A method for immobilizing isomerases with improved stability, the immobilized isomerase, and its applications.

By using the amino-functionalized resin LX-1000EPN to covalently immobilize isomerases, the problem of insufficient stability of immobilized DAEs in existing technologies has been solved, achieving high stability and reusability, making it suitable for the industrial production of D-allulose.

CN122484100APending Publication Date: 2026-07-31ZHEJIANG UNIV OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610463651.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-09
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

Existing immobilized D-allulose-3-epimerase (DAE) suffers from poor stability, low mechanical strength, and low reusability, which limits its industrial application.

Method used

An isomerase was immobilized using amino-functionalized resin LX-1000EPN via covalent bonding. Glutaraldehyde was used as a cross-linking agent to react with the amino resin carrier and the amino groups on the isomerase surface to form covalent bonds, thus preparing the immobilized isomerase.

Benefits of technology

The thermostability and operational stability of the immobilized enzyme have been improved. The immobilized enzyme retains 50% of its activity after incubation at 80°C for 32 hours and maintains 93% of its activity after 50 uses, which is significantly better than existing technologies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses a method for immobilizing isomerases to improve stability, the immobilized isomerase, and its applications. This invention provides a novel amino resin and process for improving the stability of immobilized isomerases. Enzymatic property testing of the immobilized enzyme revealed improved stability in all aspects. Specifically, the immobilized isomerase LX-1000EPN- cb The immobilized enzyme (DAE) exhibits excellent thermal stability, retaining 50% of its activity after incubation at 80°C for 32 hours and still retaining 93% of its activity after 50 uses. This represents a significant improvement in stability compared to previously reported immobilized DAEs. The immobilized enzyme prepared by the method of this invention has great potential for practical applications and opens up new directions for immobilized isomerases, possessing extremely important research and practical value.
Need to check novelty before this filing date? Find Prior Art

Description

(I) Technical Field

[0001] This invention belongs to the fields of biochemical engineering and biocatalysis, specifically relating to a method for immobilizing isomerases to improve stability, the immobilized isomerase, and its applications. (II) Background Technology

[0002] D-allulose is a rare sugar found in nature. It is characterized by low calories and various biological activities. Due to its advantages in regulating blood sugar, protecting oral health, and weight management, it is widely used in the food and medical fields, demonstrating enormous market potential. Industrially, D-allulose is mainly produced through biocatalysis, with D-allulose 3-epimerase (DAE) being the key enzyme catalyzing the conversion of D-fructose to D-allulose. However, free enzymes suffer from poor thermal stability, inadequate operational stability, and lack of reusability, severely limiting their industrial application. Immobilization technology can effectively overcome the shortcomings of free enzymes, making immobilized enzymes the preferred choice for the practical application of D-allulose 3-epimerase. Immobilized enzymes offer advantages such as reusability, high stability, and high mechanical strength, attracting widespread attention from researchers. Commonly used immobilization techniques include physical methods (encapsulation, adsorption) and chemical methods (cross-linking, covalent bonding, etc.). Among them, the covalent bonding method utilizes the covalent bonds formed between the carrier and the enzyme to complete multi-point covalent connections. Compared with the embedding method and the adsorption method, it has the advantages of being less prone to detachment, having a strong connection, and high mechanical strength, and can catalyze reactions under harsh operating conditions.

[0003] Existing methods for immobilizing DAEs suffer from drawbacks such as poor stability, low mechanical strength, and low reusability. In contrast, amino-functionalized resin LX-1000EPN, as a synthetic organic mesoporous polymer, features high mechanical strength, good stability, large enzyme loading capacity, and is easy to separate and reusable. (III) Summary of the Invention

[0004] The purpose of this invention is to provide a method for immobilizing isomerases with improved stability, the immobilized isomerase, and its applications. The immobilized isomerase prepared by the method of this invention has better performance in terms of heat resistance and operational stability than the free enzyme and the existing immobilized D-allulose-3-epimerase.

