Biological material for editing CsYTH2 gene and application thereof in regulating fruit length of cucumber
By editing the PrLD domain of the CsYTH2 gene to disable its function, the problem of insufficient regulation of cucumber fruit length was solved, resulting in a significant increase in fruit length and yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-01
- Publication Date
- 2026-07-31
AI Technical Summary
Current technologies lack the ability to systematically mine genes that regulate cucumber fruit length at the level of RNA epigenetic modification, resulting in insufficient means of regulating cucumber fruit length and failing to meet the diverse needs of the market.
By using gene editing technology, one of the two allele strands of the CsYTH2 gene can be mutated to partially or completely disable its function, or only the PrLD domain in the CsYTH2 protein can be completely disabled, in order to regulate the increase in cucumber fruit length.
A novel mutant material with significantly increased fruit length was created, which significantly increased cucumber fruit length without affecting other agronomic traits of cucumber.
Smart Images
Figure CN122484083A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of cucumber breeding, specifically to editing. CsYTH2 Application of genetic biomaterials in regulating cucumber fruit length. Background Technology
[0002] cucumber( Cucumis sativus Cucumber (L.) is the highest-yielding vegetable crop in my country. Its fruit length is a core agronomical trait determining the weight of a single fruit and the yield per unit area, directly impacting growers' economic benefits. The market has clear and diverse demands for cucumber fruit length under different cultivation models and consumption scenarios. Therefore, identifying key genes controlling cucumber fruit length and elucidating their regulatory mechanisms is of great significance for precisely improving cucumber yield and marketability through molecular breeding.
[0003] N6-methyladenine (m 6 A) is the most abundant type of post-transcriptional modification on messenger RNA (mRNA), and its dynamic regulation in plants is accomplished by three classes of proteins working together: methyltransferases (Writers), demethylases (Erasers), and methylation-reading proteins (Readers). Among them, Reader proteins (such as YTH domain family proteins) specifically recognize and bind to mRNA. 6 Modification sites (A) regulate the stability, splicing, transport, and translation efficiency of target mRNAs, thereby participating extensively in biological processes such as plant growth and development, morphogenesis, and stress responses. For example, in tomatoes, Slyth1 / 2 has been reported to regulate the synthesis of fruit aromatic compounds; in rice, OsECT3 mediates cold tolerance responses.
[0004] Currently, several genes have been reported to be involved in regulating cucumber fruit length, such as CsFUL1A , CsSUP , CsCRC , CsARP1 , CsSEP2 and CsACS2 These studies mainly focus on traditional genetic pathways such as transcriptional regulation and hormone signal transduction. Existing research on melon growth-related genes lacks research on RNA epigenetic modifications (such as m...). 6 Systematic mining at level A).
[0005] In view of this, the present invention is hereby proposed. Summary of the Invention
[0006] In view of the shortcomings of the existing technology, one of the objectives of this invention is to provide editing... CsYTH2 Application of genetic biomaterials in regulating cucumber fruit length.
[0007] This biomaterial can be used for gene editing. CsYTH2The increase in cucumber fruit length can be regulated by mutating one of the two allele chains of a gene, causing it to partially or completely lose its function, while the other chain remains unmutated. Alternatively, the biological material can be used to regulate the increase in cucumber fruit length by completely disabling the PrLD domain in the CsYTH2 protein through gene editing.
[0008] The second objective of this invention is to provide a method for regulating cucumber fruit length. Mutant strains obtained using this method exhibit significantly increased fruit length without any serious negative effects.
[0009] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of this invention provides editing CsYTH2 Application of genetically modified biomaterials in regulating cucumber fruit length. CsYTH2 The amino acid sequence encoded by the gene is shown in Sequence 2 of the sequence listing; the biological material will be genetically edited to... CsYTH2 The length of cucumber fruit is regulated by mutating one of the two allele strands of a gene, causing it to partially or completely lose its function, while the other strand remains unmutated. Alternatively, the length of cucumber fruit can be regulated by gene editing of the biological material to completely disable the PrLD domain in the CsYTH2 protein. The regulation of cucumber fruit length refers to the regulation of an increase in the length of cucumber fruit.
[0010] Through extensive analysis, the inventors discovered that the CsYTH2 protein has the function of regulating cucumber fruit length, and it is present in different tissues of unedited cucumber materials (i.e., wild-type materials), including roots, stems, leaves, male flowers, and female flowers. CsYTH2 High expression of a gene, when knocked out (i.e., both allele strands of the gene are mutated) and its function is completely disabled (e.g., by frameshift mutation), leads to the death of cucumber plants, indicating that this gene is indispensable for cucumber growth. However, the inventors unexpectedly discovered through experiments that mutating only the nucleotide sequence encoding the PrLD domain of the CsYTH2 protein in both allele strands of this gene, causing complete disabling of the PrLD domain without causing mutations in the coding sequences of other domains in the protein (i.e., knocking out only the PrLD domain in the CsYTH protein), not only does not affect the growth of cucumber plants, but also significantly increases the fruit length; or mutating only one allele strand to partially or completely disable its function while the other strand remains unchanged, also does not affect the growth of cucumber plants and significantly increases the fruit length. In other words, both of these mutations not only do not negatively affect cucumber growth, but also significantly increase the fruit length, thereby increasing yield.
