A gene crbp related to rice sheath blight resistance and its encoding protein and application

Abstract

This invention discloses a gene CRBP associated with rice resistance to rice sheath blight, its encoded protein, and its applications. This invention successfully identified a novel positive regulatory gene for rice sheath blight resistance, CRBP. Verification using two different sheath blight resistance identification methods showed that overexpression of the CRBP gene in rice plants significantly enhanced herath blight resistance; knockout of the CRBP gene led to weakened resistance to sheath blight. Further agronomic trait surveys indicated that the agronomic traits of CRBP-overexpressing lines were not significantly different from those of the wild type. Therefore, the CRBP overexpression line of this invention has a significant impact on rice sheath blight resistance and can be applied to rice breeding for resistance to sheath blight, which is of great significance for the genetic improvement of rice disease resistance.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and in particular relates to a gene CRBP related to rice resistance to sheath blight, its encoded protein, and its applications. Background Technology

[0002] Rice sheath blight, caused by *Rhizoctonia solani* Kühn, is a major fungal disease, considered one of the three major diseases of rice along with rice blast and bacterial blight. This disease has a wide distribution and causes severe damage, seriously threatening rice yield and quality. With the widespread application of sequencing technology, genome-wide association studies (GWAS) based on large-scale natural rice populations have become an effective strategy for discovering genes resistant to sheath blight. However, sheath blight resistance is a quantitative trait controlled by multiple genes and is easily affected by environmental factors. Furthermore, significant differences in the growth period and plant architecture among varieties in natural populations make it difficult to efficiently and accurately assess rice disease resistance using existing phenotypic identification methods. These problems severely restrict the discovery of resistance genes, resulting in a scarcity of resistance gene resources currently available for breeding practice, further hindering the progress of disease-resistant breeding.

[0003] Rice sheath blight has been causing increasing damage in recent years. Increased nitrogen fertilizer application and the promotion of dwarf, high-density planting varieties have created conditions conducive to the spread of the disease. In many rice-growing areas, the disease is predominantly prevalent, causing losses exceeding those of other major diseases. Chemical control not only increases costs but also contradicts the principles of sustainable agricultural development. Utilizing disease-resistant genes to cultivate varieties has become an economically effective and fundamental approach. Summary of the Invention

[0004] The purpose of this invention is to address the deficiencies of the existing technology by providing a gene CRBP that can regulate rice resistance to sheath blight; by regulating the function of the CRBP gene, the resistance of rice to sheath blight can be effectively improved, thereby alleviating the technical problem of the difficulty in controlling sheath blight in rice production practice.

[0005] This invention also provides the encoded protein, vector, and application of the rice sheath blight resistance gene CRBP.

[0006] Technical solution: In order to achieve the above objectives, the present invention provides a gene CRBP for regulating rice resistance to sheath blight, the CDS sequence of which is shown in SEQ ID NO.1.

[0007] The full-length sequence of the gene CRBP, which is related to rice resistance to sheath blight, is shown in SEQ ID NO.2.

[0008] The protein encoded by the rice sheath blight resistance gene CRBP described in this invention has the amino acid sequence shown in SEQ ID NO.3.

[0009] The substance used to regulate the CRBP gene for rice resistance to sheath blight is the gene overexpression vector pCAMBIA1300-CRBP.

[0010] Furthermore, the method for constructing the gene overexpression vector pCAMBIA1300-CRBP includes the following steps:

[0011] Furthermore, the overexpression vector pCAMBIA1300-CRBP is constructed by amplifying the CDS sequence of the CRBP gene, ligating it into the pCAMBIA1300 vector, transforming it, extracting the plasmid, and finally obtaining the overexpression vector pCAMBIA1300-CRBP.

[0012] The present invention relates to the gene knockout vector of CRBP, a gene associated with rice resistance to sheath blight.

[0013] Primers containing the target site of the CRBP gene were designed and synthesized. The full-length gRNA sequence fused to the target site was obtained by PCR. The gRNA was then homologously recombinated with the enzyme-digested pCXUN-Cas9 vector to obtain a recombinant vector. The recombinant vector was transformed into E. coli and screened to obtain the gene knockout vector pCXUN-Cas9-CRBP.

