Carboxylesterase, one-step purification and immobilization method and application thereof
By using a carrier material formed by terephthalic acid and cobalt ions to specifically bind to His-tagged carboxylesterase protein, the problems of easy blockage of enzyme active sites and complex purification steps in traditional immobilization methods are solved, achieving efficient and stable carboxylesterase immobilization, which is suitable for the degradation of phthalate plasticizers.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ANHUI NORMAL UNIV
- Filing Date
- 2026-04-01
- Publication Date
- 2026-07-31
AI Technical Summary
Traditional immobilization methods for carboxylesterases suffer from random binding sites that can easily block the enzyme's active site, resulting in low catalytic efficiency. Furthermore, the purification process is complex and time-consuming, making it difficult to achieve efficient reusability.
A highly efficient carboxylesterase composite material was constructed by using a carrier material rich in coordination unsaturated metal sites formed by terephthalic acid and cobalt ions to specifically bind to His-tagged carboxylesterase proteins, achieving one-step purification and immobilization.
It achieves efficient enzyme purification and immobilization, improves catalytic efficiency and stability, has good reusability, is suitable for large-scale production, and is applicable to the degradation of phthalate plasticizers.
Smart Images

Figure CN122484084A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering, specifically to a carboxylesterase, its one-step purification and immobilization method, and its applications. Background Technology
[0002] Phthalate esters (PAEs), as common plasticizers, are widely used in industrial products such as cosmetics, food packaging, and medical devices to enhance their flexibility and durability. However, because PAEs are difficult to bond stably with plastic molecules, they easily leach into the atmosphere, water bodies, and soil, and subsequently accumulate in organisms through the food chain, posing a potential threat to ecosystems and human health. Therefore, removing PAEs from the environment is crucial for maintaining ecological balance and protecting public health. Compared with traditional physicochemical methods, biodegradation methods offer advantages in terms of efficiency and environmental friendliness. Studies have shown that carboxylesterases can catalyze the hydrolysis of ester bonds in PAEs, converting them into low-toxicity or non-toxic metabolites, demonstrating promising applications in PAE pollution remediation.
[0003] Carboxylesterases are a class of enzymes that specifically catalyze the hydrolysis of ester bonds in aqueous environments. These enzymes do not require cofactors in catalyzing the synthesis and hydrolysis of ester compounds and exhibit good stability, stereoselectivity, and regiospecificity, thus finding wide application in various industrial fields such as food processing, pharmaceutical production, and environmental bioremediation. Recent studies have shown that carboxylesterases demonstrate significant potential in degrading various natural esters and environmental pollutants, and can be used to treat agricultural waste, remove pesticide residues, and decompose esterifiable plastics and related toxic ester compounds. These studies further expand the application scope of carboxylesterases, highlighting their important role as green catalytic tools in environmental remediation and biotransformation.
[0004] However, free enzymes are often limited in industrial applications due to their low stability and difficulty in recycling. While enzyme immobilization technology can enhance stability and enable reusability, two key problems remain: first, traditional immobilization often involves random binding sites, easily blocking the enzyme's active site and reducing catalytic efficiency; second, complex and time-consuming purification is required before immobilization to eliminate impurities. Therefore, combining purification and immobilization steps into a single step for enzyme purification and immobilization has become a development trend. The carrier material formed from terephthalic acid and cobalt ions possesses abundant coordination unsaturated metal sites, which can specifically bind to the imidazole groups in His-tagged recombinant enzyme proteins, thus providing a novel platform for one-step enzyme purification and immobilization. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention aims to obtain a carboxylesterase gene with high catalytic efficiency from microorganisms, prepare its encoded protein through heterologous expression, and further provide a carrier material for enzyme immobilization, thereby establishing a purification and immobilization technology for the carboxylesterase, while also providing its preparation method and applications.
[0006] First, based on the carboxylesterase gene ces6 (GenBank: WP_012381524) from the *Streptomyces griseus* chromosome (NC_010572), a modified gene ces6' was constructed using a codon optimization strategy. The protein Ces6 encoded by this gene was then prepared via heterologous expression. Second, a carrier material rich in coordination unsaturated metal sites, formed from terephthalic acid and cobalt ions, was provided, capable of specifically binding to the His-tagged protein of the carboxylesterase (this method is also applicable to other target proteins with His tags). Finally, using Ces6 as the enzyme protein and the aforementioned carrier material as the immobilization carrier, a carboxylesterase composite material with both efficient purification and immobilization functions was developed, along with its preparation method and applications.
[0007] The present invention provides a carboxylesterase, wherein the amino acid sequence of the carboxylesterase Ces6 is SEQ ID NO: 2.
