Medicago truncatula e3 ubiquitin ligase and its application in regulating drought resistance of alfalfa

Abstract

The application relates to the technical field of plant genetic engineering, and particularly relates to an E3 ubiquitin ligase of Medicago sativa and application of the E3 ubiquitin ligase in regulating drought resistance of Medicago sativa. The application relates to the technical field of plant genetic engineering, and particularly relates to an E3 ubiquitin ligase of Medicago sativa and application of the E3 ubiquitin ligase in regulating drought resistance of Medicago sativa. The application identifies and clones a U-box type E3 ubiquitin ligase coding gene from Medicago sativa for the first time, the coded protein MsPUB6 contains a conservative U-box domain, and the amino acid sequence homology with that of MtPUB6 of Medicago truncatula is as high as 98.04%, so that a new gene resource is provided for drought resistance molecular breeding of Medicago sativa.

Description

Technical Field

[0001] This application relates to the field of plant genetic engineering technology, specifically to alfalfa E3 ubiquitin ligase and its application in regulating alfalfa drought resistance. Background Technology

[0002] alfalfa ( Medicago sativa L. Alfalfa has a protein content as high as 16%-22%, and is rich in various amino acids, vitamins, and minerals, making it a high-quality protein feed source for herbivores such as dairy cows, beef cattle, and sheep. It plays an irreplaceable role in the sustainable development of animal husbandry. At the same time, alfalfa has a well-developed root system and strong nitrogen-fixing ability, which can effectively improve soil structure, enhance soil fertility, and prevent soil erosion, playing an important role in ecological environmental protection and the restoration of degraded grasslands.

[0003] Drought is the primary factor affecting the yield and quality of alfalfa. In arid and semi-arid regions, uneven rainfall distribution during the alfalfa growing season and frequent seasonal droughts lead to low germination rates, slow growth, and reduced biomass, and in severe cases, even plant death.

[0004] Furthermore, drought significantly reduces the protein content and increases the crude fiber content of alfalfa, leading to a substantial decline in its nutritional value. With the intensification of global climate change and the increasing frequency and intensity of extreme drought events, the threat of drought to alfalfa production is becoming increasingly serious. Therefore, developing new drought-resistant alfalfa varieties has become an urgent priority in current forage breeding work.

[0005] Traditional alfalfa drought-resistant breeding mainly relies on phenotypic selection. This involves field identification of different germplasm resources under drought conditions to screen for individuals with strong drought resistance for hybridization. While this method has achieved some success, it suffers from drawbacks such as long breeding cycles, low efficiency, and poor selection accuracy. Furthermore, alfalfa is a cross-pollinated, autotetraploid plant with a complex genetic background. Many important agronomic traits, such as drought resistance, are quantitative traits controlled by multiple genes, making it difficult for traditional breeding methods to precisely improve these traits.

[0006] In recent years, with the rapid development of molecular biology and genomics technologies, molecular breeding has provided a new approach for improving the drought resistance of alfalfa. By cloning and functionally validating drought-resistant genes, and using transgenic technology to introduce superior drought-resistant genes into alfalfa, new varieties with significantly improved drought resistance can be obtained rapidly. Among these, the U-box type E3 ubiquitin ligase (PUB) plays a key role in signal homeostasis and abiotic stress response through substrate ubiquitination, but its upstream transcriptional regulatory mechanisms are still poorly understood, especially in alfalfa's drought adaptation.

[0007] Furthermore, on the one hand, there are differences in understanding among those skilled in the art; on the other hand, the inventors studied a large number of documents and patents when making this invention, but due to space limitations, not all details and contents were listed in detail. However, this does not mean that the present invention does not possess the features of these prior art. On the contrary, the present invention already possesses all the features of the prior art, and the applicant reserves the right to add relevant prior art to the background art. Summary of the Invention

[0008] This application relates to the field of plant genetic engineering technology, specifically to alfalfa E3 ubiquitin ligase and its application in regulating alfalfa drought resistance.

[0009] To address the aforementioned technical problems, one of the objectives of this invention is to provide an alfalfa E3 ubiquitin ligase, the amino acid sequence of which is shown in SEQ ID NO: 1.

[0010] According to a preferred embodiment, the nucleotide sequence of the E3 ubiquitin ligase is shown in SEQ ID NO: 2.

[0011] It should be clearly stated that those skilled in the art can, based on the amino acid sequence disclosed in this invention, substitute, delete, and / or add one or more amino acids without affecting the protein's biological activity, resulting in a mutant sequence of the protein with a sequence alignment homology of over 90%. Therefore, this invention also includes derived proteins with high homology and biological activity obtained by substituting, deleting, and / or adding one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1.

[0012] Furthermore, it should be understood that, given the characteristics of codon degeneracy and species codon preferences, those skilled in the art can use codons suitable for the expression of a specific species as needed.