[0005] The technical solution adopted in this invention is:

[0006] In a first aspect, the present invention provides a method for immobilizing isomerases to improve stability, the method comprising the following steps: mixing an amino resin carrier with an aqueous solution of an aldehyde crosslinking agent, performing a shaking crosslinking reaction, filtering to remove residual crosslinking agent, and obtaining an activated carrier; mixing the activated carrier and isomerase solution evenly, performing an immobilization reaction at 25-30°C, filtering to remove residual enzyme solution, and obtaining an immobilized isomerase; wherein the aldehyde crosslinking agent includes glutaraldehyde.

[0007] Furthermore, the amino resin carrier is LX-1000EPN.

[0008] Furthermore, the volume concentration of the aqueous solution of the aldehyde crosslinking agent is 1-5%, preferably 2%.

[0009] Furthermore, the volume of the aqueous solution of the aldehyde crosslinking agent is 1-4 mL / g based on the mass of the amino resin carrier, preferably 4 mL / g.

[0010] Furthermore, the oscillatory crosslinking is carried out by oscillating at 28°C for 1 hour.

[0011] Furthermore, the isomerase includes D-allulose-3-epimerase, the amino acid sequence of which is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.2.

[0012] Furthermore, the isomerase solution refers to the pure enzyme solution extracted from the wet bacterial cells obtained by inducing culture of recombinant genetically engineered bacteria containing the isomerase encoding gene, after disruption. The recombinant genetically engineered bacteria are prepared by adding a histidine tag to the N-terminus of the isomerase encoding gene and inserting it between the Ncol and Xcol sites of the vector pET28a, before transforming it into... E. coli It is constructed from competent cells of BL21(DE3).

[0013] Furthermore, the protein concentration in the isomerase solution is 6-10 mg / mL (preferably 8 mg / mL), and the amount of isomerase solution used is based on the protein content, which is 10-100 mL / g (preferably 60 mL / g) based on the mass of the amino resin carrier.

[0014] Furthermore, the isomerase solution was prepared as follows:

[0015] (1) The recombinant genetically engineered bacteria were inoculated into LB liquid medium and cultured at 37℃ and 200 r / min for 8-10 h to obtain seed culture; the seed culture was inoculated into LB liquid medium at a volume concentration of 1% and cultured at 37℃ and 200 r / min until OD 600When the concentration reaches 0.6-0.8, add IPTG to a final concentration of 0.01mM, induce culture at 28℃ for 12-14h, and collect wet cells by centrifugation at 8000rpm;

[0016] (2) The wet bacterial cells obtained in step (1) were resuspended in pH 7.0, 50mM phosphate buffer, and sonicated at 240 W for 30 min, with 1 second interval between sonication to obtain cell lysate. The lysate was centrifuged at 12000 rpm for 10 min at 4℃, and the supernatant was taken after removing the precipitate to obtain crude enzyme solution.

[0017] (3) The Ni affinity column (5 mL, Bio-RAD, USA) was washed with ultrapure water until UV baseline equilibrium was reached; then the nickel column was washed with binding buffer (pH 7.0, 50 mM NaH2PO4-Na2HPO4 buffer) at a flow rate of 1 mL / min until UV baseline equilibrium was reached. After that, crude enzyme solution was loaded to ensure that the target protein was fully bound to the nickel column; then, contaminating proteins were washed with binding buffer containing 300 mM NaCl and 500 mM imidazole at a flow rate of 1 mL / min until UV baseline equilibrium was reached; the target protein was eluted with binding buffer containing 300 mM NaCl and 500 mM imidazole. When the absorbance began to rise to 500 mAu, the target protein was collected. When the absorbance dropped to 500 mAu, the collection was stopped. The collected target protein eluent was placed in a container with a molecular weight cutoff of 2000. The enzyme solution was placed in a dialysis bag and dialyzed overnight on ice in ultrapure water to remove excessively high concentrations of salt ions. The choked solution was collected to obtain pure enzyme solution.