[0008] Further, the carboxylesterase Ces6 is encoded and expressed by the optimized carboxylesterase gene ces6'; ces6' is obtained by codon optimization of the carboxylesterase gene ces6 (GenBank: WP_012381524) from *Streptomyces griseus*, and its base sequence is shown in SEQ ID NO: 1. The preparation method is described in reference to patent number CN109762832B, with the patent application titled "Carboxylesterase Gene, Recombinant Plasmid, Recombinant Engineered Bacteria, Encoded Protein, and Application". Specific steps include: (1) Optimization, synthesis and sequence analysis of the carboxylesterase gene ces6 To address the issue of inhibited heterologous expression of the high-GC-content carboxylesterase gene ces6 (GenBank: WP_012381524, start codon ATG, stop codon TGA) from the *Streptomyces griseus* chromosome (NC_010572) in *Escherichia coli*, this study successfully constructed a modified gene, ces6', using a codon optimization strategy. The optimization process involved replacing the original *Streptomyces*-preferred codons with *E. coli*-preferred codons and significantly reducing the GC content of the gene sequence, while strictly maintaining the gene length and encoded amino acid sequence. The optimized ces6' gene retains the start codon ATG, but the stop codon is replaced with TAA; its base composition is: 152 A bases (16.9%), 188 T bases (21%), 263 C bases (29.3%), and 294 G bases (32.8%). This optimization effectively resolved the expression barrier caused by the excessively high GC content of the original gene, laying the foundation for successful heterologous expression of carboxylesterase Ces6 in the *E. coli* system. (2) Construction of expression plasmids and recombinant engineered bacteria First, the artificially optimized and synthesized carboxylesterase gene ces6' and plasmid expression vector pET-28b(+) were double-digested with Nde I and Xho I. The digestion system consisted of 30 μL ces6' / pET-28b(+), 6 μL 10× buffer, 3 μL Nde I, 3 μL Xho I and 18 μL ddH2O, and the reaction was carried out at 37 °C for 5 h. Next, the restriction enzyme fragment of the target gene ces6' was mixed and ligated with the restriction enzyme fragment of the vector pET-28b(+) to construct the expression plasmid pET28b-ces6'. The ligation system consisted of 5 μL ces6', 3 μL pET-28b(+), 1 μL T4 ligase, and 1 μL 10×T4 ligase buffer. The ligation reaction was carried out overnight at 16 ℃ to obtain the ligation reaction solution. Finally, 10 μL of the ligation reaction solution was mixed with 100 μL of L. coli Rosetta (DE3) competent cells and incubated on ice for 30 min, gently shaking 10 times every 2 min to prevent cell precipitation. After heat shock at 42 ℃ for 90 s, the mixture was immediately incubated on ice for 5 min, and then 500 μL of LB medium was added for recovery culture for 1 h to construct the recombinant engineered bacterium Rosetta (DE3) pLysS / pET28b-ces6'. This engineered bacterium exhibits Kan and Cam resistance, and recombinant engineered bacteria can be screened on Kan and Cam-resistant LB medium. (3) Expression and SDS-PAGE identification of carboxylesterase Ces6 Recombinant engineered bacteria were picked from the successfully transformed plates and inoculated into 4 mL of LB liquid medium. The culture was incubated overnight at 37 °C with shaking at 150 rpm. The culture was then transferred 1:100 to a conical flask containing 100 mL of LB liquid medium and incubated at 37 °C with shaking at 225 rpm. Bacterial growth was observed during this period. When the OD600 reached approximately 0.6, IPTG was added to a final concentration of 0.1 mM, and the culture was induced by shaking at 20 °C with shaking at 180 rpm for approximately 20 h. Subsequently, the bacterial cells were collected by centrifugation at 4 °C and 10,000 rpm for 5 min, followed by ultrasonic disruption to obtain the crude carboxylesterase Ces6 enzyme solution. Finally, 12% SDS-PAGE protein electrophoresis was used for verification. The results showed that the crude enzyme solution exhibited distinct protein bands between 25 and 33 kDa.
[0009] This invention provides a one-step purification and immobilization of a carboxylesterase, using the aforementioned carboxylesterase Ces6 as the enzyme protein and an affinity material rich in coordination unsaturated metal sites formed by terephthalic acid and cobalt ions as the immobilization carrier.
[0010] Furthermore, the immobilized carrier is formed by coordination of terephthalic acid and cobalt ions, and has abundant coordination unsaturated metal sites, which can specifically bind to the His tag of a protein with a histidine tag.
[0011] Furthermore, the immobilized carrier is a purplish-red powder with a regular lamellar structure in its microstructure.
[0012] Furthermore, the optimal reaction pH for the one-step purification and immobilization of carboxylesterase is 9.0, and the optimal reaction temperature is 60 °C.
[0013] Furthermore, the one-step purified immobilized carboxylesterase exhibits excellent pH stability; after treatment at pH 9.0 for 48 h, the relative activity of the one-step purified immobilized carboxylesterase remains above 65%.
[0014] Furthermore, the one-step purified immobilized carboxylesterase exhibits good thermal stability, retaining 47.31% of its initial activity after incubation at 55°C for 94 h.
[0015] Furthermore, the Km of the one-step purified immobilized carboxylesterase is 0.58 mM and the Vmax is 16.39 μM min⁻¹, demonstrating excellent substrate affinity and catalytic efficiency.
[0016] Furthermore, the one-step purified immobilized carboxylesterase exhibits good reusability, retaining 74% of its initial activity after being reused five times.
[0017] Furthermore, the one-step purified immobilized carboxylesterase was analyzed by SDS-PAGE, and a single, clear protein band appeared.