[0013] The genes and proteins of this invention can be cloned or isolated from alfalfa, or obtained by sequence chemical synthesis.

[0014] One objective of this invention is to provide a primer pair for obtaining the above-mentioned alfalfa E3 ubiquitin ligase, wherein the primer pair is as follows: SEQ ID NO: 7:ATGATGGATGTTTCTGAGGTTGAAGAA; SEQ ID NO: 8: CTAACACTGGTAAACAGAATAGCTTTTG.

[0015] One of the objectives of this invention is to provide the use of the above-mentioned alfalfa E3 ubiquitin ligase or its encoding gene in regulating alfalfa drought resistance.

[0016] According to a preferred embodiment, the alfalfa is alfalfa.

[0017] One of the objectives of this invention is to provide a method for regulating the drought resistance of alfalfa, which includes the following steps: constructing the alfalfa E3 ubiquitin ligase encoding gene as described in claim 1 into a recombinant expression vector, introducing the recombinant expression vector into alfalfa cells, and screening to obtain alfalfa plants that overexpress the encoding gene.

[0018] One object of the present invention is to provide a transgenic plant material, characterized in that the plant material is an inactive tissue of alfalfa overexpressing the alfalfa E3 ubiquitin ligase encoding gene of claim 1. The inactive tissue is, for example, the in vitro inactivated tissue of the overexpressing plant.

[0019] One of the objectives of this invention is to provide a strain characterized in that the strain contains a recombinant plasmid, wherein the recombinant plasmid contains the aforementioned alfalfa E3 ubiquitin ligase encoding gene.

[0020] According to a preferred embodiment, the strain is Agrobacterium strain EHA105 or Agrobacterium strain GV3101.

[0021] One of the objectives of this invention is to provide a recombinant plasmid in which the above-mentioned alfalfa E3 ubiquitin ligase encoding gene is inserted, and the encoding gene is operatively linked downstream of the promoter.

[0022] According to a preferred embodiment, the plasmid used to insert the above-mentioned alfalfa E3 ubiquitin ligase encoding gene is a Super1300 vector.

[0023] The beneficial effects of this invention are: (1) This invention identifies and clones for the first time the gene encoding the U-box type E3 ubiquitin ligase from alfalfa. Its encoded protein MsPUB6 contains a conserved U-box domain and has a 98.04% homology with the amino acid sequence of alfalfa MtPUB6, providing a new gene resource for molecular breeding of drought resistance in alfalfa. (2) After one month of drought stress treatment, the relative leaf water content of transgenic alfalfa lines overexpressing the MsPUB6 gene remained at 84%–85%, significantly higher than that of the wild type (22%). The malondialdehyde (MDA) and hydrogen peroxide (H2O2) contents were significantly lower than those of the wild type, while the catalase (CAT) activity was significantly higher, indicating that the overexpression of the MsPUB6 gene was effective. MsPUB6 It can significantly improve the drought resistance of alfalfa by enhancing antioxidant defense capabilities, reducing membrane lipid peroxidation damage, and maintaining leaf water retention capacity; after rehydration, the survival rate of overexpression lines reached 100%, while only about one-third of wild-type lines survived. (3) Using virus-induced gene silencing technology to silence genes MsPUB6 After drought treatment, the electrical conductivity of plant leaves increased to 79% (compared to 35% in the control), and the chlorophyll content decreased significantly. This confirmed from the perspective of reverse genetics that MsPUB6 is an essential positive regulator for maintaining the normal drought resistance of alfalfa. (4) This invention discloses for the first time MsPUB6 The function of this gene in regulating drought resistance in alfalfa and its upstream transcriptional regulatory mechanisms were investigated. The gene's expression was induced by drought, low temperature, high salinity, and ABA stress. Overexpression and virus-induced gene silencing (VIGS) experiments confirmed its effectiveness. MsPUB6 Alfalfa positively regulates drought resistance by enhancing the activity of antioxidant enzymes (SOD and CAT), reducing malondialdehyde (MDA) and reactive oxygen species (ROS) levels, and maintaining chlorophyll content and leaf water content. Further mechanistic studies indicate that the transcription factor MsDREB1C directly binds to... MsPUB6 The CRT / DRE element in the promoter is activated and its transcription is activated. MsDREB1C Overexpression lines exhibited enhanced drought resistance and MsPUB6 The expression is upregulated, and drought resistance is improved by mitigating oxidative and membrane damage, maintaining chlorophyll content and relative leaf water content. This invention discloses a novel regulatory module, MsDREB1C. MsPUB6, or DREB1 transcription factor, directly regulates the U-box type E3 ligase gene, thereby positively regulating the drought resistance of alfalfa. This invention provides important gene resources for the molecular breeding of drought-resistant alfalfa, expands the understanding of the functional diversity of plant U-box proteins, and provides important regulatory pathway evidence for the molecular improvement of drought-resistant alfalfa. Attached Figure Description

