Lysosomal-targeted chimeras for degrading nucleic acids, methods of making and using the same

CN122484130BActive Publication Date: 2026-09-15CHONGQING MEDICAL UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202610991940.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-07-06
Publication Date
2026-09-15
Estimated Expiration
2046-07-06

AI Technical Summary

Technical Problem

[0005]为克服现有核酸清除技术缺乏特异性,无法区分致病核酸与生理性核酸,且稳定性差、毒性大;以及现有LYTAC技术受限于其结合配体,仅能降解蛋白质,无法扩展至核酸靶点等问题

Benefits of technology

[0045] 1. Existing LYTAC technologies primarily rely on antibodies or protein-binding domains to recognize protein targets. Due to the fundamental differences in chemical properties and spatial structure between nucleic acids and proteins, existing technologies cannot be directly applied to nucleic acids. This invention creatively designs a double-stranded chimera composed of an aptamer (for recognizing membrane proteins) and a nucleic acid-binding sequence (for recognizing target nucleic acids), successfully extending the LYTAC mechanism from the protein domain to the nucleic acid domain. This invention fills the gap in LYTAC technology within the field of nucleic acid degradation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122484130B_ABST
    Figure CN122484130B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a lysosome-targeting chimera for degrading nucleic acid and a preparation method and application thereof. The lysosome-targeting chimera is covalently connected by a first nucleic acid segment and a second nucleic acid segment; wherein the first nucleic acid segment comprises an aptamer sequence targeting a cell membrane surface receptor protein; the second nucleic acid segment comprises a nucleic acid binding sequence complementary to a target nucleic acid. The aptamer sequence and the nucleic acid binding sequence are covalently connected by base complementary pairing of a chimera hybridization sequence to obtain the lysosome-targeting chimera. The chimera can simultaneously bind the cell membrane surface receptor protein and the target nucleic acid, and mediate endocytosis of the target nucleic acid into the cell lysosome for degradation. The application has a broad application prospect in the treatment of tumors, autoimmune diseases and infectious diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a lysosomal targeted chimera for degrading nucleic acids, its preparation method, and its application. Background Technology

[0002] Extracellular free nucleic acids and cell membrane surface nucleic acids play crucial roles in tumors, autoimmune diseases, and infectious diseases. For example, ctDNA can serve as a biomarker for tumor liquid biopsies and participate in tumor metastasis, while membrane surface RNA can mediate intercellular communication and regulate immune responses. However, there is currently a lack of technologies capable of specifically recognizing and efficiently clearing these nucleic acid targets. Existing clearance strategies mainly rely on non-specific nucleases (such as DNase I) or cationic nanomaterials, both of which have significant technical drawbacks. Specifically, non-specific nucleases have extremely short half-lives in the plasma environment, are easily inhibited by plasma proteins, and lack target specificity, easily damaging physiological nucleic acids while degrading pathogenic nucleic acids, leading to off-target effects. While cationic nanomaterials possess a certain binding capacity, their biodistribution in vivo is poor, easily accumulating in large quantities in the liver, and carrying potential cytotoxic risks. In summary, existing nucleic acid clearance technologies are insufficient to meet the needs of precision clinical treatment in terms of specificity, stability, and safety. There is an urgent need in this field for a novel nucleic acid clearance platform that can achieve cell or tissue-specific, efficient degradation, and controllable safety.

[0003] Lysosome-targeting chimeras (LYTACs), as an emerging targeted protein degradation technology, utilize bifunctional molecules that bind to target proteins at one end and to lysosomal targeting receptors (such as CI-M6PR or ASGPR) on the cell surface at the other end. This mediates receptor-dependent endocytosis of the target protein, ultimately transporting it to lysosomes for degradation. For example, Bertozzi et al. first reported the use of M6P glycopeptide-based LYTACs for degrading membrane proteins such as EGFR and PD-L1. Another example is the patent CN120966826A, which reports a LYTAC molecule targeting GPC3 degradation, composed of a TfR1-targeting aptamer and a GPC3-targeting aptamer. This LYTAC molecule can simultaneously bind to both TfR1 and GPC3 proteins on the cell membrane. It utilizes the endocytosis of TfR1 to bring GPC3 protein into the cell and induces GPC3 degradation via the lysosomal pathway, thereby inhibiting the proliferation and migration of liver cancer cells and achieving liver cancer treatment. For example, patent CN120554529A reports a lysosomal-targeting chimera based on Sortilin, comprising a ligand molecule of a lysosomal-targeting receptor linked by a linker and a ligand molecule targeting a protein to be degraded; wherein the lysosomal-targeting receptor is Sortilin, the ligand molecule of the lysosomal-targeting receptor is a polypeptide targeting Sortilin; and the protein to be degraded is a membrane protein or an extracellular protein. This invention functionally conjugates the Sortilin-binding ligand neurotensin with a neutralizing antibody or polypeptide targeting an overexpressed protein in tumors or inflammatory diseases, demonstrating good therapeutic gains in malignant solid tumors and psoriasis models.

[0004] While LYTAC technology has shown great potential in protein degradation, there are significant technological gaps in its application to nucleic acid degradation. Due to the fundamental differences between nucleic acids and proteins in their chemical properties, spatial structure, and binding ligands, existing LYTAC platforms typically rely on antibodies or protein-binding domains as recognition ligands, failing to recognize and bind to nucleic acid targets. Furthermore, there are currently no reports on the degradation of cell membrane surface or extracellular nucleic acids using the LYTAC mechanism, and existing LYTAC technology cannot address the issues of specific capture and lysosomal guidance of nucleic acid targets. Therefore, developing a novel nucleic acid degradation technology that overcomes the non-specific defects of existing nucleases and the limitations of current LYTAC technology is of great significance. Summary of the Invention

[0005] To overcome the shortcomings of existing nucleic acid clearance technologies, such as lack of specificity (inability to distinguish between pathogenic and physiological nucleic acids), poor stability, and high toxicity; and the limitations of existing LYTAC technology, which is restricted by its binding ligands and can only degrade proteins, thus failing to extend to nucleic acid targets, this invention proposes a lysosomal targeted chimera for nucleic acid degradation, its preparation method, and its application, filling a technological gap in the field of nucleic acid-LYTAC.

