 or SEQ ID NO.5~6.

[0013] The ability to regulate cadmium stress includes improving the plant's ability to tolerate cadmium stress.

[0014] The plants mentioned include Arabidopsis thaliana, rice, or alfalfa.

[0015] The present invention also provides the application of the gene silencing vector in improving the ability of plants to tolerate cadmium stress.

[0016] Among them, the ACRY The gene number is either Arabidopsis thaliana (At1g10490 and At3g57940), or rice (LOC_Os12g07300), or alfalfa (MsG0480023388.01).

[0017] This invention also provides ACRY Application of gene regulation of cadmium tolerance in plants.

[0018] Among them, Arabidopsis thaliana Attack Application of mutants in cadmium tolerance AtACYR1 The CDS sequence is shown in SEQ ID No. 1. AtACYR2 The CDS sequence of the gene is shown in SEQ ID No. 2. AtACYR1 The genome sequence is as shown in SEQ ID No. 3. AtACYR2 The genome sequence of AtACYR1 protein is shown in SEQ ID No. 4, the amino acid sequence of AtACYR2 protein is shown in SEQ ID No. 7, and the amino acid sequence of AtACYR2 protein is shown in SEQ ID No. 8.

[0019] SEQ ID No. 1: SEQ ID No.2: SEQ ID No.3: SEQ ID No.4: SEQ ID No.7: SEQ ID No.8:

[0020] Among them, rice ACRY The application of gene knockout in cadmium tolerance, specifically by knocking out genes in rice. ACRY Genes obtained Osacyr mutant, the aforementioned OsACYR The CDS sequence of the gene is shown in SEQ ID No. 5, and the amino acid sequence of the protein it encodes is shown in SEQ ID No. 9.

[0021] SEQ ID No. 5: SEQ ID No. 9: .

[0022] alfalfa MsACYR The application of genes in cadmium tolerance, specifically through the construction of alfalfa... MsACYR Overexpression mutants or knockout MsACYR Genes obtained Massacre Deletion mutant, the aforementioned MsACYR The CDS sequence of the gene is shown in SEQ ID No. 6, and the amino acid sequence of the protein it encodes is shown in SEQ ID No. 10.

[0023] SEQ ID No. 6: SEQ ID No.10:

[0024] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: Compared with wild-type plant materials, the present invention... ACRY Gene knockout plants are more tolerant to cadmium stress. Specifically, under cadmium stress, their leaves have a relatively higher chlorophyll content, and the overexpressed material is more sensitive than the wild type. This invention provides a novel genetic resource for the breeding and improvement of cadmium-tolerant crop varieties. Attached Figure Description

[0025] Figure 1 Evolutionary analysis of ACYR genes in Arabidopsis thaliana, rice, and alfalfa; Figure 2 : ACRY Effects of gene deletion on cadmium stress tolerance in Arabidopsis thaliana: A: AtACYRs Relative gene expression levels; B: Arabidopsis thaliana Attackers The mutant exhibits cadmium stress tolerance phenotype; C: relative chlorophyll content; Figure 3 : ACRY The effect of gene deletion on cadmium stress tolerance in rice: A: Rice Osacyr Mutant cadmium stress tolerant phenotype; B: relative chlorophyll content; Figure 4 : ACRY Effects of gene deletion or overexpression on cadmium stress tolerance in alfalfa: A: Alfalfa MsACYR Overexpression materials and MsACYR B: Cadmium stress phenotype of knockout materials; MsACYR Relative gene expression level; C: relative chlorophyll content. Detailed Implementation

[0026] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0027] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0028] ACRY Gene deletion mutants include Arabidopsis thaliana ACRY Gene deletion mutant SALK_070262 ( Attacker 1 ) , SALK_011936 ( Attacker 2 (Source: Nottingham Arabidopsis thaliana stock center. Rice) ACRY Gene deletion mutants ( OsacyrThe material was obtained from Weimi Biotechnology (Hainan) Co., Ltd., with the following knockout targets: sgRNA1: CCAAGCAAGGACTTAACAAT, sgRNA2: GGTCCATTATTTGGAGCAGA. Alfalfa overexpression material. MsACYR-YES (The CDS sequence is shown in SEQ ID NO.6) and ACRY Gene deletion mutant MsACYR-Crispr Obtained from Qingdao Weike Biotechnology Co., Ltd., the knockout target sites are: sgRNA1:TGAGGGGCAGATATCTCGTC, sgRNA2:GGGTCTTTTGGATCCTGAGA, sgRNA3:GCAAGGCTCAGATCAAATCA.