[0018] This invention utilizes an amino carrier (LX-1000EPN) covalent bonding method to immobilize an isomerase (allulose-3-epimerase). An aldehyde crosslinking agent with aldehyde groups at both ends is used to activate the amino carrier, resulting in an amino carrier with aldehyde groups at the ends. The amino group on the surface of the isomerase reacts with the aldehyde group at the tail of the amino carrier to form a stable covalent bond, thereby achieving the purpose of immobilization.

[0019] Secondly, the present invention provides an immobilized isomerase prepared by the above-described method.

[0020] Thirdly, the present invention provides an application of the immobilized isomerase prepared by the method described above in the catalytic synthesis of D-allulose from D-fructose.

[0021] Furthermore, the method of application is as follows: using D-fructose as a substrate, immobilized isomerase as a catalyst, and Co... 2+The reaction system was constructed using (CoCl2) as a catalyst and a buffer solution with pH 7.0-9.0 as the reaction medium. The reaction was carried out in a constant temperature metal bath at 60-80℃ to obtain a reaction solution containing D-allulose. After separation and purification, D-allulose was obtained.

[0022] Furthermore, in the reaction system, the concentration of D-fructose is 50-150 g / L (preferably 100 g / L); the amount of immobilized isomerase is 10-100 g / L (preferably 10 g / L); Co 2+ The concentration added is 0.5-1.5 mM (preferably 1 mM).

[0023] Furthermore, the reaction medium was a 50mM PB buffer solution at pH 7.0.

[0024] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0025] This invention provides a novel amino resin and process for improving the stability of immobilized isomerases. Enzymatic property testing (optimal metal ion concentration, optimal reaction temperature, optimal reaction pH, thermal stability, and operational stability) of the immobilized enzyme revealed improved stability in all aspects. Specifically, the immobilized isomerase LX-1000EPN- cb DAE exhibits excellent thermal stability, retaining 50% enzyme activity after incubation at 80°C for 32 hours and still retaining 93% enzyme activity after 50 uses. This represents a significant improvement in stability compared to previously reported immobilized DAEs.

[0026] The immobilized enzyme prepared by the method of this invention has great potential for practical application and opens up a new direction for immobilized isomerases, which has extremely important research and practical value. (iv) Description of the attached drawings

[0027] Figure 1 Immobilized isomerase LX-1000EPN with different ratios of protein and resin cb A bar chart of enzyme activity recovery rate for DAE.

[0028] Figure 2 Immobilized isomerase LX-1000EPN at different immobilization times cb A bar chart of enzyme activity recovery rate for DAE.

[0029] Figure 3 Immobilized isomerase LX-1000EPN under different cross-linking agents cb Bar chart of enzyme activity recovery rate of DAE.

[0030] Figure 4 Immobilized isomerase LX-1000EPN under different metal ion rental conditions cb A bar chart of relative enzyme activity of DAE.

[0031] Figure 5 Immobilized isomerase LX-1000EPN under different temperatures cb A bar chart of relative enzyme activity of DAE.

[0032] Figure 6 Immobilized isomerase LX-1000EPN under different pH conditions cb The relative enzyme activity curve of DAE.

[0033] Figure 7 Immobilized isomerase LX-1000EPN- cb Conversion curves of DAE for substrates of different concentrations.

[0034] Figure 8 Immobilized isomerase LX-1000EPN- under different repeated batches cb DAE conversion rate curve. (V) Detailed Implementation Methods

[0035] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0036] The following examples use amino resin-immobilized isomerases, and the free isomerase described above is the recombinant plasmid pET28a- cb DAE was transformed into E. coli BL21(DE3) for induced expression, followed by disruption and purification. Glutaraldehyde was used as the cross-linking agent.