[0006] One of the objectives of this invention is to provide a lysosomal targeted chimera for degrading nucleic acids.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] A lysosome-targeting chimera for degrading nucleic acids, wherein the lysosome-targeting chimera is covalently linked from a first nucleic acid fragment and a second nucleic acid fragment;

[0009] The first nucleic acid fragment contains an aptamer sequence targeting a cell membrane surface receptor protein, the nucleotide sequence of which is shown in SEQ ID NO.1;

[0010] The second nucleic acid fragment contains a nucleic acid binding sequence that is complementary to the target nucleic acid, and its nucleotide sequence is shown in SEQ ID NO.2 or SEQ ID NO.5.

[0011] Preferably, the cell membrane surface receptor protein includes one or more of IGFIIR, ASGPR, and Transferrin Receptor; the target nucleic acid includes cell membrane surface nucleic acid or extracellular free nucleic acid.

[0012] More preferably, the target nucleic acid includes any one or more of FNDC3B, U3, U35, and Y5.

[0013] Preferably, the first nucleic acid fragment further includes linker 1, and the second nucleic acid fragment further includes linker 2; the aptamer sequence and the nucleic acid binding sequence are covalently linked through complementary base pairing of Linker 1 and Linker 2 to obtain the lysosome-targeting chimera.

[0014] Preferably, the linker length is 23bp.

[0015] Preferably, the nucleotide sequence of Linker 1 is as shown in the underlined portion of SEQ ID NO.1: TGACTGATT TACG GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC.

[0016] Preferably, the nucleotide sequence of Linker 2 is as shown in the underlined portion of SEQ ID NO.2 or SEQ ID NO.5;

[0017] SEQ ID NO.2: CGTAAATCAGTCATTATCAGGCT ACTACAGATGTTGCCAAGGA AGCCTGATAA ;

[0018] SEQ ID NO.5: CGTAAATCAGTCATTATCAGGCT ACTACAGATGTTGCCAAGGAACTCCCCAATACGGAGAGAAGAGACCATCGTGAGATAAGGGGAGACAATGTTAAATC AGCCTGATAA .

[0019] Preferably, the 5' end of the first nucleic acid fragment is phosphorylated.

[0020] In this invention, the aptamer sequence and the nucleic acid binding sequence are interconnected by a linker sequence, enabling the chimera to simultaneously bind to cell membrane surface receptor proteins and target nucleic acids, and mediate the internalization of the target nucleic acid into lysosomes for degradation.

[0021] The second objective of this invention is to provide a method for preparing the aforementioned lysosome-targeting chimera.

[0022] To achieve the above objectives, the present invention adopts the following technical solution:

[0023] The aforementioned method for preparing the lysosomal targeting chimera includes the following steps:

[0024] S1: Phosphorylate the 5' end of the first nucleic acid fragment to obtain a phosphorylated first nucleic acid fragment;

[0025] S2: The phosphorylated first nucleic acid fragment obtained from S1 and the hybridization sequence in the second nucleic acid fragment are covalently linked by complementary hybridization under the action of T4 DNA ligase to form a lysosomal targeting chimera.

[0026] Preferably, in S1, the reaction system includes: 8-12 µL of the first nucleic acid fragment, 0.5-2 µL of T4 kinase, 1-3 µL of reaction buffer, 0.5-2 µL of ATP and 5-8 µL of DEPC water, for a total of 20 µL; the reaction conditions are constant temperature incubation at 37±5℃ for 2-5 h.

[0027] More preferably, in S1, the concentration of the first nucleic acid fragment in the reaction system is 80-120µM, more preferably 100µM.

[0028] More preferably, in S1, the reaction system includes: 10µL 100µM first nucleic acid fragment, 1µL T4 kinase, 2µL Reaction Buffer A (10X), 1µL 10mM ATP, 6µL DEPC water, for a total of 20µL.

[0029] More preferably, in S1, the reaction conditions are constant temperature incubation at 37°C for 3 hours.

[0030] More preferably, after the S1 incubation is completed, the reaction is carried out at 90~100℃ for 5~20 min and then placed on ice for 5~20 min; more preferably, the reaction is carried out at 95℃ for 10 min and then placed on ice for 10 min.

[0031] More preferably, the concentration of the first nucleic acid fragment phosphorylated at the 5' end obtained in S1 is 40~60µM, more preferably 50µM.

[0032] Preferably, before the S1 reaction, the nucleic acid dry powder is dissolved in DEPC water to a suitable concentration.

[0033] Preferably, in S2, the reaction system includes: 40-50µL of the first nucleic acid fragment, 40-50µL of the second nucleic acid fragment, 1-3µL of T4 DNA ligase, and 8-12µL of ligation buffer, for a total of 100µL; the reaction conditions are room temperature ligation for 2-5 hours.

[0034] More preferably, in the S2 reaction system, the concentration of the first nucleic acid fragment is 15~25µM, more preferably 20µM.

[0035] More preferably, in the S2 reaction system, the concentration of the second nucleic acid fragment is 15~25µM, more preferably 20µM.

[0036] More preferably, in the S2 reaction system, the ligation buffer is 10×.