[0018] This invention provides a method for preparing the above-mentioned one-step purified immobilized carboxylesterase, using carboxylesterase Ces6 as the enzyme protein and an affinity material rich in coordination unsaturated metal sites formed by terephthalic acid and cobalt ions as the immobilization carrier, to prepare the immobilized carboxylesterase, comprising the following steps: (1) Take 10-100 mL of N,N-dimethylformamide and 5-20 mL of anhydrous ethanol and mix them evenly to obtain a mixture. Add 0.1-5 g of terephthalic acid and 0.1-5 g of cobalt hexahydrate to the mixture. Place it on a magnetic stirrer and stir for 1-60 min. Pour it into a reaction vessel and react at 60-150 ℃ for 6-18 h. After the reaction is completed, cool it naturally to room temperature. After vacuum filtration, wash the obtained solid twice with N,N-dimethylformamide and anhydrous ethanol to obtain the carrier material formed by terephthalic acid and cobalt ions. (2) Take 2-32 mg of the carrier material powder obtained in step (1) and add it to 1 mL of crude carboxylesterase Ces6 solution with a concentration of 1 mg / mL. Mix it evenly by vortexing and incubate it in a shaker at 5-55 ℃ and 150 rpm for 0.25-8 h to immobilize the enzyme. (3) Centrifuge the incubation solution obtained in step (2) at 10,000 rpm for 5 min, discard the supernatant, and wash the collected precipitate with PBS buffer several times to remove unbound enzymes. The resulting purple-red precipitate is the one-step purified immobilized carboxylesterase.
[0019] Furthermore, the preparation method includes the following steps: (1) Take 50 mL of N,N-dimethylformamide and 12.5 mL of anhydrous ethanol and mix them evenly to obtain a mixture. Add 1.15 g of terephthalic acid and 2 g of cobalt hexahydrate to the mixture. Place it on a magnetic stirrer and stir for 15 min. Then pour it into a reaction vessel and react at 100 °C for 12 h. After the reaction is completed, cool it naturally to room temperature. After vacuum filtration, the obtained solid is washed twice with N,N-dimethylformamide and anhydrous ethanol to obtain the carrier material formed by terephthalic acid and cobalt ions. (2) Take 16 mg of the carrier material powder obtained in step (1) and add it to 1 mL of carboxylesterase Ces6 solution with a concentration of 1 mg / mL. Mix it evenly by vortexing and incubate it in a shaker at 35 ℃ and 150 rpm for 1 h to immobilize the enzyme. (3) Centrifuge the incubation solution obtained in step (2) at 10,000 rpm for 5 min, discard the supernatant, and wash the collected precipitate three times with PBS buffer to remove unbound enzymes. The resulting purple-red precipitate is the immobilized carboxylesterase.
[0020] Furthermore, the preparation method is applicable to other target proteins with His tags.
[0021] This invention also provides the application of the above-described one-step purified and immobilized carboxylesterase in the field of plastic degradation.
[0022] Furthermore, the application of the one-step purified immobilized carboxylesterase in the degradation of phthalic acid ester plasticizers includes the following steps: mixing the dibutyl phthalate mother liquor with the purified immobilized carboxylesterase solution, shaking the reaction mixture for 0.1-48 h, and separating the undegraded dibutyl phthalate after the reaction is completed. The reaction temperature is 30℃ and the shaking speed is 150 rpm.
[0023] Furthermore, the one-step purified immobilized carboxylesterase can efficiently degrade 67% of dibutyl phthalate within 48 hours.
[0024] The beneficial effects of this invention are: 1. This invention connects the carboxylesterase gene ces6' to the pET28b(+) plasmid, successfully constructing a recombinant expression vector pET28b(+)-ces6' with resistance to both kanamycin (Kan) and chloramphenicol (Cam). Subsequently, this recombinant plasmid was transformed into Rosetta(DE3) competent E. coli cells, successfully constructing a recombinant engineered bacterium Rosetta(DE3)pLysS / pET28b-ces6' with resistance to both kanamycin and chloramphenicol. Finally, under low temperature and appropriate isopropyl thiogalactoside (IPTG) induction conditions, heterologous expression of the ces6' gene was successfully achieved in E. coli using this recombinant engineered bacterium.
[0025] 2. The carrier material used in this invention is a porous crystal complex constructed through coordination bonds between metal ions and organic ligands. The cobalt ions contained therein can stably bind to the imidazole groups of histidine on histidine-tagged proteins through strong coordination. Therefore, it can selectively and efficiently separate, purify, and directionally immobilize histidine-tagged proteins (including Ces6), improving protein reusability. Furthermore, its preparation process is simple, inexpensive, and suitable for large-scale production.
[0026] 3. Compared to crude enzymes, this immobilized enzyme exhibits higher substrate affinity and catalytic efficiency, while maintaining good operational stability, retaining over 74% of its residual activity even after five reuses. These characteristics demonstrate significant application potential in the bioremediation of microplastic pollution. Attached Figure Description
[0027] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1 SDS-PAGE images of crude Ces6 enzyme and one-step purified immobilized carboxylesterase; Figure 2 This is an image of a carrier material formed by terephthalic acid and cobalt ions; Figure 3 This is a scanning electron microscope image of the support material formed by terephthalic acid and cobalt ions; Figure 4 XPS full spectrum of the support material formed by terephthalic acid and cobalt ions; Figure 5 A diagram showing the determination of reaction time during the one-step purification and preparation of immobilized carboxylesterase; Figure 6 The figure shows the determination of reaction temperature during the one-step purification and preparation of immobilized carboxylesterase. Figure 7 Figure showing the determination of the mass ratio of Ces6 crude enzyme protein to carrier material during the one-step purification and immobilization of carboxylesterase; Figure 8 Scanning electron microscope image of a one-step purified immobilized carboxylesterase; Figure 9 Infrared spectra of Ces6 crude enzyme, carrier material, and one-step purified immobilized carboxylesterase; Figure 10 The effect of reaction pH on the activity of crude Ces6 enzyme and one-step purified immobilized carboxylesterase is shown in the figure. Figure 11 The figure shows the effect of reaction temperature on the activity of crude Ces6 enzyme and one-step purified immobilized carboxylesterase. Figure 12 A comparison of the specific enzyme activities of crude Ces6 enzyme and one-step purified immobilized carboxylesterase; Figure 13 pH stability diagrams for crude Ces6 enzyme and one-step purified immobilized carboxylesterase; Figure 14 Thermostability diagrams of crude Ces6 enzyme and one-step purified immobilized carboxylesterase; Figure 15 A graph showing the number of times the immobilized carboxylesterase was purified in one step; Figure 16 The graph shows the degradation efficiency of dibutyl phthalate by immobilized carboxylesterase in a one-step purification process. Detailed Implementation
[0028] The present invention will be further described below with reference to specific embodiments and accompanying drawings, illustrating that the invention can be implemented. This complete description of the invention will make its technical content clearer and easier to understand for those skilled in the art. The present invention can be embodied in many different forms of embodiments, and its scope of protection is not limited to the embodiments mentioned herein. The accompanying drawings and descriptions are essentially illustrative and not restrictive of the invention.