[0011] Specifically, mutations that completely disable the PrLD domain include deletions, insertions, substitutions, or omissions of one or more nucleotides in either allele strand, resulting in frameshift mutations or deletions in the coding sequence of the domain. In an embodiment of the present invention, a mutant obtained is: CsYTH2 The PrLD domain coding region of the two allelic strands of the gene lost 150 nucleotides (corresponding to nucleotides 398-547 in Sequence 1 of the sequence listing), resulting in the loss of amino acids 133-182 in the PrLD domain of the gene, as shown in Sequence 2 of the sequence listing. Simultaneously, amino acid 183 in the gene mutated from T (threonine) to A (alanine). This mutation did not alter the amino acid sequence of other domains of the CsYTH2 protein, i.e., it did not change the amino acid sequence of other domains (such as the YTH domain); it only completely disabled the function of the PrLD domain. Cucumber fruit length increased significantly.
[0012] The invention described CsYTH2 A mutation in one of the two allele strands of a gene that renders it ineffective while the other strand remains unchanged means that one allele strand has undergone an insertion, deletion, or base substitution of a single nucleotide or nucleotide fragment, resulting in partial or complete ineffectiveness of its function, while the other allele strand remains unchanged, i.e., no nucleotide insertion or deletion has occurred. The mutation in the mutated allele strand can be, for example, an insertion, deletion, or base substitution of a single nucleotide or nucleotide fragment in the coding region of the PrLD domain. It can be a frameshift mutation, a nucleotide fragment loss, or any other mutation that can render the strand completely or partially ineffective.
[0013] In the above application, as an optional implementation, the nucleotide sequence encoding the amino acid sequence shown in Sequence 2 of the sequence listing is as shown in Sequence 1 of the sequence listing.
[0014] One mutant obtained in an embodiment of the present invention is... CsYTH2 The PrLD domain coding region of the two allele strands of the gene lost 150 nucleotides, corresponding to nucleotides 398-547 of sequence 1 in the sequence listing.
[0015] In this invention CsYTH2 The amino acid sequence encoded by the gene is shown in Sequence 2 of the sequence listing, preferably, CsYTH2The CDS sequence of the gene is shown in Sequence 1 of the sequence listing. This gene includes a 5' UTR region and a 3' UTR region, as well as 8 exons. The coding region of the PrLD domain is located in the 5th exon from the 5' end, as shown by nucleotides 397-549 in Sequence 1 of the sequence listing; the coding region of the YTH domain is located in the 6th, 7th, and 8th exons from the 5' end, as shown by nucleotides 1371-1788 in Sequence 1 of the sequence listing. Specifically... Figure 1 As shown.
[0016] In this invention, biomaterials refer to materials created through gene editing techniques. CsYTH2 The material used for gene editing, exemplarily, could be the CRISPR / Cas9 genome editing system, in which a gRNA expression cassette is an essential element that can transcribe or express a gene for targeted editing. CsYTH2 gRNA at specific gene sites is used, and then Cas9 is used for cleavage to achieve the deletion, insertion, or substitution of single or multiple nucleotides in the gene. Biological materials used for gene editing contain gRNA that can target specific gene sites. CsYTH2 The gRNA expression cassette of a gene, including the target sequence or the nucleotide sequence encoding the gRNA, can be designed as one or two. To improve targeting or editing efficiency, it is preferable to design two target sequences or nucleotide sequences encoding the gRNA, especially for genes that require specific gRNA expression cassettes. CsYTH2 A mutant strain with partial nucleotide sequence deletions in both allele strands of a gene. As an alternative embodiment, the biological material comprises any one of the following (a)-(c): (a) gRNA combinatorial expression cassette, whose expression targets CsYTH2 The gene has two gRNAs; (b) A recombinant vector comprising the gRNA combination expression cassette described in (a); (c) A host cell or host bacterium containing the gRNA combination expression cassette of (a) or the recombinant vector of (b).
[0017] Furthermore, the two gRNAs include gRNA1 and gRNA2, which can target the coding region of the PrLD domain or the coding region of other domains, so as to... CsYTH2 The PrLD domain of the gene is completely disabled or rendered ineffective. CsYTH2If one allele of a gene mutates and loses its function, while the other allele remains unmutated, and a mutant strain with complete PrLD domain dysfunction while other domains in the gene remain unaffected is desired, then two gRNAs need to be designed to target the coding region of the PrLD domain. Preferably, the target sequence of gRNA1 is the nucleotide sequence shown in Sequence 3 of the sequence listing or its reverse complementary sequence; the target sequence of gRNA2 is the nucleotide sequence shown in Sequence 4 of the sequence listing or its reverse complementary sequence. The design of these two target sequences, combined with the CRISPR-Cas9 dual-nickelase system, is more conducive to obtaining… CsYTH2 A mutant strain in which the coding region of the PrLD domain in both allele strands of a gene is mutated, resulting in the complete failure of the PrLD domain.