[0037] More preferably, in S2, the reaction system includes: 44µL 20µM first nucleic acid fragment, 44µL 20µM second nucleic acid fragment, 2µL T4 DNA ligase, 10µL 10× ligation buffer, for a total of 100µL.

[0038] More preferably, in S2, the reaction condition is room temperature connection for 3 hours.

[0039] More preferably, after the S2 connection is completed, heat at 90~100℃ for 5~20 minutes and let stand on ice for 5~20 minutes; more preferably, heat at 95℃ for 10 minutes and let stand on ice for 10 minutes.

[0040] Preferably, before the S2 reaction, the phosphorylated solutions of the first and second nucleic acid fragments are diluted to an appropriate concentration using PBS.

[0041] A third objective of this invention is to provide the application of the aforementioned lysosome-targeting chimera in the preparation of a drug for degrading nucleic acids; and / or the application of the aforementioned lysosome-targeting chimera in the preparation of an anti-liver cancer drug.

[0042] Preferably, the nucleic acid is extracellular free nucleic acid and / or cell membrane surface nucleic acid.

[0043] Preferably, the aforementioned lysosome-targeting chimera is used in the preparation of a drug for inhibiting the proliferation of liver cancer cells.

[0044] The beneficial effects of this invention are as follows:

[0045] 1. Existing LYTAC technologies primarily rely on antibodies or protein-binding domains to recognize protein targets. Due to the fundamental differences in chemical properties and spatial structure between nucleic acids and proteins, existing technologies cannot be directly applied to nucleic acids. This invention creatively designs a double-stranded chimera composed of an aptamer (for recognizing membrane proteins) and a nucleic acid-binding sequence (for recognizing target nucleic acids), successfully extending the LYTAC mechanism from the protein domain to the nucleic acid domain. This invention fills the gap in LYTAC technology within the field of nucleic acid degradation.

[0046] 2. The lysosome-targeting chimera of the present invention relies on the lysosomal degradation pathway and can effectively degrade extracellular free nucleic acids and cell membrane surface nucleic acids. As shown in Example 2, the lysosome-targeting chimera (NHALytacs chimera) of the present invention can degrade maxFNDC3B RNA on the cell membrane surface when treated with Hep3B cells; as shown in Example 3, the lysosome-targeting chimera of the present invention can effectively degrade extracellular free FNDC3B oligos; the chloroquine (lysosome inhibitor) experiment further confirmed that the lysosome-targeting chimera of the present invention degrades through the endocytosis-lysosome pathway, rather than simple enzymatic digestion, thereby achieving a more thorough and sustained clearance effect.

[0047] 3. This invention significantly improves the stability of chimeras in complex biological environments by optimizing the linker length.

[0048] 4. This invention achieves simultaneous degradation of multiple target nucleic acids by a single molecule through the design of multivalent binding sequences. As shown in Example 4, the nucleic acid binding terminus of the Multi-NHALytac chimera integrates antisense sequences targeting four different RNAs: FNDC3B, U3, U35, and Y5. This significantly reduces the expression levels of these four target RNAs on the cell membrane surface and their extracellular free concentrations. This multi-target characteristic is of great significance for treating complex diseases driven by multiple nucleic acids (such as advanced tumors and autoimmune diseases), improving the breadth and efficiency of treatment.

[0049] 5. The lysosome-targeting chimera of the present invention exhibited good biocompatibility and significant therapeutic effects in animal models. Example 5 experiments showed that the NHALYtacs chimera could effectively inhibit the growth of subcutaneous tumors constructed from Hep3B cells, significantly reduce the expression of maxFNDC3B nucleic acid on the surface of Hep3B subcutaneous tumor cell membranes, and simultaneously reduce the Ki-67 positivity rate of subcutaneous tumors. Attached Figure Description

[0050] Figure 1 Figure 1 shows the experimental results of the synthesis and linker length screening of NHALytacs chimeras. Figure 2a is a schematic diagram of the NHALytacs chimera synthesis strategy, showing the linking methods of different linker lengths (0 bp, 10 bp, and 23 bp). Figure 3b is an agarose gel electrophoresis diagram of the synthesis results of NHALytacs chimeras, with the three lanes corresponding to NHALytacs chimeras containing different linker lengths (0 bp, 10 bp, and 23 bp). Figure 4c is a stability analysis diagram of NHALytacs chimeras with different linker lengths (0 bp, 10 bp, and 23 bp) after incubation at 37°C for different times (0, 1, 2, 3, 4, 6, 8, 10, 12, and 24 h) in DMEM complete medium containing 10% fetal bovine serum. The agarose gel electrophoresis results show that chimeras containing 23 bp linker lengths are the most stable. Linker's NHA Lytacs chimera exhibits higher stability in DMEM complete medium containing 10% fetal bovine serum; Figure d is a statistical analysis of the gel electrophoresis results in Figure c.

[0051] Figure 2Figure 1 shows the results of validating the effect of NHALytacs chimera on the degradation of FNDC3B RNA on the cell membrane surface of Hep3B cells. Figure 2a shows the statistical analysis of the relative content of maxFNDC3B RNA on the cell membrane surface after treating Hep3B cells with different treatment groups (blank group, 500 nM NHALytac-IGFIIRap, 500 nM NHALytac-FNDC3B, and 500 nM NHALytacs) for 24 h. Figure 3b shows the statistical analysis of the degradation efficiency of maxFNDC3B RNA on the cell membrane surface after treating Hep3B cells with different concentrations (0, 31.25, 62.5, 125, and 500 nM) of NHALytacs chimera for 24 h. Figure 4c shows the degradation efficiency of maxFNDC3B RNA on the cell membrane surface of Hep3B cells after treating Hep3B cells with 500 nM NHALytacs chimera for different time periods (0, 3, 6, 12, and 24 h). The graph shows the statistical analysis of RNA degradation efficiency; Figure d shows the results of HCR in situ imaging detection of the expression of maxFNDC3B RNA on the surface of Hep3B cell membrane after treatment with different treatment groups (no treatment, 500 nM NHALytac-IGFIIRap, 500 nM NHALytac-FNDC3B, 500 nM NHALytacs); Figure e is a statistical graph of the HCR in situ imaging results in Figure d, with a scale bar of 10 μm.