[0014] The application of the CDS sequence of the gene CRBP, the full-length sequence of the gene CRBP, the protein, the overexpression vector, or the knockout vector of the present invention in regulating resistance to rice sheath blight.

[0015] Furthermore, overexpression of the rice CRBP gene enhanced rice resistance to rice sheath blight, while knockout of the rice CRBP gene reduced rice resistance to rice sheath blight.

[0016] The application of the CDS gene of the CRBP gene, the full-length sequence of the CRBP gene, the protein, the overexpression vector, or the knockout vector of the present invention in the cultivation of rice germplasm resistant to sheath blight.

[0017] Among them, the present invention relates to the application of reducing the expression level and / or activity of the CRBP gene in recipient rice in the cultivation of transgenic rice with improved resistance to sheath blight.

[0018] Furthermore, this invention enhances the expression level and / or activity of the CRBP gene in recipient rice for use in rice sheath blight resistance breeding.

[0019] The application of the CRBP gene-encoded protein described in this invention in any of the following:

[0020] (1) Regulating plant resistance to sheath blight;

[0021] (2) A protein derived from rice with the same function, in which one or more amino acid residues of the amino acid sequence shown in SEQ ID No.3 are substituted and / or deleted and / or added.

[0022] The expression level and / or activity of the CRBP protein described in this invention are reduced, thereby reducing the plant's resistance to sheath blight.

[0023] The increased expression level and / or activity of the CRBP protein described in this invention enhances the plant's resistance to sheath blight.

[0024] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0025] This invention identifies a gene, CRBP, that regulates rice resistance to sheath blight. The CRBP gene positively regulates rice resistance to sheath blight pathogens; overexpression of this gene significantly enhances rice resistance to sheath blight, while knockout significantly weakens it. Sheath blight resistance-enhancing materials without transgenic components can be obtained through gene overexpression, providing a new target for molecular breeding of sheath blight-resistant rice and possessing significant application value. Furthermore, the CRBP overexpression lines of this invention also significantly increase the chlorophyll a and chlorophyll b content of rice varieties. Attached Figure Description

[0026] Figure 1 This describes the tissue-specific expression pattern of the CRBP gene in rice.

[0027] Figure 2 Western blotting results for three overexpression lines of the CRBP gene;

[0028] Figure 3 This is a schematic diagram of a knockout lineage of the CRBP gene;

[0029] Figure 4 This study aimed to identify the phenotype of CRBP gene knockout and three overexpression lines, as well as the wild-type detached stem sheath blight. In this study, A represents the detached stem sheath blight phenotype identification, and B represents the lesion length for detached sheath blight resistance identification. Indicates a significance level of P < 0.001;

[0030] Figure 5 This study identified the phenotypes of one CRBP gene knockout line, three overexpression lines, and the wild-type line against greenhouse stem blight. In this study, A represents the greenhouse stem blight phenotype, and B represents the lesion length for greenhouse stem blight resistance assessment. Indicates a significance level of P < 0.001;

[0031] Figure 6Phenotypic images of agronomic traits for one knockout and three overexpression lines, as well as the wild type;

[0032] Figure 7 The agronomic traits of one CRBP gene knockout and three overexpression lines in plant height (A), effective tiller number (B), grain length (C), grain width (D), flag leaf length (E), and thousand-grain weight (F) were evaluated. This indicates the results of multiple comparisons at the P<0.05 level. The significance level is indicated by P < 0.01. Detailed Implementation

[0033] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0034] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0035] Experimental methods not specified in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0036] The rice variety NIP (Nipponbare) used in this invention was provided and preserved by the Rice Germplasm Resource Bank of Yangzhou University.

[0037] The herbicide strain RH-9, provided by Yangzhou University, Zuo et al., Theoretical and Applied Genetics, 2013, 126:1257-1272.