[0018] Furthermore, the recombinant vector includes a Cas9 expression cassette and the gRNA combination expression cassette, wherein the Cas9 expression cassette expresses Cas9.
[0019] Host cells and host bacteria can be used to prepare high-quality or sufficient quantities of vectors, such as Escherichia coli cells or Escherichia coli, or they can be used as a medium to transform recombinant vectors into plants, such as Agrobacterium.
[0020] A second aspect of the present invention provides a method for regulating cucumber fruit length, the method comprising: using the biological material described in the first aspect of the present invention to regulate genes in the genome of cucumber material. CsYTH2 Editing to make genes CsYTH2 Mutation in one of the two allele strands leads to partial or complete loss of its function, while the other strand remains unmutated, or only the PrLD domain of the CsYTH2 protein is completely disabled, thus yielding cucumber materials with increased fruit length. CsYTH2 The amino acid sequence encoded by the gene is shown in Sequence 2 of the sequence listing. The nucleotide sequence encoding the amino acid sequence shown in Sequence 2 of the sequence listing is preferably shown in Sequence 1 of the sequence listing.
[0021] In the first aspect of this invention, the biological material used for gene editing utilizes two gRNAs transcribed from the biological material to recognize genes in the cucumber material genome. CsYTH2 The study identifies specific target sites in cucumber materials and then uses RNA-guided DNA endonucleases, such as Cas9, expressed in the materials to cleave double-stranded DNA at these sites. After repair, the resulting genome-edited cucumber materials are obtained, and these materials are then identified and screened to obtain the final gene. CsYTH2 A mutant strain in which one of the two allele strands is mutated, causing it to lose some or all of its function, while the other strand remains unchanged; or a mutant strain in which the gene... CsYTH2The mutant strain was obtained by mutating the corresponding nucleotide sequence encoding the PrLD domain in the two allele chains, resulting in complete loss of function of the PrLD domain of only the CsYTH2 protein; the fruit length of the obtained mutant strain increased.
[0022] Specifically, two gRNAs target different sites on the target gene. After Cas9 cleavage, the nucleotide sequence between the two cleavage sites is deleted, and the two broken ends are then directly joined together via the non-homologous end joining (NHEJ) repair pathway, thus obtaining a homozygous deletion mutant. This mutant is characterized by cucumber material with significantly increased fruit length. The Cas9 cleavage site is located approximately 3-4 bp upstream of the PAM sequence at each target site.
[0023] In the above method, as an optional implementation, the method specifically includes: S1: The recombinant vector described in the first aspect above is introduced into the cucumber material, and successfully transformed plants are obtained by screening. S2: Obtaining genes from the successfully transformed plants by identification. CsYTH2 Mutant strains, the gene CsYTH2 mutant lines CsYTH2 The gene mutation is any of the following: (1) CsYTH2 (2) A mutation in one strand of a gene's two alleles causes it to lose some or all of its function, while the other strand remains unmutated; CsYTH2 The corresponding nucleotide sequences encoding the PrLD domain in both allele strands of the gene are mutated, resulting in complete loss of function of the PrLD domain only in the CsYTH2 protein. The gene... CsYTH2 Mutant strains are cucumber materials with increased fruit length.
[0024] When genes CsYTH2 mutant lines CsYTH2 When only one allele in a gene has a mutation in the nucleotide sequence encoding the PrLD domain while the other allele remains unchanged, the T0 generation mutant can be self-pollinated to obtain progeny plants, from which plants can then be selected. CsYTH2 Homozygous mutant strain.
[0025] Furthermore, the identification involves using the genome of successfully transformed plants as a template for gene sequencing. CsYTH2 Fragment PCR amplification, followed by detection by gel electrophoresis or sequencing to obtain the gene. CsYTH2 Mutant lines. If gel electrophoresis reveals two bands of different lengths in the PCR product, and one of them is the same length as the PCR product of a non-transgenic plant or a wild-type plant, then the transgenic plant may be a mutant line. CsYTH2A gene in which a mutation in one strand renders it ineffective, while the other strand remains unmutated. CsYTH2 Mutant lines can be further identified through sequencing to confirm their specific mutant lineage. If gel electrophoresis reveals a single band in the PCR product, and the length of this band is significantly different from that of the PCR product from non-transgenic or wild-type plants, then the transgenic plant is likely a mutant. CsYTH2 A gene in which the corresponding nucleotide sequence encoding the PrLD domain is mutated in one of the two allele strands. CsYTH2 Mutant lines, or other homozygous or heterozygous mutants with completely inactivated function, which cannot be identified by gel electrophoresis, can be detected by sequencing to determine the specific mutation site. If the PCR product detected by electrophoresis shows two bands of significantly different lengths from the PCR product of non-transgenic or wild-type plants, it indicates that the mutant does not belong to the gene screened in this invention. CsYTH2 The mutant strain is lethal.
[0026] The preferred primer pair used for PCR amplification is sequence 5 and sequence 6 in the sequence listing.