[0024] Figure 1 This is a schematic diagram illustrating the multiple sequence alignment of MsPUB6 with homologous proteins from other species, including sequences from alfalfa (Alfalfa truncatum). Medicago truncatula XP_003601808.1), soybeans ( Glycine max KAH1226877.1), white clover ( Trifolium repens ,KAK2384100.1), Arabidopsis thaliana ( Arabidopsis thaliana , NP_174112.1) and corn ( Zea mays , NP_001169575.1); Figure 2 for MsPUB6 A schematic diagram illustrating the induced expression patterns under different stress treatments, where qRT-PCR analysis was performed. MsPUB6Expression levels under drought (A), cold (B), salt (C), and ABA (D) treatments were measured. Three-week-old hydroponic alfalfa seedlings were treated with 15% PEG6000, 4℃, 200 mM NaCl, and 100 μM ABA, respectively. Error bars represent the mean ± standard error (SEM) of three biological replicates. One-way ANOVA was used to test for significant differences between groups. Different lowercase letters indicate significant differences under Duncan's multiple comparison test. P <0.05); Figure 3 For overexpression MsPUB6 A diagram illustrating the enhancement of alfalfa's drought resistance, where (AC) represent wild-type (WT) and... MsPUB6 Overexpression ( MsPUB6 Phenotypic comparison of the -OE strains before treatment (A), after drought stress (B), and after rehydration (C); Figure 4 For overexpression MsPUB6 Effects of drought treatment on drought-resistant physiological indicators of alfalfa, including (A): compared with wild type, MsPUB6 Overexpression lines (OE19 and OE20) MsPUB6 (B) Comparison of relative expression levels of leaves after drought treatment; (C) Comparison of relative water content of wild-type (WT) and wild-type (WT) after drought treatment. MsPUB6 Overexpression ( MsPUB6 -OE) strain leaf malondialdehyde (MDA) content, (D): WT and MsPUB6 - Hydrogen peroxide (H2O2) content in leaves of OE strains, (E): WT and WT after drought treatment MsPUB6 Catalase (CAT) activity in leaves of the OE strain. Error bars represent the mean ± standard error (SEM) of three biological replicates. One-way ANOVA was used to test the significance of differences between groups. Different lowercase letters indicate significant differences under Duncan's multiple comparison test. P <0.05); Figure 5 for MsPUB6 A schematic diagram illustrating the reduction in drought resistance of alfalfa after silencing, where (A): control (TRV2) and... MsPUB6 Silent strain (TRV2-) MsPUB6 Phenotypic comparison under drought stress, (B): Leaf morphology observation of control and silent lines after drought stress; Figure 6 for MsPUB6 Effects of silencing on drought-resistance-related physiological indicators in alfalfa after drought treatment (A): qRT-PCR analysis MsPUB6The silencing efficiency (BC): The determination of leaf electrical conductivity (B) and chlorophyll content (C) of the control and silencing lines after drought stress. Error bars represent the mean ± standard error (SEM) of three biological replicates. One-way ANOVA was used to test the significance of differences between groups. Different lowercase letters indicate significant differences under Duncan's multiple comparison test. P <0.05); Figure 7 Specifically binds to and activates MsDREB1C MsPUB6 Schematic diagram of expression, where (A): EMSA analysis of MsDREB1C protein and MsPUB6 In vitro binding characteristics of the CRT / DRE element in the promoter, where "+" and "-" indicate the presence or absence of the corresponding component in the reaction system, respectively. (B): Imaging shows MsDREB1C's binding to... MsPUB6 Activation effect of promoter activity, (C): Quantitative analysis of MsDREB1C on the effect of dual-luciferase reporter system. MsPUB6 Regulatory role of promoter transcriptional activity, (D): qRT-PCR detection of wild-type (WT), MsDREB1C Overexpression ( MsDREB1C -OE) strains MsPUB6 The expression levels are shown in the error bars, which represent the mean ± standard error (SEM) of three biological replicates. One-way ANOVA was used to test the significance of differences between groups. Different lowercase letters indicate that the differences were significant under Duncan's multiple comparison test. P <0.05); Figure 8 for MsDREB1C Schematic diagram illustrating the enhancement of drought resistance in alfalfa by overexpression, wild-type (WT) and... MsDREB1C Overexpression ( MsDREB1C Phenotypic comparison of -OE strains under drought stress and rehydration treatment; Figure 9 for MsDREB1C The effects of overexpression on drought-related physiological indicators of alfalfa after drought treatment were investigated. (A): leaf electrical conductivity after drought treatment; (B): relative water content of leaves after drought treatment; (C): malondialdehyde (MDA) content after drought treatment; (D): hydrogen peroxide (H2O2) content after drought treatment; (E): superoxide dismutase (SOD) activity after drought treatment; (F): catalase (CAT) activity after drought treatment. Error bars represent the mean ± standard error (SEM) of three biological replicates. One-way ANOVA was used to test for significant differences between groups. Different lowercase letters indicate significant differences under Duncan's multiple comparison test. P <0.05). Detailed Implementation

[0025] In the description of this invention, terminology is used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. In the description of this invention, "a plurality of" means two or more, unless otherwise explicitly defined.