[0052] Figure 3 Figure 1 shows the results of verifying the effect of NHALytacs chimera on degrading extracellular free nucleic acids. Figure 2 shows the fluorescence intensity of free FNDC3B-FAM in the cell supernatant after co-incubating 500 nM NHALytacs chimera with 10 nM FNDC3B-FAM oligonucleotide for different times. Figure 3 shows the fluorescence intensity of free FNDC3B-FAM in the cell supernatant after co-incubating different concentrations of NHALytacs chimera with 10 nM FNDC3B-FAM oligonucleotide for 24 h. Figure 4 shows the co-localization of FNDC3B-FAM oligonucleotide (green fluorescence) and Lyso-Tracker labeled lysosomes (red fluorescence) observed under a fluorescence microscope. The scale bar is 10 μm.

[0053] Figure 4Figures show the experimental results related to the multiplex degradation of target nucleic acids by the MultiNHALytacs chimera. Figure a shows a schematic diagram of the MultiNHALytacs chimera structure, whose nucleic acid binding region is specially designed to contain antisense sequences of multiple target RNAs (maxFNDC3B, maxU3, maxU35, and maxY5), enabling it to bind multiple target nucleic acids simultaneously. Figure b shows the results of in situ chemiluminescence imaging (HCR) of the expression of maxY5 RNA on the cell membrane surface of Hep3B cells after treatment with 500 nM MultiNHALytacs chimera for 24 h. Figure c is a statistical graph corresponding to the HCR in situ imaging results in Figure b. Figure d is a statistical graph of the relative content of target RNA maxU3 on the cell membrane surface of Hep3B cells after treatment with 500 nM MultiNHALytacs chimera for 24 h. Figure e shows the results of treatment with 500 nM MultiNHALytacs chimera for 24 h. Figure 1 shows the relative content of target RNA maxU35 on the cell membrane surface after h; Figure 2 shows the relative content of target RNA maxY5 on the cell membrane surface after Hep3B cells were treated with 500 nM MultiNHALytacs chimera for 24 h; Figure 3 shows the relative content of target RNA maxFNDC3B on the cell membrane surface after Hep3B cells were treated with 500 nM MultiNHALytacs chimera for 24 h; Figure 4 shows the fluorescence intensity of free target oligonucleotides in the cell supernatant after co-incubation of 500 nM MultiNHALytacs chimera with 10 nM target oligonucleotide U3-FAM for different times; Figure 5 shows the fluorescence intensity of free target oligonucleotides in the cell supernatant after co-incubation of 500 nM MultiNHALytacs chimera with 10 nM target oligonucleotide U3-FAM for different times; Figure 6 shows the fluorescence intensity of free target oligonucleotides in the cell supernatant after co-incubation of 500 nM MultiNHALytacs chimera with 10 nM target oligonucleotide U35-FAM for different times; Figure 7 shows the fluorescence intensity of free target oligonucleotides in the cell supernatant after co-incubation of 500 nM MultiNHALytacs chimera with 10 nM target oligonucleotide U35-FAM for different times; Figure 8 shows the fluorescence intensity of free target oligonucleotides in the cell supernatant after co-incubation of 500 nM MultiNHALytacs chimera with 10 nM target oligonucleotide U35-FAM for different times. The fluorescence intensity of free target oligonucleotides in the cell supernatant after co-incubation of nM target oligonucleotide Y5-FAM for different times; Figure k shows the fluorescence intensity of free target oligonucleotides in the cell supernatant after co-incubation of 500 nM MultiNHALytacs chimera and 10 nM target oligonucleotide FNDC3B-FAM for different times.

[0054] Figure 5The following figures illustrate the therapeutic efficacy evaluation of NHALYtacs chimeras in a nude mouse subcutaneous tumor model: Figure a shows the establishment of the nude mouse subcutaneous tumor model and the drug administration regimen; Figure b shows the weight change curves of each group of nude mice during the drug administration period; Figure c shows the subcutaneous tumor growth curves of each group of nude mice; Figure d shows a photograph of the dissected tumor at the drug administration endpoint; Figure e shows a statistical chart of tumor weight; and Figure f shows the H&E staining results of the major organs (heart, liver, spleen, lung, and kidney) of each group of nude mice, with a scale bar of 50 μm.

[0055] Figure 6 The figure shows the results of detecting the effect of NHALYtacs chimera on the expression of maxFNDC3B RNA on the cell membrane surface in subcutaneous tumor tissue of nude mice.

[0056] Figure 7 This is a semi-quantitative statistical analysis of the fluorescence intensity of maxFNDC3B RNA in subcutaneous tumor tissues of nude mice in each group.

[0057] Figure 8 The results of the detection of the effect of NHALYtacs chimera on the proliferative activity of subcutaneous tumors in nude mice are shown in Figure a. Figure a shows the Ki-67 immunohistochemical staining results of subcutaneous tumor tissue sections of nude mice in each group. Figure b shows the statistical analysis results of the Ki-67 positive rate in subcutaneous tumor tissues of nude mice in each group. The scale bar is 10 μm.