[0027] When amplification is performed using the primer pair consisting of sequences 5 and 6, if the PCR product contains a 525 bp fragment and a fragment smaller than 525 bp, it indicates that the mutant strain is the one described in step S2. CsYTH2 A gene in which a mutation in one strand renders it ineffective, while the other strand remains unmutated. CsYTH2 Mutant strain.
[0028] Regarding a mutant strain obtained in this invention CsYTH2 ΔPrLD (that is, in) CsYTH The PrLD domain coding regions of both allele strands of the gene have lost 150 nucleotides (corresponding to nucleotides 398-547 in sequence 1 of the sequence listing). When amplified using primers consisting of sequences 5 and 6, the PCR product is only a 375 bp fragment.
[0029] Compared with the prior art, the present invention has the following beneficial effects: (1) CsYTH2 is an RNA methylation reader, and its specific function is unknown. The inventors found that complete loss of CsYTH2 function leads to plant death. The inventors also found that when only the PrLD domain in the CsYTH2 protein is knocked out, causing the domain to completely lose its function without changing the function of other domains, not only will other agronomic traits of cucumbers not be changed, but the length of cucumber fruits will also increase significantly. CsYTH2Mutations in the PrLD domain coding region of a gene, resulting in the loss of function of this domain, can be used to improve the fruit length of cucumber varieties; the inventors also discovered CsYTH2 Mutant strains in which one strand of a gene is mutated, rendering it ineffective while the other strand remains unmutated, do not affect other agronomic traits of cucumbers and can even increase cucumber fruit length.
[0030] (2) This invention provides biological materials for performing related gene editing to achieve CsYTH2 A mutation occurs in the coding region of the PrLD domain in a gene, causing the domain to lose its function while the functions of other domains in the gene remain unaffected or are disrupted. CsYTH2 A mutation in one strand of a gene's two alleles renders it ineffective while the other strand remains unmutated. This can improve cucumber germplasm or varieties, significantly increasing cucumber fruit length and yield.
[0031] (3) The present invention also provides a method for regulating the length of cucumber fruit. Through this method, a novel mutant material can be created that significantly increases the length of cucumber fruit by editing related genes of RNA epigenetic modification without serious negative phenotypes (such as lethality). This method lays the foundation for obtaining cucumbers with increased fruit length and high yield. Attached Figure Description
[0032] Figure 1 for CsYTH2 Gene structure, CsYTH2 Location information of gene editing sgRNA target 1 (T1 or Target1) and target 2 (T2 or Target2) and CsYTH2 ΔPrLD mutant strains in CsYTH2 Information on mutations occurring on homologous allele chains 1 and 2, with orange letters representing PAM.
[0033] Figure 2 Wild type CsYTH2 Genes and CsYTH2 ΔPrLD mutant strains and CsYTH2 / Csyth2 An infographic showing the location of mutations in the CsYTH2 gene in heterozygous mutant strains, where A represents... CsYTH2 ΔPrLD Mutation information at the DNA level of mutant strains, B is CsYTH2 ΔPrLD Mutation information of the amino acid sequence of the mutant strain, C is CsYTH2 / Csyth2 Mutation information diagram of CsYTH2 gene allele chains 1 and 2 in heterozygous mutant strains.
[0034] Figure 3 For wild type and different CsYTH2 Comparison of growth status of mutant lines, where A represents wild type and CsYTH2ΔPrLD Mutant lines, B being wild-type and CsYTH2 / Csyth2 Heterozygous mutant lines.
[0035] Figure 4 for CsYTH2 Expression patterns, where A represents the relative expression level of CsYTH2 in different tissues; B represents the relative expression level of CsYTH2 in cucumber fruits at different stages after pollination.
[0036] Figure 5 for CsYTH2 ΔPrLD homozygous mutants and CsYTH2 / Csyth2 Phenotypic results of heterozygous mutants, where: A represents WT and CsYTH2 / Csyth2 Phenotypic analysis of cucumber fruit length 10 days after pollination of heterozygous mutants; B represents WT and CsYTH2 / Csyth2 Statistical chart of fruit length 10 days after pollination of heterozygous mutants. CsYTH2 / Csyth2 The heterozygous mutant melon was significantly longer than the WT; C represents the WT and CsYTH2 / Csyth2 Statistical chart of cucumber fruit width 10 days after pollination of heterozygous mutants. CsYTH2 / Csyth2 The width of the heterozygous mutant melon is significantly smaller than that of the WT; D represents the difference between WT and WT. CsYTH2 ΔPrLD Phenotypic analysis of cucumber fruit length 10 days after pollination of the mutant; E represents WT and CsYTH2 ΔPrLD A statistical graph showing the length of cucumber fruits 10 days after pollination of the mutant. CsYTH2 ΔPrLD The melon length is significantly longer than WT; F represents WT and CsYTH2 ΔPrLD Statistical chart of cucumber fruit width 10 days after pollination of mutant. CsYTH2 ΔPrLD The mutant melon width is significantly smaller than WT.