[0029] Example 1: Different plants ACRY Comparative analysis of gene sequences Arabidopsis thaliana used in this invention AtACYR1 and AtACYR2 The genes were obtained from the Tair website (https: / / www.arabidopsis.org / ), and their NCBI accession numbers are AT1G10490 (AtACYR1) and AT3G57940 (AtACYR2). AtACYR1 The CDS sequence of the gene deletion mutant is shown in SEQ ID No. 1. AtACYR2 The CDS sequence of the gene deletion mutant is shown in SEQ ID No. 2. Using the protein sequences of AtACYR1 and AtACYR2 as bait, BLAST was performed on the Phytozome website (https: / / phytozome-next.jgi.doe). Search results for rice and alfalfa were selected and sequences were downloaded. Sequence alignment and evolutionary analysis were performed using MEGA X (https: / / www.megasoftware.net / ). The results are as follows. Figure 1 As shown. Sequence alignment identified the rice homolog LOC_Os12g07300 and the alfalfa homologs MsG0280007563.01, MsG0280007578.01, and MsG0480023388.01. Sequence alignment results showed that the MsG0480023388.01 gene is most closely related, and both rice and alfalfa homologs were reliably detected when AtACYR1 or AtACYR2 were used as search baits.

[0030] Example 2, Arabidopsis thaliana AtACYRs Cloning of gene promoters and genome sequences and construction of complementation vectors Design the following primers: PrimerF1: 5 '-cccgccttcggtttgggcgcgcccaaattaaagagagatatatgattaag-3 '; PrimerR1: 5'-ACATCGTATGGATAACCCCCGGGGGCCTTCTCTTTTTGTTGG-3'.

[0031] PrimerF2: 5 '-tttcccgccttcggtttgggcgcgcctatggttttggcttcctcttac-3'.

[0032] PrimerR2: 5'-AACATCGTATGGATAACCCCCGGGCTCCTTCAGGCTCTTTCTCTTC-3'.

[0033] Using the genome of wild-type Arabidopsis thaliana seedlings of the Columbia ecotype (Col-0) as a template, PCR amplification was performed using primers F1 and R1 to obtain the AtACYR1 promoter sequence and genome sequence; PCR amplification was performed using primers F2 and R2 to obtain the AtACYR2 promoter sequence and genome sequence. The PCR amplification reactions were performed in a Bio-rad T100 PCR instrument. The reaction system (50 μL) consisted of: 25 μL KOD One™ PCRMaster Mix-Blue, 1 μL primer 1 (10 μM), 1 μL primer 2 (10 μM), 2 μL template cDNA (200 ng / μL), and 21 μL ddH2O. The program was: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 2 min, repeated 35 times; 72℃ extension for 5 min; and storage at 15℃. The PCR product was recovered and purified, then ligated into the pXCS-HAStrep vector, which had been digested with AscI and XmaI, via homologous recombination to obtain the recombinant expression vector. This vector was transformed into *E. coli* DH5α strain (Qingke Biotechnology), and after culturing at 37°C for 12 hours, positive clones were selected for sequencing. Sequencing results showed that the ACYRs gene's promoter and genomic sequence obtained by PCR possessed the characteristics of SEQ ID NO. 3 (…). AtACYR1 ) and SEQ ID NO.4 ( AtACYR2 The complete genome sequence is shown in the figure.

[0034] Example 3, Arabidopsis thaliana AtACYRs Obtaining and identifying gene-reinforced plants 1. The recombinant expression vector obtained in Example 2 was transformed into Agrobacterium GV3101-RK strain using chemical transformation. After culturing at 28°C for 48 hours, positive clones were selected and propagated by shaking in LB medium containing Rif (25 μg / mL), Gent (15 μg / mL), Kan (50 μg / mL) and Carb (50 μg / mL).

[0035] 2. Inoculate the Agrobacterium tumefaciens containing the target expression vector into 20 mL of liquid LB medium containing antibiotics Rif (25 μg / mL), Gent (15 μg / mL), Kan (50 μg / mL) and Carb (50 μg / mL). Incubate at 28°C with shaking at 200 rpm for 24 h, and then collect the bacterial cells.