[0058] In the above figures, ns indicates P>0.05, with no significant difference; * indicates P≤0.05; ** indicates P≤0.01; *** indicates P≤0.001; **** indicates P≤0.0001. Detailed Implementation

[0059] The technical solution of the present invention will be described more clearly and completely below with reference to specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Therefore, based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the protection scope of the present invention.

[0060] To enhance understanding of the present invention, certain key technical and scientific terms will be clearly defined below. Unless otherwise specified herein, all other technical and scientific terms shall follow their generally accepted and understood meanings within the art to which this invention pertains. It should be noted that the terminology used herein is intended to describe specific embodiments and not to be construed as limiting.

[0061] Lysosome-targeting chimeras (LYTACs) are bifunctional molecules composed of a target protein-binding domain and a lysosome-targeting receptor-binding domain linked by a chemical linker. The target protein-binding domain, typically an antibody, nanobody, or small molecule ligand, is responsible for specifically recognizing and binding to the target protein; the lysosome-targeting receptor-binding domain is responsible for binding to lysosomal transport receptors on the cell surface. LYTACs utilize the endocytosis-lysosome pathway to effectively degrade secreted proteins and membrane proteins, overcoming the limitations of traditional PROTAC technology, which is primarily limited to intracellular protein degradation. This invention primarily provides a nucleic acid-based lysosome-targeting chimera molecule that transports the bound target nucleic acid to lysosomes for degradation via an aptamer-mediated membrane protein endocytosis mechanism.

[0062] Extracellular free nucleic acids (cfRNAs), also known as circulating free nucleic acids, refer to nucleic acid fragments that exist in human body fluids such as blood, urine, and cerebrospinal fluid in a free state and are not encapsulated within intact cells, including circulating tumor DNA (ctDNA) and glycoRNA.

[0063] Plasma membrane-associated RNA (pmRNA or maxRNA) generally refers to RNA molecules that can be stably localized on the outer surface of the plasma membrane of eukaryotic cells. These RNAs (such as U3, U35, and Y5 RNA) are usually anchored to the outer side of the cell membrane in the form of RNA-protein complexes via specific membrane receptors (such as integrins and adhesion molecules) and are not rapidly degraded by extracellular RNases. maxFNDC3B (membrane-associated FNDC3B mRNA) is one of the more thoroughly studied pro-cancer membrane surface RNAs. It is highly expressed in malignant tumors such as liver cancer and can enhance the migration, invasion, and metastasis of tumor cells by promoting cell-ECM interactions, and is associated with poor prognosis. Unlike intracellular RNA, maxFNDC3B is exposed extracellularly and can be specifically recognized and bound by aptamers or chimeric nucleic acid conjugates, making it an important potential target for developing novel "extracellular targeted" nucleic acid degradation strategies (such as LYTAC and nucleic acid-LYTAC chimeras).

[0064] An aptamer is a single-stranded oligonucleotide (DNA or RNA) with a specific three-dimensional spatial conformation, obtained through in vitro exponential enrichment of ligands using the Systematic Evolution of Ligands (SELEX) technique. It can bind to specific target molecules with high affinity and high specificity through non-covalent interactions. This invention specifically refers to nucleic acid sequences used to recognize and bind to cell membrane surface receptor proteins (such as IGFIIR).

[0065] IGFIIR (insulin-like growth factor II receptor, IGF2R) is a type I transmembrane protein belonging to the lysosomal enzyme receptor superfamily. The main function of IGFIIR is to clear and degrade IGF-II; it does not transmit growth-promoting signals. It has no kinase activity and is involved in lysosomal targeting, M6P receptor-mediated lysosomal enzyme transport, and potential anti-cancer effects.

[0066] In this embodiment of the invention, the NHALYTacs chimera consists of two parts: i) NHALYTac-IGFIIRap, which mainly includes an aptamer sequence and a chimeric hybridization sequence. The aptamer sequence, after annealing, can fold to form a specific structure, thereby possessing specific recognition capabilities. In this embodiment, the aptamer sequence targets the common membrane protein IGFIIR. The chimeric hybridization sequence can be adjusted in length according to actual needs, for example, 0bp, 10bp, and 23bp in this embodiment. ii) NHALYTac-FNDC3B, which mainly consists of a nucleic acid binding sequence and a chimeric hybridization sequence. The nucleic acid binding sequence is a sequence complementary to the target nucleic acid, and the corresponding sequence can be changed according to actual needs. The chimeric hybridization sequences in NHALYTac-IGFIIRap and NHALYTac-FNDC3B, through complementary hybridization, connect the two nucleic acid parts under the action of T4 DNA ligase, forming the NHALYTacs chimera, as shown below. Figure 1 As shown in Figure a, the aptamer end of the NHALYtacs chimera binds to a cell membrane surface protein, while the other end, a nucleic acid recognition sequence, binds to the target nucleic acid through base complementarity. When the membrane protein undergoes endocytosis, it engulfs the target nucleic acid into the cell, where it is subsequently degraded via the lysosomal pathway.

[0067] In this embodiment of the invention, the DNA sequences involved in the experiment are shown in Table 1 below.

[0068] Table 1

[0069]

[0070] The underlined nucleic acid sequences can be hybridized with the 5' and 3' single-stranded ends of NHALYtac-IGFIIRap and NHALYtac-FNDC3B or NHALYtac-Multi through base complementarity pairing to form a nicked double-stranded chimera. After ligating the nick with T4 DNA ligase, NHALYtacs or MultiNHALytacs chimeras are generated. The sequences in bold are IGFIIRap (specifically binds to IGFIIR) and the nucleic acid binding sequence (complementarily pairs with the nucleic acid to be degraded), respectively. The single-underlined sequences form a double-stranded linker through complementary pairing. The length of this linker sequence can be adjusted according to specific circumstances.