[0029] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.
[0030] Unless otherwise specified, all other raw materials, reagents, and equipment used in the embodiments are commercially available or publicly disclosed.
[0031] Example 1: Preparation of carboxylesterase Ces6 Based on the carboxylesterase gene ces6 (GenBank: WP_012381524) of the Streptomyces griseus chromosome (NC_010572), the modified gene ces6' was successfully constructed first through codon optimization strategy, and then its encoded protein Ces6 was prepared by heterologous expression; the steps are referenced in patent number CN109762832B, and the patent application is entitled "Carboxylesterase gene, recombinant plasmid, recombinant engineered bacteria and encoded protein and application".
[0032] The specific steps are as follows: (1) Optimization, synthesis and sequence analysis of the carboxylesterase gene ces6 To address the problem of inhibited heterologous expression of the high-GC-content carboxylesterase gene ces6 (GenBank: WP_012381524, start codon ATG, stop codon TGA) from the *Streptomyces griseus* chromosome (NC_010572) in *Escherichia coli*, this study successfully constructed its modified gene ces6' using a codon optimization strategy. The optimization process involved replacing the original *Streptomyces*-preferred codons with *E. coli*-preferred codons and significantly reducing the GC content of the gene sequence, while strictly maintaining the gene length and encoded amino acid sequence. The optimized ces6' gene retains the start codon ATG, but the stop codon is replaced with TAA; its base composition is: 152 A bases (16.9%), 188 T bases (21%), 263 C bases (29.3%), and 294 G bases (32.8%). This optimization effectively solved the expression barrier caused by the excessively high GC content of the original gene, laying the foundation for the successful heterologous expression of carboxylesterase Ces6 in the *E. coli* system.
[0033] (2) Construction of expression plasmids and recombinant engineered bacteria First, the artificially optimized and synthesized carboxylesterase gene ces6' and plasmid expression vector pET-28b(+) were double-digested with Nde I and Xho I. The digestion system consisted of 30 μL ces6' / pET-28b(+), 6 μL 10× buffer, 3 μL Nde I, 3 μL Xho I, and 18 μL ddH2O. The reaction was carried out at 37 °C for 5 h.
[0034] Next, the restriction enzyme fragment of the target gene ces6' was mixed and ligated with the restriction enzyme fragment of the vector pET-28b(+) to construct the expression plasmid pET28b-ces6'. The ligation system consisted of 5 μL ces6', 3 μL pET-28b(+), 1 μL T4 ligase, and 1 μL 10×T4 ligase buffer. The ligation reaction was carried out overnight at 16 ℃ to obtain the ligation reaction solution.
[0035] Finally, 10 μL of the ligation reaction solution was mixed with 100 μL of L. coli Rosetta (DE3) competent cells and incubated on ice for 30 min, gently shaking 10 times every 2 min to prevent cell precipitation. After heat shock at 42 ℃ for 90 s, the mixture was immediately incubated on ice for 5 min, and then 500 μL of LB medium was added for recovery culture for 1 h to construct the recombinant engineered bacterium Rosetta (DE3) pLysS / pET28b-ces6'. This engineered bacterium exhibits Kan and Cam resistance, and recombinant engineered bacteria can be screened on Kan and Cam-resistant LB medium.
[0036] (3) Expression and SDS-PAGE identification of carboxylesterase Ces6 Recombinant engineered bacteria were picked from the successfully transformed plates and inoculated into 4 mL of LB liquid medium. The culture was incubated overnight at 37 °C with shaking at 150 rpm. The culture was then transferred 1:100 to a conical flask containing 100 mL of LB liquid medium and incubated at 37 °C with shaking at 225 rpm. Bacterial growth was observed during this period. When the OD600 reached approximately 0.6, IPTG was added to a final concentration of 0.1 mM, and the culture was induced by shaking at 20 °C with shaking at 180 rpm for approximately 20 h. Subsequently, the bacterial cells were collected by centrifugation at 4 °C and 10,000 rpm for 5 min, followed by ultrasonic disruption to obtain the crude carboxylesterase Ces6 enzyme solution. Finally, 12% SDS-PAGE protein electrophoresis was used for verification. The results showed that the crude enzyme solution exhibited distinct protein bands between 25-33 kDa. Figure 1 Lane 1.