[0037] Figure 6 The pBSE402 vector spectrum. Detailed Implementation
[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Those skilled in the art should understand that the embodiments described are merely illustrative of the invention and should not be considered as specific limitations thereof.
[0039] Unless otherwise specified, the experimental methods used in the following examples are generally performed under standard conditions. For reference, you may refer to the following books or manuals, such as Molecular Cloning: A Laboratory Manual (2nd Edition, by J. Sambrook et al., translated by Huang Peitang et al., Science Press, 2002), CRISPR-Cas9 Gene Editing Laboratory Manual, or Genome Editing: Principles and Applications, or follow the conditions recommended by the manufacturer.
[0040] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0041] In the quantitative experiments described below, three replicate experiments were conducted, and the average value of the results was taken.
[0042] The wild-type cucumber material used in the following examples is the North China dense-spined type ('Chinese Long') inbred line "9930".
[0043] This invention, through functional analysis, discovered that the protein CsYTH2, shown in sequence 2 of the sequence listing, can regulate cucumber fruit size. CsYTH2 When both allele strands of the gene are mutated in the coding region of the PrLD domain, and only the PrLD domain is dysfunctional, for example, in the gene... CsYTH2 When nucleotides 398-547 (a total of 150 bp) are deleted from the CDS, the process begins before pollination, i.e., day 0. CsYTH2 ΔPrLD The mutant cucumber fruit length was significantly increased compared to the wild-type cucumber (WT), increasing by 55.2% in length 10 days after pollination.
[0044] The following examples illustrate the gene provided by the present invention. CsYTH2 The process of obtaining the material and obtaining long cucumbers through gene editing is explained in detail.
[0045] Example 1: Wild-type cucumber CsYTH2 Acquisition of gene sequences 1. Extract total RNA from cucumbers and then reverse transcribe it to obtain cDNA.
[0046] 2. Using the cDNA obtained in step 1 as a template, amplify using primers. CsYTH2 Open reading frames of genes.
[0047] The PCR reaction system consisted of: 2 μL of upstream primer CsYTH2-F, 2 μL of downstream primer CsYTH2-R, 2 μL of cDNA template, 25 μL of high-fidelity enzyme, and ddH2O to a final volume of 50 μL. The PCR reaction conditions were as follows: pre-denaturation at 95°C for 30 seconds, followed by 35 cycles, each cycle consisting of denaturation at 95°C for 10 seconds, annealing at 55°C for 5 seconds, extension at 72°C for 1 minute, and a final extension at 72°C for 1 minute.
[0048] The primer sequences are as follows: CsYTH2-F: 5'-ATGGCTACTGTTGCTTCACC-3' (Sequence 7); CsYTH2-R: 5'-ATATCCGTTTGCTACACCACTTCTT-3' (Sequence 8).
[0049] 3. The PCR product was detected by 1% agarose gel electrophoresis, and the DNA fragment of 2112 bp was recovered and purified.
[0050] 4. The recovered fragments were sent to Beijing Nuosheng Genome Research Center Co., Ltd. for sequencing using the Novizan FastPure Gel DNA Extraction Mini Kit. The nucleotide sequence is shown in Sequence 1 of the sequence listing.
[0051] Example 2: Construction of CRIPSR / Cas9 gene editing vector I. Obtaining the CsYTH2 gene CRIPSR / Cas9 gene editing target sequence Using the CRISPR-P 2.0 website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR), in CsYTH2 Select 1-2 gRNA target sites (PAMs such as NGG) in the coding region, avoiding the YTH domain of CsYTH2 and high-homology series; design CsYTH2 The two targets for editing are: the target site of gRNA 1: 5'-GCAGGTGAATAAGGACCATA-3' (sequence 3). The target site for gRNA 2 is: 5'-ACAACAGTTCCTCCAACACA-3' (sequence 4). See the location of the target site in the genome. Figure 1 .
[0052] II. Construction [[ID=tmp]]CsYTH2 CRIPSR / Cas9 gene editing vector The gRNA was assembled and ligated into the pBSE402 vector using standard molecular cloning methods (see vector diagram). Figure 6 On ), obtain for CsYTH2The gene-editing recombinant vector, after sequencing confirmation, was used for Agrobacterium-mediated genetic transformation. The gene-editing vector pBSE402 contains eGFP, Cas9, and sgRNA expression cassettes. When this vector is transformed into plant cells, the eGFP expression cassette expresses green fluorescent protein, emitting green fluorescence under blue light. The gene-editing vector pBSE402 can also be replaced by other commercially available CRISPR / Cas9 system vectors; the specific construction methods are as follows: (1) The pBSE402 vector was digested with restriction endonuclease BsaI-HFv2 (NEB #R3733), and the linearized vector was recovered using the Novizan FastPure Gel DNA Extraction Mini Kit and stored at -20℃ for later use.