[0026] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials, reagents or instruments used, unless otherwise specified by the manufacturer, are all commercially available reagents and materials; the conditions not specified in the examples are all carried out according to conventional conditions or conditions recommended by the manufacturer. At the same time, the present invention does not limit the source of the raw materials used. Unless otherwise specified, the raw materials used in the present invention are all commercially available products in this technical field.

[0027] 1. Analysis of MsPUB6 sequence characteristics and expression patterns 1.1 Materials and Methods 1.1.1 Experimental Materials and Growth Conditions alfalfa ( Medicago sativa L. 'Zhongmu No. 1' was grown under controlled environmental conditions with a photoperiod of 16 hours of light / 8 hours of darkness, day / night temperatures of 22 ℃ and 20 ℃ (actual temperatures fluctuated with environmental conditions, ranging from ±2-3 ℃), and a light intensity of 65 µmol / m². - ² s - ¹, with a relative humidity of 50%-60%. Depending on the experimental requirements, the plants may be grown in soil in a greenhouse or hydroponically in an artificial climate chamber.

[0028] 1.1.2 Multiple sequence alignment of MsPUB6 with homologous proteins from other species Multiple sequence alignment of alfalfa MsPUB6 and its homologous proteins was performed using DNAMAN software. Sequences involved in the alignment included those from alfalfa (…). Medicago truncatula XP_003601808.1), soybeans ( Glycine max KAH1226877.1), white clover ( Trifolium repens ,KAK2384100.1), Arabidopsis thaliana ( Arabidopsis thaliana , NP_174112.1) and corn ( Zea mays , NP_001169575.1).

[0029] The protein sequence is shown as SEQ ID NO: 1: MMDVSEVEENFFAASDAKLHAEMCRSLSAIYCKVLSLFPSLEAARPRSKSGIQALCSLHVALEKAKNVLKHCSECSKLYLAITGDSVLLKFEKAKCALVDSLKLVEDIVSQSIGYQIDEIVNEIAGMVFALDSSEKQVGDDLIALLQQDRKFNNSNDSSELECFHMAATRLGITSSRAALTERRALKKLIERARAEEDKRKESIIAYLLHLMRKYSKLFRSEFSDDNDSQGSQPCSPTVQPCSPNGVPGGHCQAFDRQISKLGSFNFKPNKKKSGQMPLPPEELRCPISLQLMSDPVIIASGQTYERACIEKWFNDGHNTCPKTQQKLAHLSLTPNYCVKGLVASWCEQNGIPIPEGPPESLDFNYWRLALSDSESINSRSVNSVNSCKLKGVKVVPLEENSILEQTEGNVTESFSAQEEEDSEKYLSLLKVLTEGNNWKRKCKVVERLRFLLRDDEEARIFMGANGFVEALFQFLQSAVHEGNAMALENGAMALFNLAVNNNRNKELMISAGILSLLEEMVSSTSSYSCATALYLNLSCLEEAKHMIGASQAVQFLIQMLRTKIEVQCKLDALHALYNISTVPSNISNLLSSGIINGLQSLLVGQAECTWTEKCIAVLVNLAVSHEGREEMMLNPELISTLASILDTGESIEQEQAVSCLLILCNRSEKCCEMVLQEGAIPALVSITVNGTSRGREKAQKLLMLFREQRQRDHSPANTQDCSPEAGDLSMPPRETKPLSKSISRRKVGKALSFLWKSKSYSVYQC.

[0030]

[0031] 1.1.3 Different abiotic stress treatments on alfalfa Alfalfa seeds with plump and uniform size were selected, surface-sterilized, and then germinated in petri dishes lined with moist filter paper. After 7 days of cultivation in an artificial climate chamber, seedlings with uniform growth were transferred to 1 / 2 Hoagland nutrient solution (pH 5.95) for hydroponic cultivation. For stress treatment, 3-week-old seedlings with uniform growth were selected and subjected to cold (4℃), drought (15% PEG6000), salt (200 mM NaCl), and ABA (100 μM) treatments, respectively. Leaves were collected at 0, 3, 5, 8, 12, 24, 48, and 72 h after treatment and quickly frozen in liquid nitrogen for subsequent gene expression analysis.