[0037] Example 1: Preparation of free enzyme solution

[0038] (1) Construction of engineered bacteria: The bacteria derived from Christensenellaceae bacterium of cb The N-terminus of the coding gene of DAE (amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence of the coding gene as shown in SEQ ID NO.2) is linked with a histidine tag, which is then artificially synthesized and transferred into the Ncol and Xcol sites of the vector pET28a to construct the recombinant plasmid pET28a- cb DAE, transferred using thermal shock method E. coli BL21(DE3) was inoculated into LB solid medium containing 50 mg / L kanamycin (KAN) resistance, cultured at 37°C, and positive clones were picked to obtain recombinant genetically engineered bacteria. E. coli BL21(DE3)-pET28a- cb DAE.

[0039] (2) Inoculate the recombinant genetically engineered bacteria from step (1) into 10 mL of LB liquid medium and culture at 37°C and 200 r / min for 8-10 h to obtain the seed culture. Inoculate the seed culture at a volume concentration of 1% into LB liquid medium and culture at 37°C and 200 r / min until OD. 600 When the concentration reaches 0.6-0.8, add IPTG to a final concentration of 0.01mM, induce culture at 28℃ for 12-14h, and collect wet cells by centrifugation at 8000rpm;

[0040] (3) The wet bacterial cells obtained in step (2) were resuspended in 50mM phosphate buffer at pH 7.0 at a concentration of 100 g / L, and sonicated (power 240 W, sonication for 1 second, interval for 1 second, sonication for 30 min) to obtain cell lysate. The lysate was centrifuged at 12000 rpm for 10 min at 4℃, the precipitate was removed, and the supernatant was taken to obtain crude enzyme solution.

[0041] (4) The Ni-NTA affinity chromatography column (5 mL, Bio-RAD, USA) was washed with ultrapure water and monitored with a UV detector until the UV baseline was equilibrated. The nickel column was then washed with binding buffer (pH 7.0, 50 mM NaH2PO4-Na2HPO4 buffer) at a flow rate of 1 mL / min until the UV baseline was equilibrated. The crude enzyme solution was then loaded to ensure that the target protein was fully bound to the nickel column. Then, the contaminating protein was washed with binding buffer containing 300 mM NaCl and 500 mM imidazole at a flow rate of 1 mL / min until the UV baseline was equilibrated. The target protein was then washed with binding buffer containing 300 mM NaCl and 500 mM imidazole to elute the protein. When the absorbance began to increase to 500 mAu, the target protein was collected. When the absorbance decreased to 500 mAu, the collection was stopped. The collected target protein eluent was placed in a dialysis bag with a molecular weight cutoff of 2000 Da and dialyzed overnight on ice in ultrapure water to remove excessively high concentrations of salt ions from the enzyme solution. The cutoff fluid was collected to obtain pure enzyme solution.

[0042] SEQ ID NO.2

[0043] atgaaacacggcatttactacgcctactgggaacagagctgggccgccgactacctgtactacgttgacaaagttgccaaactgggttttgacattctggaaattggggccaccccgctgccggaatatgatcagaaaaccattgcgcagctgcgtgattgtgcaaaaggcaatgggattgagctgaccgccggttacggtccggcaccgcagcacaatgttggtagtacggatcctgcagtgcagaaaggtgcactggagtggtatacccgtctgtttaaagttatggaccagctgaacattcgttggattgggggtgcactgtatctgtattggccggttgattatagcgttccggttaacaaagaagcggattttgcaagcgcagttgcaggtatgaaaaagctgggtgcaattgccgcagattatgggattgatctggggatggagattctgaatcgttttgaaaattacctgctgaataccgcaaaagaaggagtggaatttgtggaacaggtgggactgccgaatgttaaagttatgctggatacctttcatatgaatattgaggaagaatcaatcggtggcgcaatccgtaccgcaggtaaacatctgggtcatctgcataccggtgaatgtaatcgtatggtgccgggtaaaggtcgtaccccttggaaagaaattggtgaagcactgaaagaaattggttacgatggccgtgtggtgatggaaccgtttgttcgtatgggtggtcaggtgggtcaggatgttaaagtgtggcgtgacctgagctgtggagcggatgaagcgaaactggatcaggatgcaaaagaagcactgatttttcagcgttatatgctgggt。