[0053] (2) The gRNA 1 and gRNA 2 sequences were designed as double-stranded DNA fragments with BsaI-HFv2 compatible sticky ends at both ends. The two corresponding DNA sequences are as follows: gRNA 1: GGTCTCGCAGGTGAATAAGGACCATACCAGAG (sequence 9) gRNA 2: GGTCTCACAACAGTTCCTCCAACACACCAGAG (sequence 10) (3) The pBSE402 vector was ligated with gRNA 1 and gRNA 2 using Golden Gate Assembly (GGA). The reaction system was as follows: 1 μL of linearized vector obtained in step (1), 1 μL of gRNA 1 fragment, 1 μL of gRNA 2 fragment, 2 µL of 10×T4 DNA Ligase Buffer, 1 µL of NEBridge Golden Gate Enzyme Mix (BsaI-HFv2), and Nuclease-free H2O to 10 µL. The reaction conditions were as follows: temperature cycling was used, with enzyme digestion at 37℃ and ligation at 16℃, repeated 30 times. All procedures were last kept at 60℃ for 5 minutes to inactivate the enzyme and terminate the reaction.
[0054] (4) Thaw a tube of 50 µL of NEB 10-beta competent Escherichia coli cells on ice for 10 minutes; add 2 µL of the reaction product obtained in step (3); gently tap the tube wall 4-5 times to mix; incubate on ice for 30 minutes; heat shock at 42°C for 30 seconds; immediately place on ice for 5 minutes; add 950 µL of antibiotic-free LB medium at room temperature; incubate at 37°C for 60 minutes; take 50 µL of the liquid and spread it on an LB plate containing chloramphenicol; invert the plate and incubate at 37°C overnight.
[0055] (5) Select 5-10 single clones and use the following primer pairs to detect whether they are positive single clones. Extract plasmids from the single clones that are correctly sequenced and store them at -20℃ for later use. The primer pairs are as follows: F: 5'-CTGCAGGAAGGTTTAAACGCATTTAGG-3' (sequence 11) R: 5'-TAATACGACTCACTCTAGGGAGACTCA-3' (Sequence 12).
[0056] Example 3: Obtaining gene-edited transgenic plants I. Agrobacterium-mediated transformation 1. Transform Agrobacterium with the recombinant plasmid prepared in Example 2. Take 1 μg of the recombinant vector prepared in Example 2 and place it in 100 μL of GV3101 competent cells. Quick-freeze in liquid nitrogen for 3 minutes, then incubate at 37°C for 5 minutes. Pick a single colony of Agrobacterium carrying the recombinant plasmid and inoculate it into YEB medium containing 50 mg / L kanamycin and 70 mg / L rifampin. Incubate overnight at 28°C and 200 rpm with shaking. Then, add 2 mL of the bacterial culture to 50 mL of YEB medium containing the same antibiotic concentration and continue incubating with shaking for approximately 14 hours until late logarithmic growth is achieved, with an OD600 value between 0.6 and 0.8. Next, collect the bacterial cells by centrifugation at 5000 rpm for 5 minutes. Wash the bacterial cells once with 1 / 2 MS liquid medium and dilute to 5 times the original bacterial volume, ensuring an OD600 value of approximately 0.2, for subsequent infection.
[0057] 2. Seed disinfection and preparation before infection Seeds of the cucumber 9930 strain had their seed coats removed with tweezers, were disinfected with 75% (v / v) ethanol for 15 seconds, and then with 0.6% (v / v) sodium hypochlorite solution for 15 minutes. The disinfected seeds were placed in plastic petri dishes containing Murashige and Skoog medium (Phytotech) containing 2 mg / L 6-benzylaminopurine (Sigma-Aldrich) and 1 mg / L abscisic acid (Phytotech), and germinated overnight in the dark at 28°C, followed by Agrobacterium infection.
[0058] 3. Infection Operation Select cucumber seeds that have grown for 2 days, remove the growing point and hypocotyl, and simultaneously remove the upper half (approximately 1 / 2 to 1 / 3) of both cotyledons, retaining the lower half. Infect the cotyledons with the diluted bacterial solution from the previous step for 15 minutes. After infection, gently blot away excess bacterial solution with sterile filter paper, and place the cotyledon pieces face down on differentiation medium (MS differentiation medium: MS medium supplemented with 0.5 mg / L 6-BA and 1 mg / L ABA). Incubate in the dark at 28°C for 2 days.
[0059] II. T0 generation CsYTH2 Obtaining and identifying gene-edited plants 1. Obtaining T0 generation regenerated plants After two days of co-culture, the newly grown callus tissue from the cotyledons was transferred to MS medium containing 150 mg / L spectinomycin and 50 mg / L streptomycin (AADA) and cultured for 14-21 days to screen for resistance. Only callus tissue transformed with the pBSE402 vector showed AADA resistance. Simultaneously, a second subculture was performed. The resistant callus tissue was then transferred to MS differentiation medium and cultured at 25-28℃ under light conditions until regeneration and seedling emergence.