[0036] 3. Centrifuge the bacterial culture at 4,000 × g for 20 min, then resuspend the bacterial culture in an equal volume of osmotic buffer (10% sucrose, 400 μl / L Silwet-77), mix thoroughly, and adjust OD. 600 To 0.8-1.0. Meanwhile, plants cultured for 6 weeks (with bolting to 6-8 cm) will be... Attackers The mutant was created by cutting off the pods and fully open flowers from the plant.

[0037] 4. Immerse the above-ground parts of the plant in the bacterial solution for 1 minute and gently shake.

[0038] 5. Cover the infected plants with plastic wrap to maintain humidity and incubate in the dark for 1 day. Then, place them under normal culture conditions for 2 days, remove the plastic wrap, and water them after 1 week of transformation. Continue cultivation until the plants mature. After harvesting and drying the seeds, use 1 / 2 MS medium containing 50 μg / mL glufosinate to screen for positive seedlings of transgenic plants, obtaining replacement plants. Attacker1 pACYR1:ACYR1-HA and Attacker2 pACYR2:ACYR1-HA .

[0039] Example 4, Rice OsACYR Knockout vector construction 1. Vector linearization: Linearization system: 5 μL of vector BGK03 (200 ng / uL, Baige Gene Technology (Jiangsu) Co., Ltd.), 1 μL of BsaⅠ enzyme, 5 μL of buffer, and 39 μL of ddH2O. After incubation at 37 ℃ for 30 min, the linear vector was obtained.

[0040] 2. Primer synthesis: F-C005: CAATGGTCTCATgattg CCAAGCAAGGACTTAACAAT gttttagagctagaaata; R-C005: TTGGGGTCCTAAACTCTCTGCTCCAAATAATGGACCTCACTACTTCGACTCTAG.

[0041] 3. The PCR amplification reaction system (50 μL) consisted of: 25 μL Pfu enzyme, 2 μL F-C005 (10 μM), 2 μL R-C005 (10 μM), 1 μL PSG template (200 ng / μL), and 20 μL ddH2O. The program was: 95℃ for 5 min, 95℃ denaturation for 30 s, 58℃ binding for 30 s, 72℃ extension for 30 s, and 72℃ for 5 min. The number of cycles for denaturation, annealing, and extension was set to 30. The obtained PCR products were recovered.

[0042] 4. Editing media connection and conversion: Vector ligation reaction system: 1 μL homologous recombinase, 1 μL linearized vector (75 ng / uL), 3 μL PCR fragment (25 ng / uL), 5 μL ddH2O. Transformed into Escherichia coli DH5α strain (Qingke Biotechnology), cultured at 37℃ for 12 hours, and then selected positive clones for sequencing.

[0043] Example 5: Rice OsACYR Gene knockout acquisition and identification Select mature rice seeds (preferably newly harvested seeds from the current year), peel off the husks, disinfect with 75% ethanol, rinse once with sterile water, discard the ethanol, disinfect with 30% sodium hypochlorite, and rinse 5-6 times with sterile water. Absorb excess water and transfer the seeds to an induction medium to induce callus culture. Transform the recombinant expression vector obtained in Example 4 into Agrobacterium EHA105 strain using chemical transformation. Select positive clones and propagate them by shaking in LB medium containing Rif (25 μg / mL) and Kan (50 μg / mL). Centrifuge, discard the supernatant, and resuspend in an invasion staining solution. Select a sufficient number of callus tissues and place them in a sterile Erlenmeyer flask, add an appropriate amount of Agrobacterium suspension, and incubate at room temperature for 20 minutes. Discard the bacterial suspension, place the callus tissues on sterile filter paper to absorb excess bacterial suspension, and then transfer them to a solid co-culture medium. Incubate in the dark at 26°C for 3 days. After 3 days of co-culture, wash the callus tissues and then transfer them to sterile filter paper to dry. After the callus has dried, it is transferred to a selection medium for selection culture at 28-30 degrees Celsius in the dark. The selection process takes 3-4 weeks. One month after selection, positive callus can be picked and transferred to a differentiation medium for differentiation and regeneration. When the differentiated seedlings grow to about 2-3 cm and have obvious roots, they can be transferred to a rooting medium to allow them to grow further. After transplanting into seedling trays, PCR testing is performed on the plants. The primer information is as follows: HYG-F1: CAAAGATCGTTATGTTTATCGGCACT; HYG-R1: TTGGCGACCTCGTATTGGGAA. The PCR reaction system (15 μL) is as follows: 2xEs Tag MasterMix (Dye) 7.5 μL, HYG-F1 (10 μM) 1 μL, HYG-R1 (10 μM) 1 μL, DNA template (20 ng / μL) 1 μL, ddH2O 4.5 μL. The program is as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 58℃ binding for 30 s, 72℃ extension for 30 s, and 72℃ final extension for 5 min. The number of denaturation, annealing, and extension cycles is set to 30.