[0032] 1.1.4 Total RNA extraction, reverse transcription, and quantitative real-time PCR (qRT-PCR) analysis Total RNA was extracted from alfalfa tissue using the Eastep™ Total RNA Extraction Kit (Promega, USA) according to the manufacturer's instructions. RNA concentration and purity were measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA), and RNA integrity was verified by 1% agarose gel electrophoresis. First-strand cDNA was synthesized using 1 µg of total RNA as a template using the HiScript III All-in-One RT SuperMix Kit (Vazyme, China) according to the manufacturer's instructions.

[0033] qRT-PCR reactions were performed on a CFX96 Touch™ real-time quantitative PCR system (Bio-Rad, USA) using Taq Pro Universal SYBR qPCR premix (Vazyme, China). Amplification specificity was verified by melting curve analysis. Data normalization was performed using the alfalfa Actin gene (MsActin) as an internal control (primers are shown in Table 1), and relative expression levels were calculated using a 2-1 ratio. -ΔΔCt Calculation by method.

[0034] Table 1 Details of the quantitative primers used

[0035] 1.2 Results and Analysis 1.2.1 Multiple sequence alignment of MsPUB6 with homologous proteins from other species like Figure 1 As shown, through homology comparison analysis, MsPUB6 is related to alfalfa (Alfalfa tribulus). Medicago truncatula MtPUB6, soybeans ( Glycine maxGmPUB7, white clover ( Trifolium repens TrPUB, Arabidopsis thaliana ( Arabidopsis thaliana AtPUB45 and corn ( Zea mays All ZmPUB7 proteins showed high sequence similarity. Among them, MsPUB6 showed the highest homology (98.04%) with alfalfa MtPUB6, 74.58% with white clover TrPUB, 71.41% with soybean GmPUB7, 64.82% with Arabidopsis AtPUB45, and 54.22% with maize ZmPUB7. Further protein sequence analysis revealed that all of these homologous proteins contain a typical U-box domain, suggesting that MsPUB6 and its homologous proteins are highly conserved evolutionarily and may possess similar E3 ubiquitin ligase functions.

[0036] The aligned sequences include alfalfa (tribulus terrestris) Medicago truncatula XP_003601808.1), soybeans ( Glycine max KAH1226877.1), white clover ( Trifolium repens ,KAK2384100.1), Arabidopsis thaliana ( Arabidopsis thaliana , NP_174112.1) and corn ( Zea mays , NP_001169575.1) 1.2.2 MsPUB6 Analysis of expression patterns induced by different stresses The expression pattern analysis results show that, MsPUB6 Its expression was induced to be upregulated under drought, cold, salinity and ABA stress, and its expression level showed a dynamic trend of first increasing and then decreasing with the extension of stress time. Figure 2 The presence of AD in the data suggests that it is widely involved in abiotic stress response processes and may be subject to fine regulation.

[0037] Analysis was performed using qRT-PCR. MsPUB6 Expression levels under drought (A), cold (B), salt (C), and ABA (D) treatments. Three-week-old hydroponic alfalfa seedlings were treated with 15% PEG6000, 4 ℃, 200 mM NaCl, and 100 μM ABA, respectively. Error bars represent the mean ± standard error (SEM) of three biological replicates. One-way ANOVA was used to test the significance of differences between groups. Different lowercase letters indicate significant differences under Duncan's multiple comparison test (D). P <0.05).

[0038] 2. Functional identification of MsPUB6 in regulating drought resistance in alfalfa 2.1 Materials and Methods 2.1.1 Drought Treatment Alfalfa seedlings of uniform growth, propagated at the same time, were transplanted into individual pots (8.5×8.5×9.5 cm) filled with a pre-weighed standard-ratio substrate (150±5 g; vermiculite: nutrient soil = 2:1). All pots were submerged overnight in a tray containing approximately 2 L of water to ensure the substrate was fully saturated. The next day, excess water was removed from the tray, and the pots were moved to the greenhouse. Drought stress treatment was initiated by stopping watering. To minimize microenvironmental differences and location effects, the pots were randomly rotated every 2-3 days during the experiment. Plant morphological changes were observed and recorded regularly. The degree of stress was assessed by progressive phenotypic symptoms such as leaf wilting, and key phenotypic parameters were recorded at the end of the stress period.

[0039] 2.1.2 Alfalfa MsPUB6 Creation of overexpression lines Using alfalfa cDNA as a template, amplification MsPUB6 The full-length coding sequence was obtained (primers are shown in Table 2). After verification by sequencing, the fragment was inserted into the target sequence via homologous recombination. SmaⅠ The recombinant plasmid was digested into the Super1300 vector. The constructed recombinant plasmid was then introduced into Agrobacterium strain EHA105 for subsequent genetic transformation, specifically through callus induction, shoot differentiation, and rooting to obtain transgenic plants. To screen for positive transformants, genomic DNA was first extracted from the regenerated plants and identified by PCR using the primers listed in Table 2. Subsequently, total RNA was extracted and detected by qRT-PCR. MsPUB6 The expression level was determined to confirm the successful establishment of the overexpression line.