[0038] Example 1

[0039] Identification and cloning of the CRBP gene

[0040] The genome sequence of the rice CRBP gene was obtained through the National Rice Data Center, and primers were designed: F: 5'-ATGGCAGCAACAGCCTCCCTG-3', R: 5'-TCAGACGCTGACGSTTC-3'. Using cDNA from the leaves of 4-5 leaf stage seedlings of NIP as a template, the CDS sequence of the rice CRBP gene was amplified as shown in SEQ ID NO.1, its amino acid sequence as shown in SEQ ID NO.3, and the full length of the CRBP gene as shown in SEQ ID NO.2.

[0041] Example 2

[0042] CRBP gene expression characterization analysis

[0043] Root, stem, leaf, leaf sheath, and panicle tissues from the booting stage of the rice cultivar NIP, susceptible to rice sheath blight, were used as materials for RNA extraction. RNA extraction was performed using Invitrogen's Trizol reagent according to its manufacturer's instructions. Genomic DNA contamination was then removed using Promega's RNase-free DNase I, following the kit's instructions. Subsequently, the first strand of cDNA was synthesized using TaKaRa's PrimeScript RT reagent Kit with gDNA Eraser, following the manufacturer's instructions. The reaction conditions were: 37°C for 30 min, 85°C for 5 sec, and storage at 4°C. Using cDNA from various tissues as templates and the rice Actin gene as an internal reference gene (amplification primer sequences: forward primer F: 5'-TGTATGCCAGTGGTCGTACCA-3', reverse primer R: 5'-CCAGCAAGGTCGAGACGAA-3'), real-time quantitative PCR was performed using CRBP gene-specific quantitative primers (CRBP: 5'-AACTACAACCCCGTGGAGGAG-3'; CRBP-R: 5'-CGCCGGAGATGTTGAACACCT-3') to detect the expression specificity of the CRBP gene in different rice tissues. The real-time quantitative PCR reaction conditions were: 95℃ pre-denaturation for 2 min; followed by 40 cycles of amplification with cycling parameters of 95℃ for 15 sec, 60℃ for 10 sec, and 72℃ for 10 sec. The qPCR results showed that CRBP gene expression was highest in leaves. Figure 1 ).

[0044] Example 3

[0045] Vector construction and genetic transformation to construct CRBP transgenic materials

[0046] The main steps in constructing the overexpression vector are as follows: Using high-fidelity DNA polymerase to amplify cDNA from the leaf sheath tissue of the NIP during the booting stage as a template, primers F: 5'-CATTTACGAACGATAGCCggtaccATGGCAGCAACAGCCTCC-3' and R: 5'-ATCATGATCTTTGTAATCggatccAGGATCTAAGTCAGACG-3' were used to obtain the CDS sequence of CRBP with homologous arms. The overexpression vector pCAMBIA1300 was linearized by restriction endonucleases KpnI and BamHI (Thermo Scientific™, FD0524, ER0051). The target gene was then introduced into the overexpression vector pCAMBIA1300 using homologous recombinase. The specific operation method is as follows: First, the amplified CDS sequence and the digested vector are homologously recombinated with recombinase (Novizan ClonExpress II One Step Cloning Kit reagent) for 2 hours. Then, the CDS sequence of the obtained CRBP is homologously recombinated with the digested pCAMBIA1300 linear vector for 2 hours. Next, it is introduced into E. coli competent cells via heat shock transformation. Then, 500 μL of LB solution is added, and the cells are incubated at 37°C for 30 minutes for recovery. Finally, the cells are plated on Kansas culture dishes and incubated at 37°C for 12 hours. Single colonies are picked from the culture dishes, plasmids are extracted and digested with enzymes. Positive plasmids are selected for sequencing, resulting in the successfully recombined, mutation-free positive plasmid pCAMBIA1300-CRBP. Then, the overexpression vector pCAMBIA1300-CRBP is transformed into NIP cells via Agrobacterium EHA105 to obtain CRBP overexpression material. The genetic transformation of the transgene in this invention was obtained by Wuhan Boyuan Biotechnology Co., Ltd. according to conventional transgenic technology experiments. Three transgenic lines were selected and named CRBP-OE1, CRBP-OE2, and CRBP-OE3. Expression level analysis showed that CRBP expression was significantly overexpressed in all three lines. Figure 2 The results of Western blotting for three overexpression lines of the CRBP gene are shown.