[0071] This invention synthesized three NHALytac chimeras with different linker lengths: NHALytacs (23 bp linker), NHALytacs (10 bp linker), and NHALytacs (0 bp linker). The NHALytacs (0 bp linker) lacks complementary pairing sequences and therefore cannot complete the linking of two oligonucleotides; thus, it is directly synthesized as a single nucleic acid chain. The NHALytacs (23 bp linker) were synthesized using NHALytac-IGFIIRap (23 bp linker) and NHALytac-FNDC3B (23 bp linker) or NHALytac-Multi (23 bp linker). The NHALytacs (10 bp linker) were synthesized using NHALytac-IGFIIRap (10 bp linker) and NHALytac-FNDC3B (10 bp linker). Ultimately, it was found that the NHALYtacs chimera containing a 23bp linker exhibited higher stability.

[0072] Example 1. Synthesis of NHALYTacs and Selection of Linker Length

[0073] 1. Synthesis of NHALYTacs chimeras

[0074] Dissolve NHALYtac-IGFIIRap and NHALYtac-FNDC3B nucleic acid powder to 100 µM using DEPC water. Perform 5' phosphorylation modification on NHALYtac-IGFIIRap nucleic acid according to the following reaction system: 10 µL 100 µM NHALYtac-IGFIIRap, 1 µL T4 Polynucleotide Kinase (Beyotime), 2 µL Reaction Buffer A (10X), 1 µL 10 mM ATP, 6 µL DEPC water, for a total of 20 µL. After mixing, incubate the reaction system at 37 °C for 3 h on a PCR instrument. After incubation, react at 95 °C for 10 min, then incubate on ice for 10 min. At this point, the concentration of NHALYtac-IGFIIRap is 50 µM.

[0075] Dilute the phosphorylated NHALYtac-IGFIIRap and NHALYtac-FNDC3B nucleic acid solutions to 20 µM using PBS. NHALYtac chimeras were synthesized according to the following reaction mixture: 44 µL 20 µM NHALYtac-IGFIIRap, 44 µL 20 µM NHALYtac-FNDC3B, 2 µL T4 DNA Ligase (Beyotime), 10 µL 10× ligation buffer, for a total of 100 µL. After mixing, ligation was performed at room temperature for 3 h. After ligation, the mixture was heated at 95 °C for 10 min on a PCR instrument and then incubated on ice for 10 min. Then, 1 µL of the synthesized NHALYtac chimera product was mixed with 1 µL 2× sample loading buffer and loaded onto a 2% agarose gel containing 1× nucleic acid dye. Electrophoresis was performed in 1× TBE buffer at 160 V for 30 min. After electrophoresis, the gel was imaged using a gel imaging system (Seville). For example... Figure 1 As shown in Figure b, the three lanes correspond to NHALYtacs chimeras with different Linker lengths.

[0076] 2. Effect of Linker Length on the Stability of NHALYTacs Chimeras

[0077] Following the above-described synthesis steps for NHALYtac chimeras, NHALYtac chimeras containing different linker lengths (0bp, 10bp, and 23bp) were synthesized (e.g., Figure 1(As shown in Figure a). NHA Lytacs chimeras (0 bp, 10 bp, and 23 bp) were diluted to 500 nM with DMEM complete medium containing 10% fetal bovine serum. They were then incubated at 37°C for 0, 1, 2, 3, 4, 6, 8, 10, 12, and 24 h, respectively. After the preset incubation time, the chimeras were temporarily stored at -20°C. Once samples for each time gradient were collected, 10 µL of each sample was mixed with 2× sample loading buffer and loaded onto a 2% agarose gel containing 1× nucleic acid dye. Electrophoresis was performed in 1× TBE buffer at 160 V for 30 min. After electrophoresis, the gel was imaged using a gel imaging system. Figure 1 As shown in the cd figure, the NHALYtacs chimera containing a 23bp linker exhibits higher stability and is more stable in DMEM complete medium containing 10% fetal bovine serum.

[0078] Example 2. NHALytacs chimeras can degrade nucleic acids on the cell membrane surface.

[0079] 1. NHALYTacs chimera treatment of Hep3B cells

[0080] Hep3B cells were seeded in 96-well cell culture plates or confocal cell culture dishes 24 hours before the experiment to achieve a cell density of 70% before NHALYtacs chimera treatment. To detect the degradation effect of the NHALYtacs chimera on Hep3B cell membrane surface nucleic acids, this example uses cell membrane surface FNDC3B RNA (maxFNDC3B RNA) as an example. Hep3B cells were treated as follows: i) No treatment, 500 nM NHALYtac-IGFIIRap, 500 nM NHALYtac-FNDC3B, and NHALYtacs (23 bp linker) for 24 hours. ii) 0 nM, 31.25 nM, 62.5 nM, 125 nM, and 500 nM NHALYtacs (23 bp linker) for 24 hours. iii) 500 nM NHALytacs (23 bp linker) were used to treat 0h, 3h, 6h, 12h and 24h.