[0044] Example 6: Alfalfa MsACYR Construction of overexpression vectors Vector primer synthesis: OE-F: tctagaggatccccgggtaccATGAGGAAGAAGGTGGATGAAC; OE-R: cgatcggggaaattcgagctctcatttttcaaattgaggatgagaccaGGAACCAGCGTAATCTGGAACATCGTATGGGTATGATCCAGACCTTCTCCTTTCCTTTTTAC.

[0045] Using alfalfa seedling cDNA as a template, PCR amplification was performed using OE-F and OE-R primers to obtain... MsACYR The CDS sequence was obtained, and the amplification PCR reaction system (50 μL) consisted of: 25 μL phanta enzyme, 2 μL OE-F (10 μM), 2 μL OE-R (10 μM), 1 μL cDNA template (200 ng / μL), and 20 μL ddH2O. The program was: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 55℃ binding for 15 s, 72℃ extension for 2 min, and 72℃ final extension for 5 min. The number of denaturation, annealing, and extension cycles was set to 34. The obtained PCR product was recovered. After purification, the PCR product was ligated into the enzyme-digested and recovered overexpression vector via homologous recombination to obtain the recombinant expression vector. This vector was transformed into Escherichia coli DH5α strain (Qingke Biotechnology), and after culturing at 37℃ for 12 hours, positive clones were selected for sequencing. The sequencing results showed that the PCR reaction yielded... MsACYR The gene sequence has the CDS sequence shown in SEQ ID No. 6.

[0046] Example 7: Alfalfa MsACYR Knockout vector construction 1. Primer synthesis for vector editing: P2.0-F1:TAGGTCTCAATCGAACAAAGCACCAGTG; P2.0-T1-R1: GCGGTCTCAGACGAGATATCTGCCCCTCATGCACCAGCCGGGAA; P2.0-T1-F2: TAGGTCTCATGAGGGGCAGATATCTCGTCGTTTTAGAGCTAGAAA; P2.0-T2-R2: GCGGTCTCATCTCAGGATCCAAAAGACCCTGCACCAGCCGGGAA; P2.0-T2-F3: TAGGTCTCAGGGGTCTTTTGGATCCTGAGAGTTTTAGAGCTAGAAA; P2.0-T3-R3: GCGGTCTCATGATTTGATCTGAGCCTTGCTGCACCAGCCGGGAA; P2.0-T3-F4: TAGGTCTCAGCAAGGCTCAGATCAAATCAGTTTTAGAGCTAGAAA; P2.0-R4: TAGGTCTCAATATAAAAAAAGCACCGACTCGGTGCC.

[0047] Product 1 was obtained by amplifying P2.0-F1 with P2.0-T1-R1; product 2 was obtained by amplifying P2.0-T1-F2 with P2.0-T2-R2; product 3 was obtained by amplifying P2.0-T2-F3 with P2.0-T3-R3; and product 4 was obtained by amplifying P2.0-T3-F4 with P2.0-R4. The PCR reaction system (50 μL) consisted of: 25 μL phanta enzyme, 1.5 μL F1 / F2 / F3 / F4 (10 μM), 1.5 μL R1 / R2 / R3 / R4 (10 μM), 2 μL pGTR template (200 ng / μL), and 20 μL ddH2O. The program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 55℃ binding for 15 s, 72℃ extension for 30 s, and 72℃ final extension for 5 min. The denaturation, annealing, and extension cycles were set to 34. The obtained PCR products were then recovered.