[0044] Example 2: Preparation of Immobilized Isomerase by Covalent Binding of Amino Carrier and Enzyme Activity Detection

[0045] 1. Preparation of Immobilized Enzyme

[0046] (1) Carrier pretreatment: The amino resin LX-1000EPN was thoroughly washed with 50mM PB buffer at pH 7.0 to remove impurities and residues on the resin surface. Then, excess liquid was removed by filtration to ensure that the resin was in a dry state, thus obtaining the pretreated resin, which was ready for subsequent activation treatment.

[0047] (2) Activation of the carrier: 40 mL of 2% (v / v) glutaraldehyde aqueous solution was added to 10 g of the resin pretreated in step (1), and the mixture was stirred at 28 °C and 120 rpm for 60 min for activation. After activation, the resin was separated by filtration and washed with 50 mM PB buffer at pH 7.0 to remove residual glutaraldehyde and other impurities, yielding 10 g of activated carrier LX-1000EPN for later use.

[0048] (3) Immobilization of isomerase: 0.4 g of the activation carrier was added to 3 mL of the pure enzyme solution prepared by the method in Example 1 (protein concentration of 8 mg / mL, enzyme to resin ratio of 60 mg / g), and placed in a 10 mL centrifuge tube. Immobilization reaction conditions: The centrifuge tube was placed in a constant temperature shaking incubator at 28℃ for 12 h. The residue was removed by filtration to obtain 0.4 g of immobilized isomerase (or immobilized DAE enzyme), designated as LX-1000EPN- cb DAE.

[0049] 2. Enzyme activity detection

[0050] The final concentration composition of a 1 mL reaction system was: 100 g / L substrate D-fructose, 0.01 g immobilized DAE enzyme, and 1 mM Co. 2+ The reaction mixture was prepared with CoCl2, pH 7.0, and 50 mM PB buffer. The reaction was carried out in a constant temperature metal bath at 70℃ for 10 min. The reaction solution was diluted with deionized water to a total concentration of 2 g / L for both D-fructose and the target product D-allulose. After filtration through a 0.22 μm water membrane, the filtrate was analyzed by HPLC. A standard curve was constructed based on the peak area and concentration of D-fructose and D-allulose standards under the same conditions to quantitatively analyze the D-fructose and the target product D-allulose in the product.

[0051] Enzyme activity is defined as the amount of enzyme required to catalyze the production of 1 μmol of product D-allulose per minute during a reaction.

[0052] HPLC detection conditions: High performance liquid chromatograph (Thermo Fisher U3000-RID), Sugar-Pak I column, differential refractive index detector, column temperature 80 ℃, mobile phase ultrapure water (0.22 μm water film filtration), flow rate 0.4 mL / min. The retention time of D-fructose was 13.9 min, and the retention time of D-allulose was 19.9 min.

[0053] Example 3: Optimization of immobilization conditions for allulose-3-epimerase

[0054] (1) Optimization of the ratio of immobilized enzyme to resin

[0055] The volume of the pure enzyme solution in Example 2 was varied to control the enzyme-to-resin ratio at 10, 20, 40, 60, 80, and 100 mg / g. The immobilization time was changed to 16 hours, while other operations remained the same. Enzyme activity results are shown below. Figure 1 The results showed that the optimal enzyme-to-resin ratio was 60 mg / g. After immobilization, 97.94% of the enzyme in the solution was immobilized on resin 1000EPN, and the enzyme activity recovery rate was 96.19%.