[0040] Table 2 Details of the quantitative primers used

[0041] 2.1.3 Virus-induced diseases in alfalfa MsPUB6 Creation of gene silencing (VIGS) lines Analysis using SGN-VIGS online tool MsPUB6 The coding sequence was determined, specific target fragments were screened, and corresponding primers were designed and synthesized (primers are shown in Table 3). The target fragment was cloned into the pTRV2 viral silencing vector, and after confirmation by sequencing, it was transformed into Agrobacterium strain EHA105. Subsequently, following the method described by Liu in "MsCYP71 is a positive regulator for drought resistance in alfalfa", alfalfa leaves were infected with Agrobacterium culture to obtain... MsPUB6Silent plants. Plants transformed with the empty vector pTRV2 were used as negative controls. After infection, the plants were cultured under suitable conditions. Once the plants reached the appropriate growth stage, total RNA was extracted and detected by qRT-PCR. MsPUB6 The expression level was determined, and lines with significant silencing efficiency were screened for subsequent drought resistance testing.

[0042] Table 3 Details of the quantitative primers used

[0043] 2.1.4 Determination of Relative Water Content (RWC) of Leaves Take 0.1 g of fresh leaves, weigh them immediately, and record the fresh weight (FW). Then immerse the sample in a 15 mL centrifuge tube containing 10 mL of deionized water and soak it in the dark at 25°C for 6 h to allow it to fully absorb water and become saturated. After soaking, gently blot the excess water from the sample surface with filter paper, weigh it again, and record the saturated fresh weight (TW). Subsequently, place the sample in a 65°C forced-air drying oven to dry for 72 h, and weigh it a third time to record the dry weight (DW). RWC is calculated using the following formula: RWC (%) = (FW – DW) / (TW – DW) × 100.

[0044] 2.1.5 Measurement of conductivity Take 0.1 g of fresh leaf, cut it in half, and place it in a 15 mL polypropylene centrifuge tube containing 14 mL of deionized water. Equilibrate the centrifuge tube containing the sample on a 25℃ constant-temperature shaker at 70 rpm for 24 h, then measure the initial conductivity (R1). Use sterile deionized water as a blank control to measure the background conductivity (R0). Then boil the sample at 100℃ for 30 min, cool to room temperature, and measure the maximum conductivity (R2) and the corresponding blank control (R0′). Electrolyte leakage rate (relative conductivity) is calculated using the following formula: Conductivity (%) = (R1 – R0) / (R2 – R0′) × 100.

[0045] 2.1.6 Determination of chlorophyll content Chlorophyll was extracted using the ethanol immersion method. 0.1 g of fresh leaves were placed in a 15 mL centrifuge tube containing 10 mL of 95% ethanol and immersed in the dark for 48 h until the leaves were completely dechloroated. The absorbance of the extract at 665 nm and 649 nm was measured using a spectrophotometer (Thermo Fisher Scientific, USA). The chlorophyll content was calculated using the following formula: Chlorophyll a (mg / g FW) = (13.95 × A) 665 –6.88×A 649 ) × 0.01 ÷ 0.1; Chlorophyll b (mg / g FW) = (24.96 × A) 649 –7.32×A 665 ) × 0.01 ÷ 0.1; Total chlorophyll (mg / g FW) = chlorophyll a + chlorophyll b.

[0046] 2.1.7 Determination of malondialdehyde (MDA), hydrogen peroxide (H2O2) content, and superoxide dismutase (SOD) and catalase (CAT) activities. The following physiological parameters were quantitatively determined using commercially available kits (Nanjing Jiancheng Biotechnology Institute, China): malondialdehyde (MDA) content, hydrogen peroxide (H2O2) content, superoxide dismutase (SOD) activity, and catalase (CAT) activity. All measurements were performed strictly in accordance with the kit instructions.

[0047] 2.2 Results and Analysis 2.2.1 Overexpression MsPUB6 It enhanced the drought resistance of alfalfa. To investigate MsPUB6 Regarding its biological functions, we obtained stable [transformation] through Agrobacterium-mediated genetic transformation. MsPUB6 Overexpression lines ( MsPUB6 -OE). qRT-PCR analysis showed that OE19 and OE20 MsPUB6 The transcription levels were 4.1 times and 2.6 times higher than those of wild-type (WT), respectively. Figure 4 (A) These two lines were selected for subsequent phenotypic analysis. Before drought treatment, WT and... MsPUB6 -OE cuttings ( Figure 3 A) Transplanted into individual pots (8.5×8.5×9.5 cm) filled with pre-weighed standard-ratio substrate (150±5 g; vermiculite: nutrient soil = 2:1). All pots were fully saturated with water, and excess water was removed from the trays the following day. Drought stress was then initiated by stopping watering. After one month of drought treatment, the WT plants exhibited severe leaf wilting and yellowing. MsPUB6 -OE plants retain greener leaves and better water retention. Figure 3 (B) After 7 days of rehydration following mowing, only one-third of the WT plants recovered growth, while all... MsPUB6 -All OE plants survived ( Figure 3 C in the text indicates overexpression. MsPUB6 It significantly enhanced the drought resistance of alfalfa.