[0060] 2. T0 generation CsYTH2 Obtaining gene-edited plants The regenerated seedlings were transplanted into an artificial climate chamber, and DNA was extracted from young cucumber leaves using CTAB. DNA was then amplified by PCR using the identification primer YJJ20. CsYTH2 Editing sites, wild-type material CsYTH2 The PCR product size at the site was 525 bp, and the T0 regenerated plant material CsYTH2 The electrophoresis image of the PCR products showed two bands, one of which was similar to WT. CsYTH2 PCR products are similar in size, but one type has bands that are significantly smaller than WT. CsYTH2 The PCR products were then subjected to Sanger sequencing, retaining all... CsYTH2 Eight mutant plants were obtained through heterozygous editing, and each line was self-pollinated to obtain T1.
[0061] Primer YJJ20 is as follows: The PCR reaction system consisted of: 2 μL of upstream primer YJJ20_L, 2 μL of downstream primer YJJ20_R, 2 μL of DNA template, 25 μL of high-fidelity enzyme, and ddH2O to a final volume of 50 μL. The PCR reaction conditions were as follows: pre-denaturation at 95°C for 30 seconds, followed by 35 cycles, each cycle consisting of denaturation at 95°C for 10 seconds, annealing at 55°C for 5 seconds, extension at 72°C for 1 minute, and a final extension at 72°C for 1 minute.
[0062] 3. Screening and phenotype analysis of T1 generation edited mutants right CsYTH2 DNA was extracted from the young tissues of T1 seedlings from eight different lines that underwent mutations. Editing sites were identified, and... CsYTH2 A mutant in which both allele strands of the gene are missing 150 bp nucleotides in the coding region of the PrLD domain on the CDS (corresponding to nucleotides 398-547 in Sequence 1 of the sequence listing, i.e., missing 50 amino acids). CsYTH2 ΔPrLD (See) Figure 1 , Figure 2 A and Figure 2 B), and CsYTH2 A heterozygous mutant line in which one of the two allele strands of a gene is mutated while the other is not. CsYTH2 / Csyth2 (See) Figure 2 C) Heterozygous mutant lines CsYTH2 / Csyth2 The mutated strand contains a deletion of one nucleotide, specifically the deletion of nucleotide G at position 9 of allele 1, corresponding to nucleotide 398 as shown in Sequence 1 of the sequence listing. For the eight mutant lines, 100 T1 generation materials were identified for each line, and no mutations were found. CsYTH2 A complete gene knockout strain is a single plantlet in which frameshift mutations occur in both allele strands near the target site. Normally, CsYTH2 Complete knockout should be heritable, but it was not found in the T1 generation. The above identification results do not conform to Mendelian inheritance laws, therefore it is inferred that... CsYTH2 Complete loss of function (e.g., due to a frameshift mutation resulting in the loss of the YTH domain) will cause plant death, thus making it impossible to obtain [the necessary nutrients]. CsYTH2 A mutant with complete loss of function. (In this article...) CsYTH2 A mutant with a 150 bp deletion at positions 398-547 in the gene's CDS CsYTH2 ΔPrLD Some functions are still retained, especially the YTHdomain for RNA methylation recognition. CsYTH2 ΔPrLD It is a weak mutant; its functions are not completely lost. CsYTH2 ΔPrLDThe amino acid sequence encoded by the mutant gene is shown in Sequence 13 of the sequence listing. Amino acid positions 1-132 are identical to those of the wild-type CsYTH2 protein, and amino acid positions 134-654 are identical to those of positions 184-704. This mutant gene only loses 50 amino acids in the PrLD domain and has a substitution at amino acid position 183 of the wild-type CsYTH2 protein, replacing T with A. A 150 bp deletion mutant was identified from the T1 generation plants of the eight mutants in this study. This mutant retained the YTH domain for RNA recognition and binding, therefore RNA binding and recognition functions were unaffected. Further mutations were also identified in the T1 generation plants of the eight mutants. CsYTH2 A heterozygous mutant in which one strand of a gene is rendered functionally ineffective due to a single nucleotide deletion, while the other strand remains unmutated. CsYTH2 / Csyth2 .
[0063] The QRT-PCR method was used to detect genes in different tissues of wild-type cucumber plants, including roots, stems, leaves, male flowers, female flowers, and tendrils. CsYTH2 The expression was examined, and it was found that CsYTH2 It was expressed in different tissues, with high expression in male flowers and stems; therefore, it can be determined that... CsYTH2 These are genes essential for cucumber growth (see...). Figure 4 A), therefore, combined CsYTH2 Gene-edited T1 generation identification results confirmed CsYTH2 Knockout can be fatal.
[0064] The QRT-PCR method was also used to analyze the genes in fruits of wild-type cucumber plants at different time points after self-pollination. CsYTH2 The expression was examined, and it was found that CsYTH2 The relative expression level of the gene gradually increases with the increase of pollination days (see [reference]). Figure 4 B), which illustrates CsYTH2 It plays an important role in the development of cucumber fruit.