[0056] (2) Fixed time optimization

[0057] The immobilization time in Example 2 was changed to 2, 4, 6, 8, 10, 12, 18, and 24 hours, with all other operations remaining the same. Enzyme activity results are shown below. Figure 2 The results showed that the optimal immobilization time was 12 hours.

[0058] (3) Optimization of crosslinking agents

[0059] In Example 2, the glutaraldehyde in the cross-linking agent aqueous solution was replaced with no cross-linking agent, genipin, polyethylene glycol diglycidyl ether, glutamin transferase, and formaldehyde, respectively, while other operations remained the same. Enzyme activity results are shown below. Figure 3 The results showed that glutaraldehyde was the most suitable crosslinking agent.

[0060] Example 4: Characterization of the thermal stability of different amino resins

[0061] In Example 2, the amino resin LX-1000EPN was replaced with amino resins LX-1000EA and LX-1000HAA, respectively. All other procedures were the same, and immobilized isomerases were prepared, denoted as LX-1000EA- cb DAE and LX-1000HAA- cb DAE.

[0062] Weigh out LX-1000EPN- cb DAE, LX-1000EA- cb DAE and LX-1000HAA- cb 0.1 g of DAE was transferred to 1.5 mL EP tubes. Simultaneously, 750 µL of purified enzyme solution (protein concentration 8 mg / mL) was added to another EP tube as a free enzyme control group. Immobilized enzyme particles with different amino resins and purified enzyme solutions were heat-treated at 80 °C. Samples were taken at 1, 2, 4, 8, 12, and 24 h, and residual enzyme activity was measured using the method in Example 2. The enzyme activity of the untreated free DAE purified enzyme solution was defined as 100%. The results are shown in Table 1.

[0063] Table 1 Residual enzyme activity under different treatments

[0064]

[0065] As shown in Table 1, LX-1000EPN- cb After heat treatment at 80℃ for 24 hours, DAE still retained 63.93% residual enzyme activity, which is 10 times higher than that of free DAE and significantly better than LX1000-EA- cb DAE, LX-1000HAA- cb Thermal stability of DAE.

[0066] Example 5: Immobilized isomerase LX-1000EPN- cb Characterization of DAE optimal reaction conditions

[0067] 1. Optimal metal ions

[0068] Using the reaction system of step 2 in Example 2, the effects of adding different metal ions and chelating agents on the activity of immobilized isomerase were studied.

[0069] Experimental group: The reaction system of step 2 in Example 2 was used, with the addition of metal ions at a final concentration of 1 mM. Nine divalent / trivalent metal ions (Co) were selected. 2+ Ca 2+ Fe 2+ Ni 2+ Cu 2+ Mg 2+ Zn 2+ Mn 2+ Fe 3+ The other operations are the same.

[0070] EDTA chelating agent intervention group: The reaction system of step 2 in Example 2 was used, with EDTA chelating agent added to a final concentration of 1 mM, and other operations were the same.

[0071] Control group without added reagents: reaction system of step 2 in Example 2.

[0072] The enzyme activity of the control group was set at 100%, and the relative enzyme activities of other groups were measured. The results are shown below. Figure 4 The results showed that the immobilized isomerase LX-1000EPN- cb The optimal metal ion for DAE is Co. 2+ .

[0073] 2. Optimal reaction temperature

[0074] The catalytic properties of immobilized enzymes were studied using a gradient temperature control method. The temperature in step 2 of Example 2 was changed to 60℃, 65℃, 70℃, 75℃, and 80℃, with other operations remaining the same. The relative enzyme activity at other temperatures was calculated with the maximum enzyme activity defined as 100%. The results are shown below. Figure 5 The results showed that the immobilized isomerase LX-1000EPN- cb DAE exhibits its highest enzyme activity at 80℃. However, since high temperatures can cause protein denaturation, leading to a decrease in enzyme activity, 70℃, which still maintains relatively high enzyme activity, was chosen as the temperature for immobilizing the isomerase LX-1000EPN-. cb The optimal reaction temperature for DAE.