[0048] Physiological analysis further supports this conclusion. Before drought treatment, WT and MsPUB6There were no significant differences in physiological indicators among -OE plants; however, after drought treatment, the relative leaf water content of WT plants decreased to 22%, MsPUB6 -OE plantlets remain at 84%-85% ( Figure 4 (B in the text). And after the drought, MsPUB6 The -OE strain had significantly lower malondialdehyde (MDA) and H2O2 content than the WT strain, while its catalase (CAT) activity was significantly higher than that of the WT strain. Figure 4 (CE in the text). In summary, overexpression MsPUB6 It can reduce oxidative damage and membrane damage, while enhancing the water retention capacity of leaves, thereby improving the drought resistance of alfalfa.

[0049] All treatments involved transplanting uniformly growing cuttings into plastic pots (8.5×8.5×9.5cm) filled with an equal volume of growing medium (vermiculite: nutrient soil = 2:1). The medium was fully saturated with water before transplanting. After transplanting, the plants were allowed to dry naturally for one month, followed by one week of rewatering.

[0050] 2.2.2 MsPUB6 Silencing reduces drought resistance in alfalfa To further explore MsPUB6 Its function in drought resistance was obtained using virus-induced gene silencing (VIGS) technology. MsPUB6 Silent strain. qRT-PCR analysis showed that TRV2- MsPUB6 In the plant MsPUB6 The transcription level decreased to 39% of the empty vector control (TRV2). Figure 6 The A in the figure indicates that the target gene was effectively silenced. Subsequently, both the control and silenced lines were subjected to drought stress. Phenotypic observation showed that, compared to the control, TRV2- MsPUB6 The wilting of the plant leaves was more severe, especially the basal leaves, which showed obvious wrinkling and shedding. Figure 5 (A) Further observation of the top leaves revealed that... MsPUB6 Silent plants lose more water and exhibit significant leaf yellowing. Figure 5 (B in the text). These phenotypic differences suggest that silence... MsPUB6 It may weaken the plant's ability to resist drought stress.

[0051] To investigate the physiological mechanism, relevant physiological indicators were measured before and after drought treatment. Before drought treatment, there was no significant difference in conductivity between the control and the silenced lines; however, after drought treatment, TRV2- MsPUB6 The plant's electrical conductivity rose to 79%, significantly higher than the control's 35%, indicating that... MsPUB6 Silence exacerbates membrane damage. Figure 6 (B in the text). Meanwhile, the chlorophyll content of the silent lines was significantly lower than that of the control (…). Figure 6(C) in the above. MsPUB6 Knockdown reduces the drought resistance of alfalfa by exacerbating membrane damage and accelerating chlorophyll degradation.

[0052] 3. Elucidation of the upstream transcriptional regulatory mechanism of MsPUB6 3.1 Materials and Methods 3.1.1 Drought Treatment The drought treatment method is the same as described in 2.1.1.

[0053] 3.1.2 Electrophoretic Mobility Assay (EMSA) The EMSA experiment used the LightShift chemiluminescent EMSA kit (Thermo Scientific), and the procedure was performed according to the instructions. A product containing... MsPUB6 Probes containing the GCCGAC cis-elements in the promoter were biotin-labeled (see Table 4). The purified His-MsDREB1C recombinant protein was co-incubated with the biotin-labeled DNA probes to detect binding activity. In the competition assay, 50-fold or 100-fold excess of unlabeled competing probes (see Table 4) were added to the reaction system and co-incubated with the biotin-labeled probes and His-MsDREB1C protein. To verify binding specificity, the His-MsDREB1C protein was also co-incubated with mutant probes carrying mutant cis-elements (see Table 4). After the binding reaction, the protein-DNA complexes were separated by non-denaturing polyacrylamide gel electrophoresis, transferred to a nylon membrane, and detected using a high-sensitivity chemiluminescence imaging system (Tanon 4600, Shanghai, China).

[0054] Table 4. Details of the probes used

[0055] 3.1.3 Fluorescence Imaging and Dual-Luciferase Reporter Assay Through homologous recombination MsPUB6 The promoter region was cloned and inserted into the pGreenII 0800-LUC vector to construct a reporter vector. Simultaneously, the coding sequence of MsDREB1C was inserted into the Super1300 vector to construct an effect vector (primers used are shown in Table 5). After sequencing verification, both vectors were transformed into Agrobacterium strain GV3101. Equal volumes of Agrobacterium culture carrying the effector (Super1300-MsDREB1C or empty vector) and the reporter were mixed and incubated at room temperature in the dark for 2 hours. Then, the mixed culture was infiltrated into tobacco (…) using a needle-free syringe. Nicotiana benthamiana The infiltrated areas were marked on the leaves. After the plants were cultured for another 48 hours, the leaves were taken for analysis.