[0081] 2. Validation of the results of NHALYtacs chimera treatment

[0082] To verify that NHALYtacs chimera treatment of Hep3B cells can degrade maxFNDC3B RNA on the cell membrane surface, treated cells were washed three times with PBS. Then, 20 µL of 1 µM anti-FNDC3B-FAM solution (anti-FNDC3B-FAM nucleic acid powder dissolved in PBS to 1 µM, added at 95°C for 10 min, and incubated on ice for 10 min) was added to each well of a 96-well plate. The plate was incubated at 37°C in the dark for 30 min, followed by washing three times with PBS to thoroughly remove unbound free anti-FNDC3B-FAM that had not bound to maxFNDC3B RNA on the cell membrane surface. The fluorescence intensity of each well was then detected using a Spark microplate reader. Figure 2 As shown in Figure a, compared with the other three control groups, the maxFNDC3B RNA content in the NHALYtacs chimera group was significantly reduced. Figure 2 As shown in Figure b, the degradation efficiency of maxFNDC3B RNA increases with increasing NHAlytacs chimeric concentration. Figure 2 As shown in Figure c, when the concentration of NHALYtacs chimera is constant, the degradation efficiency of maxFNDC3BRNA increases with the extension of treatment time.

[0083] For imaging analysis of RNA on the cell membrane surface, Hep3B cells treated according to protocol i) were washed three times with PBS, then fixed with 4% paraformaldehyde at room temperature for 15 min, followed by in situ HCR imaging. Figure 2 As shown in the figure, compared with the other three control groups, NHALYtacs can significantly reduce the content of maxFNDC3B RNA on the cell membrane surface.

[0084] Example 3. NHALytacs can degrade extracellular free nucleic acids.

[0085] To verify that NHALYtacs can degrade extracellular free nucleic acids, Hep3B cells cultured in 96-well cell culture plates for 24 h were incubated for: i) 24 h in the dark with different concentrations of NHALYtacs chimeras (Scrambled RNA binding region and Scrambled aptamer as negative controls) and 10 nM FNDC3B oligo with FAM; ii) incubation for a period of time in the dark with 500 nM NHALYtasc chimeras (Scrambled RNA binding region and Scrambled aptamer as negative controls) and 10 nM FNDC3B oligo with FAM. The supernatant from the 96-well plates was then transferred to new 96-well plates, and the fluorescence intensity of each well was detected using a Spark multi-plate reader. To verify that the NHALYtacs chimera can internalize FNDC3B oligo with FAM into lysosomes, Hep3B cells in confocal culture dishes were treated under the conditions described above, with additional treatments including chloroquine and MG132. After 24 hours of treatment, lysosomes were stained with Lyso-Tracker and then imaged using Thunder Image.

[0086] like Figure 3 As shown in Figure a, with prolonged co-culture time, the NHALytacs chimera can effectively degrade extracellular free FNDC3B oligo. Figure 3 As shown in Figure b, the degradation effect on extracellular free FNDC3B oligos became more pronounced with increasing NHALYtacs chimera concentration. Figure 3 As shown in Figure c, the green fluorescence of FNDC3B oligo with FAM and Lyso-Tracker lysosomal staining are highly colocalized, indicating that the NHALYtacs chimera can internalize FNDC3B oligo with FAM into lysosomes. After chloroquine treatment, the green fluorescence is almost invisible, indicating that chloroquine inhibits the internalization of FNDC3B oligo with FAM into lysosomes by inhibiting the lysosomal pathway. MG132, as a proteasome pathway inhibitor, does not affect the internalization of FNDC3B oligo with FAM into lysosomes.

[0087] Example 4. MultiNHALytacs can achieve multiple degradation of target nucleic acids.

[0088] To further improve the degradation efficiency of target nucleic acids by NHALytacs chimeras, the nucleic acid binding region in NHALytacs is specially designed to contain antisense sequences of multiple target nucleic acids (NHALytac-multi), enabling it to bind multiple target nucleic acids simultaneously. The synthesis steps of MultiNHALytacs are the same as those of NHALytacs in Example 1, except that NHALytac-FNDC3B is replaced with NHALytac-multi (23 bp linker).

[0089] To verify the multiple degradation capability of MultiNHALytacs, the nucleic acid binding region of MultiNHALytacs in this embodiment was designed as a multiple binding sequence containing the maxFNDC3B, maxU3, maxU35, and maxY5 RNA antisense sequences. Hep3B cells were seeded into 96-well plates or confocal culture dishes 24 hours in advance, and different concentrations of MultiNHALytacs were added to the cells and cultured for 24 hours. After 24 hours, the upper culture medium was discarded, and the treated cells were washed three times with PBS. Then, 20 µL of 1 µM anti-FNDC3B-FAM solution (anti-FNDC3B-FAM nucleic acid powder was dissolved in PBS to 1 µM, added at 95°C for 10 min, and incubated on ice for 10 min) was added to a 96-well plate. For the detection of maxU3, maxU35, and maxY5, the corresponding antisense sequence nucleic acid probes were used. The plate was incubated at 37°C in the dark for 30 min, followed by washing three times with PBS to thoroughly remove free anti-FNDC3B-FAM that had not bound to the maxFNDC3B RNA on the cell membrane surface. The fluorescence intensity of each well was then detected using a Spark microplate reader. For imaging analysis of cell membrane surface RNA, Hep3B cells treated with the chimera were washed three times with PBS, fixed with 4% paraformaldehyde at room temperature for 15 min, and then subjected to in situ HCR imaging. To verify that MultiNHALytacs can simultaneously degrade multiple extracellular free nucleic acids, 500 nM MultiNHALytacs chimeras (with scrambled RNA binding region and scrambled aptamer as negative controls) and 10 nM FNDC3B, U3, U35, and Y5 oligos with FAM were incubated in a cell culture incubator in the dark for 24 h. The supernatant from the 96-well plates was then transferred to new 96-well plates, and the fluorescence intensity of each well was detected using a Spark multi-plate reader.