[0037] Example 2: Preparation of a carrier material formed by terephthalic acid and cobalt ions In a mixed solution of 50 mL N,N-dimethylformamide and 12.5 mL anhydrous ethanol, 1.15 g of terephthalic acid and 2 g of cobalt hexahydrate were added. The mixture was magnetically stirred for 15 min to ensure homogeneity, then transferred to a 100 °C reactor and reacted for 12 h. After the reaction, the mixture was allowed to cool naturally to room temperature and filtered under vacuum. The resulting solid was washed twice each with N,N-dimethylformamide and anhydrous ethanol to obtain a purplish-red carrier material powder. The results are as follows: Figure 2 As shown; the morphology of this material was observed using a scanning electron microscope (SEM), and the results are as follows. Figure 3 As shown, the material exhibits a regular layered structure; further X-ray photoelectron spectroscopy (XPS) full-spectrum analysis revealed that the support material contains C, O, and Co elements, and no obvious signals from other elements were detected, as shown in the results. Figure 4 As shown above, the results confirm that the target material formed by the coordination of terephthalic acid and cobalt ions has been successfully prepared.
[0038] Example 3: Preparation of one-step purified immobilized carboxylesterase (immobilized enzyme) (1) Weigh 16 mg of the carrier material powder prepared in Example 2, add it to 1 mL of crude carboxylesterase Ces6 enzyme solution (1 mg / mL), vortex to mix, place the mixture in a shaker, and incubate at 35 °C and 150 rpm for 1 hour for immobilization; (2) Centrifuge the incubation solution obtained in step (1) at 10,000 rpm for 5 min, carefully discard the supernatant, and wash the collected precipitate three times with PBS buffer to completely remove unadsorbed enzyme, thus obtaining purified immobilized carboxylesterase. Figure 8 As shown, the morphology of the one-step purified immobilized carboxylesterase prepared in Example 3 is still regular lamellar, consistent with the structural characteristics of the immobilization carrier material used, indicating that the immobilization process did not cause significant changes in the morphology of the material.
[0039] The crude enzyme Ces6 prepared in Example 1, the carrier material prepared in Example 2, and the purified immobilized carboxylesterase prepared in Example 3 were subjected to infrared spectroscopy detection. The results are as follows: Figure 9 As shown in the spectrum, the crude enzyme Ces6 prepared in Example 1 has a characteristic absorption peak at 1642 cm⁻¹, the carrier material prepared in Example 2 has characteristic absorption peaks at 754 cm⁻¹, 1383 cm⁻¹, and 1555 cm⁻¹, and the immobilized carboxylesterase prepared in Example 3 has characteristic absorption peaks at 1642 cm⁻¹, 1555 cm⁻¹, 1383 cm⁻¹, and 754 cm⁻¹, indicating that the crude enzyme Ces6 has been successfully immobilized in the carrier.
[0040] Example 4: SDS-PAGE verification of the purification of carboxylesterase Ces6 To verify the purification effect of the carrier material during the immobilization of Ces6, the immobilized enzyme prepared in Example 3 was eluted with 1 mL of 250 mM imidazole solution, followed by SDS-PAGE protein electrophoresis for verification and analysis. Figure 1 As shown in lane 3, after elution with 250 mM imidazole solution, a single, clear protein band appeared in the range of 25-33 kDa, consistent with the molecular weight of Ces6 (31.41 kDa).
[0041] Example 5: Enzyme activity assay of the carboxylesterase Ces6 expressed in Example 1 and the one-step purified immobilized carboxylesterase prepared in Example 3. Carboxylesterase Ces6 catalyzes the hydrolysis of ester bonds in p-nitrophenol ester substrates, generating p-nitrophenol (pNP), a product with a specific absorption peak at 410 nm. One unit of enzyme activity (U) refers to the amount of enzyme required to release 1 μmol / L of pNP per unit time under the reaction conditions (25 °C and pH 9.0). The standard total reaction system for crude enzyme activity determination is 1 mL, including 10 μL of 1.0 mg / mL enzyme solution, 10 μL of 50 mM p-nitrophenol butyrate (pNPB4), and 980 μL of 50 mM Tris-HCl buffer (pH 9.0). After thorough mixing, the mixture is incubated in a 25 °C water bath for 5 min, and the OD410 value is measured immediately. When comparing the same parameters, the amount of the one-step purified immobilized carboxylesterase in the reaction system is consistent with that of the crude enzyme. The enzyme activity assay of the one-step purified immobilized carboxylesterase is basically performed following the procedure for crude enzyme activity assay. The key adjustment is to place the sample in a centrifuge at 10,000 rpm for 15 s after the reaction has been completed for 5 min, then take the supernatant and transfer it to a glass cuvette, and measure its absorbance at a wavelength of 410 nm.
[0042] Example 6: Optimization of reaction time in the one-step purification and preparation of immobilized carboxylesterase In the one-step purification and synthesis of immobilized carboxylesterase, different immobilization times (0.25, 0.5, 1, 2, 4, and 8 h) were varied by adjusting the time in the isothermal shaker. Other steps followed the procedure described in Example 3, and the enzyme activity of the immobilized enzyme was evaluated using the standard reaction system described in Example 5. Figure 5As shown, the relative enzyme activity of the one-step purified immobilized carboxylesterase gradually increased with prolonged immobilization time, reaching its peak at 1 h. However, when the immobilization time exceeded 8 h, the enzyme activity decreased. This may be due to the saturation limit of the carrier material's adsorption capacity for Ces6, and further extending the incubation time may cause some weakly bound enzymes to detach. Therefore, controlling the immobilization time to 1 h is most suitable, at which point the enzyme loading effect is optimal and the relative enzyme activity is highest.