[0047] The steps for constructing a CRISPR / Cas9 knockout vector using the rice CRBP gene are as follows: For the rice CRBP gene sequence, highly efficient knockout target sites were screened, and a specific sgRNA was designed and synthesized with the nucleotide sequence: 5'-AGCACTCTCCATCTCAACCCAGG-3'. The pCXUN-Cas9 vector (referencing Chinese Invention Patent CN108949805A) was used. The specific restriction endonuclease KpnⅠ (Takara) was used to digest the vector at specific restriction sites, obtaining a linearized vector fragment. The digestion effect was verified by agarose gel electrophoresis, and the linearized vector was recovered and purified. The recombinant reaction mixture was prepared according to the following system: 4 μL sgRNA, 2 μL of digested linearized vector template, 1 μL Exnase II recombinase (Novizan Biosciences), 2 μL 5×CEⅡ Buffer (Novizan Biosciences), and 1 μL sterile deionized water, for a total volume of 10 μL. The mixture was placed in a PCR instrument and programmed to react at 37°C for 30 min. After the reaction, it was immediately placed on ice to cool and store. The constructed recombinant vector plasmid was added to competent *E. coli* cells and incubated on ice for 30 min. Then, it was heat-shocked in a 42°C water bath for 90 s and immediately transferred to ice for 3-5 min. In a clean bench, 600 μL of sterile liquid LB medium was added to a centrifuge tube, mixed well, and incubated at 37°C and 200 rpm for 1 h. The revived bacterial culture was centrifuged at 5000 rpm for 3 min, 500 μL of supernatant was discarded, and the remaining bacterial culture was resuspended and evenly spread on LB agar plates containing kanamycin. The plates were incubated upside down at 37°C for approximately 12 h. Twelve single colonies were randomly selected from the LB plates and inoculated into 500 μL of liquid LB medium containing kanamycin, and incubated at 37°C and 200 rpm for 6 h. Use 5 μL of bacterial culture as a template and perform PCR identification using specific primers. The primer sequences are as follows:

[0048] Upstream primer (CRBP-KO-F): 5'-AGAGAGATGGCAGCAACAGC-3'

[0049] Downstream primer (CRBP-KO-R): 5'-CTCTTAGCTTTTCTGCCATGCT-3'

[0050] PCR-positive clones were screened and sequenced for verification. Positive clones with completely correct sequences were selected, and recombinant plasmids were extracted using the EZNATMPlasmid Midi Kit (OMEGA) according to the kit instructions. The plasmids were then stored at -20°C for later use.

[0051] After the knockout vector was constructed, the recombinant plasmid was transformed into EHA105 Agrobacterium competent cells using electroporation. Single colonies were picked and cultured by shaking. After confirmation by PCR, the Agrobacterium engineered strain pCXUN-Cas9-CRBP was obtained. Glycerol was added to the bacterial culture to a final concentration of 20%, and the culture was stored at -80°C for later use. Then, the Agrobacterium engineered strain pCXUN-Cas9-CRBP was transformed into NIP cells to obtain CRBP knockout material. The genetic transformation of the transgene in this invention was obtained by Wuhan Boyuan Biotechnology Co., Ltd. according to conventional transgenic technology experiments. After the genetic transformation of rice was completed, the knockout line CRBP-KO was obtained. Figure 3 As shown, the insertion of base A in the transgenic knockout line leads to an alteration in the amino acid sequence, causing premature termination of protein translation.