[0048] 2. Editing media connection and conversion: The vector ligation reaction system consisted of 1 μL Cut Buffer, 1 μL T4 Buffer, 1.5 μL BsaI ligase, 0.5 μL T4 ligase, 2 μL CRISPR 2.0 vector (75 ng / uL), and 1 μL each of PCR fragments (product 1, product 2, product 3, and product 4) (25 ng / uL). The mixture was transformed into *E. coli* DH5α strain (Qingke Biotechnology), and after incubation at 37°C for 12 hours, positive clones were selected for sequencing.

[0049] Example 8: Obtaining and identifying alfalfa MsACYR gene knockout and overexpression plants The recombinant expression vectors obtained in Examples 6 and 7 were transformed into Agrobacterium GV3101 strain using chemical transformation. Freshly transformed Agrobacterium positive single colonies were picked and cultured in liquid LB medium containing Rif (25 μg / mL) and Kan (50 μg / mL) on a shaker until OD. 600The value reaches 0.6. Centrifuge, discard the supernatant, and resuspend in a resuspension solution for subsequent infection. Take fresh alfalfa leaves, rinse them thoroughly with running water, disinfect them with sodium hypochlorite, and then wash them 6-8 times with sterile water. Place the disinfected leaves into a culture flask containing the infection solution. After infection, discard the bacterial solution, blot the leaves dry with sterile filter paper or air dry them, and then spread them evenly on a co-culture medium and incubate in the dark for 2-3 days. After co-culture, transfer the leaves to a selection medium plate and incubate in the dark to induce callus. Subculture every 1-2 weeks. Transfer the callus to a shoot differentiation medium to induce bud formation, and then transfer the buds to a shoot elongation medium. When the resistant shoots grow to 0.5-1 cm, transfer them to a rooting medium (Sangon Biotech (Shanghai) Co., Ltd.). Cut leaves from the rooted plants for transgenic positive detection. PCR was used to detect the hygromycin resistance gene HPT (NCBI accession number: YDO78519.1). Primer sequences: F': AAGGAATCGGTCAATACACTACATGG, R': AAGACCAATGCGGAGCATATACG. The program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 55℃ binding for 15 s, 72℃ extension for 30 s, and 72℃ final extension for 5 min. The number of cycles for denaturation, annealing, and extension was set to 34.

[0050] Example 9, Arabidopsis thaliana ACRY Application of cadmium stress tolerance in gene-deleted plants The wild-type Arabidopsis thaliana strain used in this invention is the Columbia ecotype (Col-0). The wild-type Col-0, Attacker 1 , Attacker 2 and replanting Attacker1 pACYR1:ACYR1-HA and Attacker2 pACYR2: ACYR1-HA Seeds were surface-sterilized with 70% ethanol for 10 minutes, followed by washing three times with sterile water. All experimental materials were sown on 1 / 2 MS solid medium containing 1% sucrose and vernalized at 4°C in the dark for 2 days, then vertically cultured at 21°C under long-day conditions (16 hours light / 8 hours dark). After 14 days, seedlings with uniform growth were transferred to 1 / 2 Hoagland medium for another 14 days, followed by transfer to 1 / 2 Hoagland medium with or without 1 μM Cd(NO3)2 for another 7 days. Plant growth was observed and analyzed. The results showed ( Figure 2 Compared to wild-type Col-0, Attacker 1 , Attacker 2 Leaves under cadmium stress appeared greener, and the recombinant material showed the same trend as Col-0, indicating that... ACRY Gene deletion can significantly improve the cadmium stress tolerance of plants.

[0051] Example 10: Application of cadmium stress tolerance of rice ACYR gene knockout mutant Select wild-type (Zhonghua 11) grapes with plump grains and uniform size. ACRY Gene knockout mutant ( Osacyr Rice seeds were disinfected with a 30% sodium hypochlorite solution and rinsed repeatedly with sterile water 4-5 times before being placed in moist petri dishes. The dishes were then placed in a light-treated culture room to await germination. During this period, the rice seeds were rinsed daily with deionized water to keep the petri dishes clean and moist. After germination, seedlings with good development, similar growth, and uniform root length were transferred from the petri dishes to culture boxes for further cultivation. 1 L of Hoagland nutrient solution was added to the culture boxes, and the solution was changed every 3-4 days. After 21 days, seedlings with uniform growth were transferred to Hoagland nutrient solution with or without 75 μM Cd(NO3)2 and cultured for another 7 days. Leaf development was observed and analyzed. The results showed ( Figure 3 Under culture conditions without the addition of Cd(NO3)2, Osacyr There was no significant difference in leaf color between the mutant and the wild type. ， Under culture conditions with added Cd(NO3)2, compared to the wild type, Osacyr The mutant has greener leaves, indicating ACRY Gene deletions also play an important role in the cadmium stress tolerance of rice plants. The gene deleted in the rice deletion mutant Osacyr is shown in SEQ ID NO. 5.