[0043] Example 7: Optimization of reaction temperature in the one-step purification and preparation of immobilized carboxylesterase In the one-step purification and preparation of immobilized carboxylesterase, different immobilization temperature gradients (5, 15, 25, 35, 45, and 55 °C) were set. The remaining operations followed the procedure in Example 3 for synthesizing the immobilized enzyme, and its enzyme activity was measured using the standard reaction system of Example 4. Figure 6 As shown, the relative enzyme activity of the one-step purified immobilized carboxylesterase significantly increased with increasing temperature. However, when the temperature exceeded 35 °C, the enzyme activity decreased rapidly. This trend indicates that temperature has a significant impact on the adsorption behavior between the enzyme and the carrier material during immobilization. Therefore, 35 °C was selected as the optimal reaction temperature, at which the relative enzyme activity reached its highest level.
[0044] Example 8: Optimization of the ratio of crude carboxylesterase Ces6 protein to carrier mass during the one-step purification and immobilization of carboxylesterase In the one-step purification and immobilized carboxylesterase preparation experiment, the mass ratio of crude Ces6 carboxylesterase protein to carrier was adjusted to different ratios (1:2, 1:4, 1:8, 1:16, 1:24, and 1:32). All other operations followed the procedures outlined in Example 3 for immobilized enzyme preparation, and the enzyme activity was evaluated using the standard reaction system described in Example 4. Figure 7 As shown, the highest enzyme activity recovery rate of the immobilized carboxylesterase Ces6 was achieved when the mass ratio of crude enzyme protein to carrier was 1:16. This result indicates that at this ratio, the adsorption of enzyme molecules by the carrier material reaches an optimal level, facilitating sufficient exposure and effective binding of the active site, thereby maximizing enzyme activity retention. Therefore, the optimal mass ratio of crude enzyme protein to carrier for Ces6 carboxylesterase was determined to be 1:16.
[0045] Example 9: Effect of reaction pH on the activity of crude carboxylesterase Ces6 and one-step purified immobilized carboxylesterase. Using the standard reaction system described in Example 5, the enzyme activities of crude Ces6 enzyme and one-step purified immobilized carboxylesterase were determined at different pH values. The buffer formulations were as follows: 50 mM Sodium citrate Buffer (pH 5.5-7.0); 50 mM Tris-HCl Buffer (pH 7.0-9.0); 50 mM NaH2PO4-NaOH Buffer (pH 9.0-10.5). The enzyme activity at the optimal pH of 9 was taken as 100%, and the relative enzyme activities of the crude enzyme and one-step purified immobilized carboxylesterase in other pH buffers were calculated. The experiment was independently repeated three times, and the measured values were the average of the three independent experimental data. The results showed that the optimal pH for both crude Ces6 enzyme and one-step purified immobilized carboxylesterase was 9.0 (Tris-HCl buffer). The results are shown in [Figure 1]. Figure 10 .
[0046] Example 10: Effect of reaction temperature on the activity of crude enzyme and one-step purified immobilized carboxylesterase Using the standard reaction system described in Example 5, and selecting 50 mM Tris-HCl buffer (pH 9.0), the enzyme activities of crude Ces6 enzyme and one-step purified immobilized carboxylesterase were measured at temperatures ranging from 10 to 65 °C. The enzyme activity at the optimal temperature was taken as 100%, and the relative enzyme activities of crude Ces6 enzyme and one-step purified immobilized carboxylesterase at other temperatures were calculated. The experiment was independently repeated three times, and the average value was taken. The results showed that the optimal temperature for crude Ces6 enzyme was 55 °C, and the optimal temperature for one-step purified immobilized carboxylesterase was increased to 60 °C. (See attached figure). Figure 11 .
[0047] Example 11: Comparison of specific enzyme activities between crude enzyme and one-step purified immobilized carboxylesterase To evaluate the change in enzyme catalytic efficiency before and after immobilization, the enzyme activity of the crude Ces6 enzyme solution and the one-step purified immobilized carboxylesterase was measured three times in parallel under the conditions of pH 9.0 and 25 °C, following the method described in Example 4. The specific enzyme activity (U / mg), i.e., the number of enzyme activity units per milligram of enzyme protein, was calculated. The results showed that the specific enzyme activity of the one-step purified immobilized carboxylesterase was 44.8 U / mg, approximately 88% of the specific enzyme activity of the crude enzyme. Figure 12 As shown in the figure, this indicates that the crude Ces6 enzyme can still maintain high catalytic activity after being immobilized on the carrier material, further confirming the effectiveness of the one-step purification and immobilization method in preserving enzyme activity.