[0075] 3. Optimal reaction pH

[0076] The experimental systems were configured according to a pH gradient: 5.0, 5.5, 6.0 (acetic acid-sodium acetate buffer), 6.0, 6.5, 7.0, 7.5, 8.0 (phosphate buffer), 8.0, 8.5, 9.0 (Tris-HCl buffer), and 9.0, 9.5, 10.0 (glycine-sodium hydroxide buffer). The ionic strength of each buffer system was strictly controlled at 0.05 M. In Example 2, the pH of the reaction system in step 2 was changed to 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, and 10.0, respectively. All other operations remained the same. The pH group with the highest enzyme activity was taken as 100%, and the relative enzyme activity of the other groups was calculated. The results are shown in […]. Figure 6 The results showed that the immobilized isomerase LX-1000EPN- cb The optimal reaction pH for DAE is 7.0.

[0077] 4. Optimal substrate concentration

[0078] The concentration of D-fructose substrate in step 2 of Example 2 was changed to 100, 500, and 700 g / L, and samples were taken after reacting in a 70°C water bath for 2, 4, 6, 8, 10, 15, 20, 30, 40, 50, and 60 mins, respectively. The concentration of D-allulose was quantified using HPLC as described in Example 2, and the conversion rate was calculated to determine the reaction equilibrium time. The results are as follows: Figure 7 As shown, catalytic equilibrium was reached fastest at a substrate concentration of 100 g / L, taking 10 minutes to reach equilibrium.

[0079] Example 6: Immobilized enzyme LX-1000EPN- cb Characterization of the thermal stability of DAE and free DAE

[0080] The pure enzyme solution (free enzyme DAE) with a protein content of 6 mg prepared in Example 1 was mixed with 0.1 g of immobilized enzyme LX-1000EPN prepared by the method in Example 2. cb DAE was placed in an 80℃ water bath for 1, 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 42, and 48 h, respectively. After sampling, the residual enzyme activity was measured under the optimal reaction conditions determined in Example 5. The enzyme activity measured in the untreated pure enzyme solution was recorded as 100%. The half-lives of the free and immobilized enzymes under the above 80℃ conditions were measured, and the results are shown in Table 2. After incubation at 80℃ for 32 h, 50% of the enzyme activity was retained. The half-life of the immobilized DAE was 8 times longer than that of the free DAE.

[0081] Table 2 Half-life

[0082]

[0083] Example 7, Immobilized enzyme LX-1000EPN- cb Characterization of DAE operational stability

[0084] The final concentration composition of the 1 mL catalytic reaction system was: 50 mM PB buffer (pH 7.0), 100 g / L D-fructose, and 1 mM Co. 2+ (CoCl2) and 0.1 g of the immobilized enzyme LX-1000EPN- prepared by the method in Example 2 cb DAE was performed in a metal bath at 70°C and 1000 rpm for 10 min. After the reaction, samples were taken for enzyme activity and conversion rate detection using the method in Example 2. Subsequently, the reaction solution was aspirated by centrifugation or filtration, and the immobilized enzyme was thoroughly washed with PB buffer to remove residual substrate and product, and the immobilized enzyme was recovered. The operational stability of the immobilized enzyme was evaluated using a batch-cycle reaction mode: the recovered immobilized enzyme after each round of reaction was transferred to a fresh reaction system for the next round of catalytic reaction. After 50 consecutive reuses, 93% of the enzyme activity remained, and the conversion rate of the immobilized enzyme remained stable within 10 min without significant decrease, maintaining above 31%. The results are shown in [Figure number missing]. Figure 8 .

[0085] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for immobilizing isomerases to improve stability, characterized in that, The method includes the following steps: mixing an amino resin carrier with an aqueous solution of an aldehyde crosslinking agent, performing a shaking crosslinking reaction, filtering to remove residual crosslinking agent, and obtaining an activated carrier; mixing the activated carrier and isomerase solution evenly, performing an immobilization reaction at 25-30℃, filtering to remove residual enzyme solution, and obtaining an immobilized isomerase; the aldehyde crosslinking agent includes glutaraldehyde.