[0065] One was identified from T1 CsYTH2 The homozygous mutant with 150 bases missing is Figure 1 and Figure 2 In CsYTH2 ΔPrLD and heterozygous mutants CsYTH2 / Csyth2 , CsYTH2 ΔPrLD mutants in CsYTH2 A missing value occurs at positions 398-547 in the CDS PrLD structural domain, such as... Figure 1 or Figure 2As shown in A, the corresponding amino acid changes are as follows: Figure 2 As shown in B; heterozygous mutant CsYTH2 / Csyth2 The mutated strand has a nucleotide missing. See [link to relevant documentation]. Figure 2 Nucleotide G is deleted at position 9 of allele 1 in C, corresponding to nucleotide 398 as shown in Sequence 1 of the sequence listing. Compared to wild-type 9930 (WT), CsYTH2 ΔPrLD The mutant plant as a whole showed no significant changes during the growth period (see [link]). Figure 3 A), heterozygous mutant ( CsYTH2 / Csyth2 The overall plant showed no significant changes during the growing season (see [reference]). Figure 3 B). Compared to the wild type, the heterozygous mutant ( CsYTH2 / Csyth2 )as well as CsYTH2 ΔPrLD Ten days after pollination, the mutants showed significant increases in fruit length of 58.54% and 55.2%, respectively. Figure 5 A, Figure 5 B. Figure 5 D and Figure 5 E). From Figure 5 C and Figure 5 F indicates that the heterozygous mutation ( ) begins to occur 10 days after pollination. CsYTH2 / Csyth2 )as well as CsYTH2 ΔPrLD The width of the mutant melon was significantly smaller than that of the wild type.
Claims
1. Edit CsYTH2 Application of genetically modified biomaterials in regulating cucumber fruit length. CsYTH2 The amino acid sequence encoded by the gene is shown in Sequence 2 of the sequence listing; the biological material will be genetically edited to... CsYTH2 The length of cucumber fruit is regulated by mutating one of the two allele strands in a gene, causing it to partially or completely lose its function, while the other strand remains unmutated. Alternatively, the length of cucumber fruit can be regulated by gene editing of the biological material to completely disable the PrLD domain in the CsYTH2 protein. The regulation of cucumber fruit length refers to the regulation of an increase in the length of cucumber fruit.
2. The application according to claim 1, characterized in that, The nucleotide sequence of the amino acid sequence shown in Sequence 2 of the sequence listing is as shown in Sequence 1 of the sequence listing.
3. The application according to claim 1, characterized in that, The biomaterial includes any one of the following (a)-(c): (a) gRNA combinatorial expression cassette, whose expression targets CsYTH2 The gene contains two gRNAs; (b) A recombinant vector comprising the gRNA combination expression cassette described in (a); (c) A host cell or host bacterium containing the gRNA combination expression cassette of (a) or the recombinant vector of (b).
4. The application according to claim 3, characterized in that, The two gRNAs include gRNA1 and gRNA2, wherein the target sequence of gRNA1 is the nucleotide sequence shown in Sequence 3 of the sequence listing or the reverse complementary sequence of the sequence shown in Sequence 3 of the sequence listing; and the target sequence of gRNA2 is the nucleotide sequence shown in Sequence 4 of the sequence listing or the reverse complementary sequence of the sequence shown in Sequence 4 of the sequence listing.
5. The application according to claim 3, characterized in that, The recombinant vector includes a Cas9 expression cassette and the gRNA combination expression cassette of claim 3 or 4, wherein the Cas9 expression cassette expresses Cas9.
6. A method for regulating the length of cucumber fruits, characterized in that, The method includes: utilizing the biological material described in any one of claims 1 to 5 to target the genome of cucumber material. CsYTH2 Gene editing, making genes CsYTH2 Mutation in one of the two allele strands leads to partial or complete loss of its function, while the other strand remains unmutated, or only the PrLD domain of the CsYTH2 protein is completely disabled, thus yielding cucumber materials with increased fruit length. CsYTH2 The amino acid sequence encoded by the gene is shown in Sequence 2 of the sequence listing.
7. The method according to claim 6, characterized in that, The method specifically includes: S1: Introduce the recombinant vector according to any one of claims 3-5 into the cucumber material, and obtain successfully transformed plants by screening; S2: Obtaining genes from the successfully transformed plants by identification. CsYTH2 Mutant strains, the gene CsYTH2 mutant lines CsYTH2 The gene mutation can be any of the following: (1) CsYTH2 (2) A mutation in one strand of a gene's two alleles causes it to partially or completely lose its function, while the other strand remains unmutated. CsYTH2 The corresponding nucleotide sequences encoding the PrLD domain in both allele strands of the gene are mutated, resulting in complete loss of function of the PrLD domain only in the CsYTH2 protein; the gene CsYTH2 Mutant strains are cucumber materials with increased fruit length.
8. The method according to claim 7, characterized in that, The nucleotide sequence of the amino acid sequence shown in Sequence 2 of the sequence listing is as shown in Sequence 1 of the sequence listing.
9. The method according to claim 7, characterized in that, The identification process involved using the genome of successfully transformed plants as a template for gene sequencing. CsYTH2 Fragment PCR amplification, followed by detection by gel electrophoresis or sequencing to obtain the gene. CsYTH2 Mutant strain.
10. The method according to claim 9, characterized in that, The primer pairs used for the PCR amplification are as shown in sequence 5 and sequence 6 in the sequence listing.