[0048] Example 12: Thermal and pH stability of crude enzyme and one-step purified immobilized carboxylesterase To evaluate the thermostability and pH stability of the crude enzyme and the one-step purified immobilized carboxylesterase, the crude enzyme and the one-step purified immobilized carboxylesterase were first incubated at 55 °C for a certain period of time, and then their residual enzyme activities were measured at pH 9.0 and 25 °C. In addition, the Ces6 crude enzyme was incubated in a pH 9.0 buffer at 4 °C for a period of time, and its residual activity was then detected using a standard reaction system. The activities of the untreated Ces6 crude enzyme and the one-step purified immobilized carboxylesterase were used as 100% controls to calculate the relative residual activities of the crude enzyme and the one-step purified immobilized carboxylesterase under different conditions. The results are shown in the figure. The one-step purified immobilized carboxylesterase exhibited good pH and thermostability. After treatment at pH 9.0 for 48 h, the relative enzyme activity remained above 65%. Figure 13 As shown; after incubation at 55℃ for 94 h, it still retains 47.31% of its initial activity, as indicated. Figure 14 As shown.
[0049] Example 13: Number of times immobilized carboxylesterase can be purified in one step and reused The enzyme activity of the immobilized enzyme was detected in a standard reaction system (the same as in Example 4) at 25 °C and pH 9.0. The enzyme was separated from the reaction solution by centrifugation at 10,000 rpm for 1 min, washed three times with ultrapure water, and the reaction process was repeated. The OD410 value of the supernatant was recorded after each reaction. Using the enzyme activity of the first reaction as 100%, the relative enzyme activity of subsequent reactions was calculated to determine the reusability of the one-step purified immobilized carboxylesterase. The results are as follows: Figure 15 As shown, the immobilized Ces6 crude enzyme exhibits good reusability; after 5 cycles, the residual enzyme activity of the one-step purified immobilized carboxylesterase is over 74%.
[0050] Example 14: One-step purification of the degradation efficiency of immobilized carboxylesterase on dibutyl phthalate The degradation ability of immobilized enzymes on dibutyl phthalate (Dbutyl phthalate) was evaluated using high-performance liquid chromatography (HPLC). First, a 5 mg / L Dbutyl phthalate solution was prepared in methanol and stored at 4°C. The total reaction volume was 10 mL, with three replicates for each time gradient. The experimental group consisted of 200 μL of the prepared Dbutyl phthalate solution and 9.8 mL of the immobilized enzyme solution (1 mg / mL). The reaction was carried out at 30°C and 150 rpm. A control group was incubated under the same conditions with a mixture of 200 μL of Dbutyl phthalate stock solution and 9.8 mL of Tris-HCl buffer (pH 9.0). The total reaction time was 48 h. Every 12 h, 500 μL of sample was taken, and 100 μL of 1 M HCl was added to terminate the reaction. Then, 0.3 g of NaCl solid particles were added to saturate the solution, followed by the addition of an equal volume of n-hexane and shaking for 15 min. After centrifugation at 10,000 rpm for 5 minutes, the solution clearly separated into two layers: an organic phase on top and an aqueous phase on the bottom. The upper organic phase was recovered, filtered through a 0.22 μm organic filter membrane to remove impurities, and then analyzed by high-performance liquid chromatography (HPLC). The results are as follows: Figure 16 As shown, under 30 °C conditions, a one-step purified immobilized carboxylesterase can degrade 67% of dibutyl phthalate within 48 h, demonstrating good application potential in the green degradation of phthalate pollutants.
[0051] The specific embodiments described above are merely preferred examples for fully illustrating the present invention and do not constitute a limitation on the scope of protection of the present invention. Any other corresponding improvements and modifications made based on the technical concept of the present invention are within the scope of protection of the present invention. The scope of protection of the present invention is defined by the appended claims and their equivalents.
[0052] SEQ ID NO:1 Optimized Streptomyces griseus carboxylesterase ces6'Gene sequence: ATGCTGCCGTGGATTCATGCGGCGCGTGTTCCGCGTACCCGTGGTCTGTTTGCGGCGCTGCTGCTGGCGCTGACCGTGCTGGTTGCGCCGGCGACCACCGCGACCGCGGCGGCGCCGGCGGCGGCGGAGGCGACCACCAGCCGTGGCTGGAACGATTATAGCTGCAAACCGAGCGCGGCGCACCCGCGTCCGGTGGTTCTGGTTCACGGTACCTTCGGCAACAGCATCGACAACTGGCTGGTGCTGGCGCCGTACCTGGTTAACCGTGGTTATTGCGTGTTTAGCCTGGATTACGGTCAGCTGCCGGGCGTGCCGTTCTTTCACGGTCTGGGCCCGATTGACAAAAGCGCGGAGCAACTGGACGTGTTCGTTGATAAGGTTCTGGACGCGACCGGTGCGCCGAAAGCGGATCTGGTGGGTCACAGCCAGGGTGGCATGATGCCGAACTACTATCTGAAGTTTCTGGGTGGCGCGGATAAAGTGAACGCGCTGGTTGGTCTGGCGCCGGACAACCACGGTACCACCCTGCTGGGCCTGACCAAGCTGCTGCCGTTCTTTCCGGGCGTTGAAAAATTCATCACCGATACCACCCCGGGCCTGGCGGACCAGATTGCGGGCAGCCCGTTTATTACCAAACTGACCGCGGGTGGCGACACCGTGCCGGGTGTTCGTTACACCGTGATTGCGACCAAATATGATCAGGTGGTTACCCCGTACCGTACCCAATTCCTGGACGGTCCGAACGTGCGTAACGTTCTGCTGCAAGATCTGTGCCCGCTGGACCTGAGCGAGCATGTGGCGATCGGCACCGTTGATCGTATTGCGTTTCATGAAGTTGCGAACGCGCTGGACCCGGCGCGTGCGACCCCGACCACCTGCAGCAGCGTGATTGGCTAA SEQ ID NO:2 Heterologous expression of Streptomyces griseus carboxylesterase Ces6 amino acid sequence: MLPWIHAARVPRTRGLFAALLLALTVLVAPATTATAAAPAAAEATTSRGWNDYSCKPSAAHPRPVVLVHGTFGNSIDNWLVLAPYLVNRGYCVFSLDYGQLPGVPFFHGLGPIDKSAEQLDVFVDKVLDATGAPKADLVGHSQGGMMPNYYLKFLGGADKVNALVGLAPDNHGTTLLGLTKLLPFFPGVEKFITDTTPGLADQIAGSPFITKLTAGGDTVPGVRYTVIATKYDQVVTPYRTQFLDGPNVRNVLLQDLCPLDLSEHVAIGTVDRIAFHEVANALDPARATPTTCSSVIG.