[0052] Example 11, Alfalfa MsACYR Cadmium tolerance analysis of gene overexpression and deletion mutants Select robust, disease- and pest-free wild-type alfalfa (Zhongmu No. 1) and ACRY Gene overexpression mutants ( MsACYR-YES ) and knockout mutants ( MsACYR-Crispr Healthy stem segments with 2-3 nodes were selected for propagation. Lower leaves were removed, leaving 1-2 young leaves at the top. The base of the stem segment was cut at a 45° angle and inserted into a sterile propagation box for soilless propagation. During the propagation period, the stem segments were kept moist by spraying with sterile deionized water daily and placed in a light-controlled culture room, maintaining a temperature of 25℃ and long-day conditions (16 h light / 8 h darkness) to promote rooting. The knockout mutant contained a gene that was missing, and the overexpressed mutant contained a gene that was overexpressed. MsACYR The gene, whose nucleotide sequence is shown in SEQ ID NO. 6. SEQ ID NO. 10 is a homologous gene from alfalfa.

[0053] Once the cuttings have developed 5-6 adventitious roots, reached a height of 8-10 cm, and exhibited uniform growth, they are transplanted into soilless culture boxes containing 1 L of Hoagland nutrient solution. The nutrient solution is changed every 3-4 days. After 21 days, the uniformly growing alfalfa seedlings are transferred to Hoagland nutrient solution with or without 75 μM Cd(NO3)2 and cultured for another 7 days. Leaf growth and development are then observed and analyzed. The results show ( Figure 4 Under normal culture conditions without the addition of Cd(NO3)2, MsACYR-YES There was no significant difference in leaf color between overexpression and knockout mutants and the wild type; however, under cadmium stress conditions with added Cd(NO3)2, compared to the wild type, MsACYR-YES The overexpression mutant exhibited a distinct cadmium-sensitive phenotype, characterized by yellowing and browning of the leaves. MsACYR- Crisp The mutant exhibited a clear cadmium tolerance phenotype, with a lower degree of leaf yellowing, indicating... ACRY Gene overexpression reduces alfalfa's cadmium tolerance; knockout ACRY Genes can enhance alfalfa's cadmium tolerance, indicating that... ACRY Genes play an important regulatory role in alfalfa's response to cadmium stress.

Claims

1. An ACYR protein, characterized in that, The amino acid sequence of the ACYR protein is shown in SEQ ID NO.

10.

2. A gene encoding the ACYR protein of claim 1.

3. The gene of claim 2, wherein, Its nucleotide sequence is shown in SEQ ID NO.

6.

4. Use of an ACYR protein or a gene encoding the ACYR protein in the ability to regulate cadmium stress tolerance in plants, characterized in that, The amino acid sequence of the ACYR protein is shown in any one of SEQ ID NO. 7 to 10.

5. Use according to claim 4, characterized in that, The ability of plants to tolerate cadmium stress can be regulated by inhibiting or promoting the expression of ACYR proteins.

6. The application according to claim 4, characterized in that, Modulation of the ability of plants to tolerate cadmium stress is achieved by knocking out or overexpressing genes of the plant ACYR The application relates to a method for modulating the ability of plants to tolerate cadmium stress.

7. The application according to claim 4, characterized in that, The nucleotide sequence of the gene is shown in any one of SEQ ID NO.1~2 or SEQ ID NO.5~6.

8. The application according to claim 4, characterized in that, The ability to regulate cadmium stress includes improving the plant's ability to tolerate cadmium stress.

9. The application according to claim 4, characterized in that, The plants mentioned include Arabidopsis thaliana, rice, or alfalfa.

10. The application of the gene silencing vector of claim 4 in improving the ability of plants to withstand cadmium stress.

Images