[0056] For fluorescence imaging, detached tobacco leaves were uniformly sprayed with D-luciferin potassium working solution (150 mg / mL) until the leaf surface was fully wetted but not dripping, followed by dark adaptation for 5 minutes. The luminescence signal was captured using a light-cooled CCD camera system with an exposure time of 1-2 minutes. For dual-luciferase quantification, samples were taken from the wetted area using a perforator and immediately frozen in liquid nitrogen. The activities of firefly luciferase (LUC) and kidney luciferase (REN) were detected according to the instructions of the dual-luciferase reporter gene assay system (Promega, USA). Promoter activity was expressed as the LUC / REN ratio.

[0057] Table 5 Details of the quantitative primers used

[0058] 3.1.4 Measurement of relevant physiological indicators The determination of drought-related physiological indicators is as described in sections 2.1.4-2.1.7.

[0059] 3.2 Results and Analysis 3.2.1 MsDREB1C directly binds to and activates MsPUB6 transcription Building upon the established drought-resistance function of MsPUB6, this study further explores its upstream regulatory mechanisms. Previous multi-omics analyses suggest that the transcription factor MsDREB1C plays a crucial role. MsPUB6 A potential upstream regulator. To verify this hypothesis, an EMSA experiment was first conducted, which revealed that MsDREB1C can specifically bind to... MsPUB6 The CRT / DRE element (GCCGAC) in the promoter. This binding can be attenuated in a dose-dependent manner by unlabeled competing probes, and binding disappears completely when the core element is mutated. Figure 7 A in the text indicates that MsDREB1C specifically recognizes... MsPUB6 CRT / DRE element in the promoter.

[0060] To evaluate MsDREB1C's effect on MsPUB6 The transcriptional regulatory activity of MsDREB1C was investigated using dual-luciferase reporter gene assays. LUC imaging showed that MsDREB1C significantly activated [the transcriptional regulatory activity]. MsPUB6 Promoter-driven luciferase expression ( Figure 7 (B) Quantitative analysis showed that after co-expression of MsDREB1C, the LUC / REN ratio was approximately twice that of the empty vector control, confirming that MsDREB1C significantly enhanced the expression of LUC / REN. MsPUB6 transcriptional activity ( Figure 7 (C in the text). To verify this regulatory relationship at the genetic level, existing data were used. MsDREB1CqRT-PCR analysis was performed on the overexpression line (Zhang et al., 2024). The results showed that... MsPUB6 Transcription level at MsDREB1C The expression was significantly upregulated in overexpression lines ( Figure 7 (D in the text) further supports MsPUB6 The expression of MsDREB1C is positively regulated. In summary, these results indicate that MsDREB1C directly binds to… MsPUB6 The promoter activates its transcription.

[0061] 3.2.2 Transcription factor MsDREB1C positively regulates drought resistance in alfalfa To investigate the biological function of the upstream transcription factor MsDREB1C, its drought resistance was assessed using overexpression lines. The same drought treatment method as described above was used to analyze the drought resistance phenotypes of two overexpression lines (OE2 and OE8) and the wild-type (WT).

[0062] The results showed that, compared to WT, MsDREB1C -OE strains exhibit significantly enhanced drought resistance ( Figure 8 Physiological measurements further indicated that after drought stress, the overexpressing lines showed reduced membrane damage and oxidative stress levels, enhanced leaf water retention capacity, and increased antioxidant enzyme activity. Figure 9 In summary, these results indicate that overexpression MsDREB1C It significantly enhanced the drought resistance of alfalfa.

[0063] It should be noted that the specific embodiments described above are exemplary, and those skilled in the art can devise various solutions inspired by the disclosure of this invention, all of which fall within the scope of this invention and its protection. Those skilled in the art should understand that this specification is illustrative and not intended to limit the scope of the claims. The scope of protection of this invention is defined by the claims and their equivalents.

Claims

1. The use of alfalfa E3 ubiquitin ligase or its encoding gene in regulating alfalfa drought resistance, characterized in that, The amino acid sequence of the E3 ubiquitin ligase is shown in SEQ ID NO:

1. The alfalfa is alfalfa. Overexpression of the coding gene can promote drought resistance of alfalfa, while inhibiting the expression of the coding gene can reduce drought resistance of alfalfa.

2. The use according to claim 1, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO:

2.

3. A method for regulating the drought resistance of alfalfa, characterized in that, The process includes the following steps: constructing the encoding gene of claim 1 into a recombinant expression vector, introducing the recombinant expression vector into alfalfa cells, and screening to obtain alfalfa plants that overexpress the encoding gene to promote drought resistance in alfalfa.

Images