[0090] like Figure 4As shown in Figure a, the multi-RNA binding region can bind to multiple target RNAs simultaneously. Figure 4 As shown in the dg diagram, the 500 nM MultiNHALytacs chimera can effectively degrade multiple target nucleic acids simultaneously. Figure 4 As shown in Figure bc, treatment with the MultiNHALytasc chimera effectively reduces the content of maxY5 RNA on the cell membrane surface. Figure 4 As shown in the hk figure, with the extension of co-culture time, the MultiNHALytacs chimera can effectively degrade multiple extracellular free nucleic acids simultaneously.

[0091] Example 5. Therapeutic application of NHALytacs in subcutaneous tumors of nude mice

[0092] To investigate the therapeutic effect of the NHA Lytacs chimera, this embodiment used the Hep3B cell line to construct a nude mouse subcutaneous tumor model for validation. The tumor size was determined when it reached 50 mm. 3 The following groups were used for treatment: Control group: blank control group; Scrambled Apt group: negative control (random sequence aptamer) to exclude the influence of non-specific binding of aptamer sequences; Scrambled RBR group: negative control (random sequence RBR module) to exclude the non-specific effect of RBR module; NHALYtacs group: experimental group to verify the specific efficacy of the complete "nucleic acid-LYTAC" molecule. The Scrambled Apt group, Scrambled RBR group, and NHALYtacs group were administered the drug on days 0, 2, 4, 6, and 8, each time via intratumoral injection of 1 nmol of the aforementioned nucleic acid drug. Figure 5 As shown in Figure a. The Control group is not processed.

[0093] like Figure 5 As shown in Figure b, the drug treatment did not significantly affect the normal weight gain of nude mice. Figure 5 As shown in the CE diagram, the NHA Lytacs chimera can effectively inhibit the growth of subcutaneous tumors. Figure 5 As shown in Figure f, the NHALYtacs chimera does not affect vital organs in nude mice, demonstrating good biocompatibility. Figure 6-7 As shown, the NHALYtacs chimera can significantly reduce the expression of maxFNDC3B nucleic acid on the surface of Hep3B subcutaneous tumor cells. Figure 8 As shown, the Ki-67 positivity rate of subcutaneous tumors in the NHALYtacs-treated group was significantly lower than that in the other three control groups, indicating that the NHALYtacs chimera can significantly inhibit the proliferation of subcutaneous tumors.

Claims

1. A lysosome-targeted chimera for degrading nucleic acids, characterized in that, The lysosome-targeting chimera is formed by covalently linking a first nucleic acid fragment and a second nucleic acid fragment; The first nucleic acid fragment consists of an aptamer sequence targeting a cell membrane surface receptor protein and Linker 1, and the nucleotide sequence of the first nucleic acid fragment is shown in SEQ ID NO.1; The second nucleic acid fragment consists of a nucleic acid binding sequence complementary to the target nucleic acid and Linker 2, and the nucleotide sequence of the second nucleic acid fragment is shown in SEQ ID NO.2 or SEQ ID NO.5; The aptamer sequence and the nucleic acid binding sequence are covalently linked through complementary base pairing of Linker 1 and Linker 2 to obtain the lysosome-targeting chimera; The nucleotide sequence of Linker 1 is shown in the underlined portion of SEQ ID NO.1: TGACTGATTTACG GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC; The nucleotide sequence of the Linker 2 is shown as the underlined portion in SEQ ID NO.2 or SEQ ID NO.5; SEQ ID NO.2: CGTAAATCAGTCATTATCAGGCT ACTACAGATGTTGCCAAGGA AGCCTGATAA ; SEQ ID NO.5: CGTAAATCAGTCATTATCAGGCT ACTACAGATGTTGCCAAGGAACTCCCCAATACGGAGAGAAGAGACCATCGTGAGATAAGGGGAGACAATGTTAAATC AGCCTGATAA 。 2. The lysosome-targeting chimera according to claim 1, characterized in that, The 5' end of the first nucleic acid fragment is phosphorylated.

3. The method for preparing the lysosome-targeting chimera according to any one of claims 1 to 2, characterized in that, Includes the following steps: S1: Phosphorylate the 5' end of the first nucleic acid fragment to obtain a phosphorylated first nucleic acid fragment; S2: The phosphorylated first nucleic acid fragment obtained from S1 and the hybridization sequence in the second nucleic acid fragment are covalently linked by complementary hybridization under the action of T4 DNA ligase to form a lysosomal targeting chimera.

4. The preparation method according to claim 3, characterized in that, In S1, the reaction system includes: 8-12 µL of the first nucleic acid fragment, 0.5-2 µL of T4 kinase, 1-3 µL of reaction buffer, 0.5-2 µL of ATP and 5-8 µL of DEPC water, for a total of 20 µL; the reaction conditions are constant temperature incubation at 37±5℃ for 2-5 h.

5. The preparation method according to claim 3, characterized in that, In S2, the reaction system includes: 40-50µL of the first nucleic acid fragment, 40-50µL of the second nucleic acid fragment, 1-3µL of T4 DNA ligase, and 8-12µL of ligation buffer, for a total of 100µL; the reaction conditions are room temperature ligation for 2-5 hours.

6. The use of the lysosome-targeting chimera according to any one of claims 1 to 2 in the preparation of an anti-liver cancer drug.

7. The use of the lysosome-targeting chimera according to any one of claims 1 to 2 in the preparation of a drug for inhibiting the proliferation of liver cancer cells.

Citation Information

Patent Citations

  • Sortilin-based lysosome targeting chimera and application thereof

    CN120554529A

  • LYTAC molecule for targeted degradation of GPC3 as well as preparation method and application of LYTAC molecule

    CN120966826A

  • DNA (deoxyribonucleic acid) aptamer modified nanoparticles as well as preparation method and application thereof

    CN118022010A

  • Lysosome sorting signal-nucleic acid aptamer chimera as well as preparation method and application thereof

    CN121518481A