2. The method as described in claim 1, characterized in that, The amino resin carrier is LX-1000EPN.

3. The method as described in claim 1, characterized in that, The volume concentration of the aldehyde crosslinking agent aqueous solution is 1-5%, and the volume of the aldehyde crosslinking agent aqueous solution used is 1-4 mL / g based on the mass of the amino resin carrier.

4. The method as described in claim 1, characterized in that, The isomerase solution refers to the pure enzyme solution extracted after the wet bacterial cells obtained by inducing culture of recombinant genetically engineered bacteria containing the isomerase encoding gene are broken; the isomerase includes D-allulose-3-epimerase, the amino acid sequence of the D-allulose-3-epimerase is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.

2.

5. The method as described in claim 1, characterized in that, The protein concentration in the isomerase solution is 6-10 mg / mL, and the amount of isomerase solution used is based on the protein content, which is 10-100 mL / g based on the mass of the amino resin carrier.

6. The method as described in claim 1, characterized in that, The isomerase solution was prepared as follows: (1) The recombinant genetically engineered bacteria were inoculated into LB liquid medium and cultured at 37℃ and 200r / min for 8-10h to obtain seed culture; The seed culture was inoculated into LB liquid medium at a volume concentration of 1% and cultured at 37°C and 200 rpm until OD reached. 600 When the concentration reaches 0.6-0.8, add IPTG to a final concentration of 0.01mM, induce culture at 28℃ for 12-14h, and collect wet cells by centrifugation at 8000rpm; (2) The wet bacterial cells obtained in step (1) were resuspended in pH 7.0, 50mM phosphate buffer, and sonicated at 240 W for 30 min, with 1 second interval between sonication to obtain cell lysate. The lysate was centrifuged at 12000 rpm for 10 min at 4℃, and the supernatant was taken after removing the precipitate to obtain crude enzyme solution. (3) Clean the Ni affinity column with ultrapure water until the UV baseline is balanced; The nickel column was then rinsed with binding buffer at a flow rate of 1 mL / min until UV baseline equilibration. The crude enzyme solution was then loaded to ensure complete binding of the target protein to the nickel column. Next, contaminating proteins were rinsed with binding buffer containing 300 mM NaCl and 500 mM imidazole at a flow rate of 1 mL / min until UV baseline equilibration. The target protein was then eluted with binding buffer containing 300 mM NaCl and 500 mM imidazole. Collection of the target protein began when the absorbance reached 500 mAu and stopped when it dropped to 500 mAu. The collected target protein eluent was placed in a dialysis bag with a molecular weight cutoff of 2000 Da and dialyzed overnight on ice in ultrapure water to remove excessively high concentrations of salt ions from the enzyme solution. The cutoff fluid was collected to obtain pure enzyme solution. The binding buffer was a pH 7.0, 50 mM NaH₂PO₄-Na₂HPO₄ buffer.

7. An immobilized isomerase prepared by the method of claim 1.

8. The application of an immobilized isomerase prepared by the method of claim 1 in the catalytic synthesis of D-allulose from D-fructose.

9. The application as described in claim 8, characterized in that, The application method is as follows: using D-fructose as a substrate, immobilized isomerase as a catalyst, and Co... 2+ The reaction system was constructed using a buffer solution with pH 7.0-9.0 as a catalyst and reacted in a constant-temperature metal bath at 60-80℃ to obtain a reaction solution containing D-allulose. The solution was then separated and purified to obtain D-allulose.

10. The application as described in claim 9, characterized in that, In the reaction system, the concentration of D-fructose added is 50-150 g / L; the amount of immobilized isomerase added is 10-100 g / L; Co 2+ The concentration added is 0.5-1.5 mM.