Claims
1. A carboxylesterase, characterized in that, The amino acid sequence of the carboxylesterase Ces6 is SEQ ID NO:
2.
2. A one-step purification and immobilization method for carboxylesterase, characterized in that, The enzyme protein was carboxylesterase Ces6, and the immobilization carrier was an affinity material rich in coordination unsaturated metal sites formed by terephthalic acid and cobalt ions.
3. The one-step purification and immobilization of carboxylesterase as described in claim 2, characterized in that, The morphology of the immobilized carrier is regular sheet-like.
4. The one-step purification and immobilization of carboxylesterase as described in claim 2, characterized in that, Its optimal reaction pH is 9.0 and its optimal reaction temperature is 60 ℃.
5. A method for preparing a one-step purified immobilized carboxylesterase as described in any one of claims 2-4, characterized in that, The method uses carboxylesterase Ces6 as the enzyme protein and an affinity material rich in coordination unsaturated metal sites formed by terephthalic acid and cobalt ions as the immobilization carrier. The immobilization is achieved in one step by the specific binding of the coordination unsaturated metal sites of the affinity material to the His tag of the carboxylesterase protein, thus preparing an immobilized carboxylesterase. The preparation method is applicable to other target proteins with His tags.
6. The method for preparing a one-step purified immobilized carboxylesterase as described in claim 5, characterized in that, Includes the following steps: (1) Take 10-100 mL of N,N-dimethylformamide and 5-20 mL of anhydrous ethanol and mix them evenly to obtain a mixture. Add 0.1-5 g of terephthalic acid and 0.1-5 g of cobalt hexahydrate to the mixture. Place it on a magnetic stirrer and stir for 1-60 min. Pour it into a reaction vessel and react at 60-150 ℃ for 6-18 h. After the reaction is completed, cool it naturally to room temperature. After vacuum filtration, wash the obtained solid twice with N,N-dimethylformamide and anhydrous ethanol to obtain the carrier material formed by terephthalic acid and cobalt ions. (2) Take 2-32 mg of the carrier material powder obtained in step (1) and add it to 1 mL of Ces6 crude enzyme solution with a concentration of 1 mg / mL. Mix it evenly by vortexing and incubate it in a shaker at 5-55 ℃ and 150 rpm for 0.25-8 h to immobilize the enzyme. (3) Centrifuge the incubation solution obtained in step (2) at 10,000 rpm for 5 min, discard the supernatant, and wash the collected precipitate with PBS buffer several times to remove unbound enzymes. The resulting purple-red precipitate is the one-step purified immobilized carboxylesterase.
7. The method for preparing a one-step purified immobilized carboxylesterase as described in claim 6, characterized in that, Includes the following steps: (1) Take 50 mL of N,N-dimethylformamide and 12.5 mL of anhydrous ethanol and mix them evenly to obtain a mixture. Add 1.15 g of terephthalic acid and 2 g of cobalt hexahydrate to the mixture in sequence. Place it on a magnetic stirrer and stir for 15 min. Then pour it into a reaction vessel and react at 100 ℃ for 12 h. After the reaction is completed, cool it naturally to room temperature. After vacuum filtration, the obtained solid is washed twice with N,N-dimethylformamide and anhydrous ethanol in sequence to obtain the carrier material formed by terephthalic acid and cobalt ions. (2) Take 16 mg of the carrier material powder obtained in step (1) and add it to 1 mL of Ces6 crude enzyme solution with a concentration of 1 mg / mL. Mix it evenly by vortexing and incubate it in a shaker at 35 °C and 150 rpm for 1 h to immobilize the enzyme. (3) Centrifuge the incubation solution obtained in step (2) at 10,000 rpm for 5 min, discard the supernatant, and wash the collected precipitate three times with PBS buffer to remove unbound enzymes. The resulting purple-red precipitate is the one-step purified immobilized carboxylesterase.
8. The application of a one-step purified immobilized carboxylesterase according to any one of claims 2-7 in the field of bioremediation of plastic degradation.
9. The application of a one-step purified immobilized carboxylesterase according to any one of claims 2-7 in the degradation of dibutyl phthalate plasticizers.
10. The application of the one-step purified and immobilized carboxylesterase according to claim 9 in the degradation of dibutyl phthalate plasticizers, characterized in that, The mother liquor of dibutyl phthalate was mixed with the purified immobilized carboxylesterase solution, and the reaction mixture was shaken for 0.1-48 h. After the reaction was completed, undegraded dibutyl phthalate was separated. The reaction temperature was 30 °C and the shaking speed was 150 rpm.