[0052] Example 4

[0053] Resistance to sheath blight was identified in wild-type (WT, NIP), knockout (CRBP-KO), and overexpression lines (CRBP-OE1, CRBP-OE2, CRBP-OE3) of the pathogen using a greenhouse inoculation method. The in vitro sheath blight resistance identification method is as follows:

[0054] For inoculation with detached stem materials, detached stems were sampled from rice plants at the early panicle stage. Stems from each plant, as well as wild-type plants, were cut off, leaving only the flag leaf and the second leaf from the top. These were then placed in water overnight to allow the rice to acclimatize to the climatology chamber environment and prevent water loss. The next day, inoculation was performed using the same embedding method. A piece of wood bark (1.0 cm long and 2 mm wide, fully coated with mycelium of *Rhizoctonia solani* RH-9 (Zuo et al., Theoretical and Applied Genetics, 2013, 126:1257-1272)) was carefully placed 1 cm below the leaf sheath of the second leaf from the top. After inoculation, the stems were inserted into test tube racks containing floral foam and then transferred to a nutrient solution. The plants were then grown in an environment with 14 hours of light (30℃), 10 hours of darkness (26℃), and 90% humidity. Eight to ten detached stems were collected from each line, and the length of lesions was assessed seven days after inoculation.

[0055] The method for identifying resistance to greenhouse sheath blight is as follows:

[0056] When the rice plants reach the 8-10 tillering stage, transplant them into long pots, 5 plants per pot. Newly dug seedlings need to be placed in a cool, shaded area (low light) for 3-4 days to aid recovery and survival. After 3-4 days, prune the seedlings, removing small tillers, withered leaves, and rotten leaf sheaths at the base, retaining 8-10 main stems. After pruning, move the seedlings from the shaded area to the outdoors for 5-7 days to grow normally. Three days before inoculation, move the seedlings that are growing normally outdoors to the greenhouse and fertilize appropriately. Set the greenhouse temperature and light conditions to 14 hours of light (30℃) and 10 hours of darkness (24℃), and use a misting system for indoor humidification. Inoculation was carried out when the rice plants reached the late booting stage. The inoculation method was manual embedding. A piece of wood bark, 1 cm long and 2 mm wide, covered with mycelium of Rhizoctonia solani RH-9 (enough to be fully coated with mycelium), was carefully placed on the leaf sheath 1 cm below the second leaf from the bottom. Five seedlings were inoculated per pot, and five stems of relatively consistent growth stages were inoculated on each seedling. The length of lesions was investigated 14 days after inoculation.

[0057] When using in vitro inoculation, such as Figure 4 As shown, the average lesion length of the three transgenic overexpression lines CRBP-OE1, CRBP-OE2, and CRBP-OE3 (6.53 cm, 7.62 cm, and 8.95 cm, respectively) was significantly different from that of the wild-type plant (11.71 cm), while the average lesion length of the transgenic knockout line CRBP-KO (10.73 cm, respectively) was not different from that of the wild-type plant (10.36 cm).

[0058] When using artificial inoculation in a greenhouse, such as Figure 5 As shown, the average lesion lengths of the three transgenic overexpression lines CRBP-OE1, CRBP-OE2, and CRBP-OE3 (16, 26 cm, 17.54 cm, and 16.73 cm, respectively) were significantly shorter than those of the wild-type plant (19.99 cm). However, the average lesion lengths of the transgenic knockout line CRBP-KO (18, 60 cm, respectively) were not different from those of the wild-type plant (20.47 cm). These results indicate that the CRBP gene positively regulates rice sheath blight resistance, and overexpression of this gene can significantly enhance rice sheath blight resistance.

[0059] Example 5

[0060] Agronomic traits of transgenic rice plants

[0061] To investigate the function of CRBP in rice development, overexpression and knockout lines of CRBP were constructed in a NIP background. The CRBP-KO lines all exhibited a yellowing leaf phenotype, and their chlorophyll content was significantly lower than that of the wild type. Under field conditions, almost no morphological differences were observed between the CRBP-OE lines and wild-type plants. Given the reduced chlorophyll content in the CRBP-KO lines, the chlorophyll content of the CRBP-OE lines was subsequently measured. Compared with wild-type plants, the chlorophyll a and chlorophyll b contents of both CRBP-OE lines were significantly increased, while the carotenoid content showed no significant difference. Furthermore, six major agronomical and yield-related traits were measured, including plant height, flag leaf length, effective tiller number, grain length, grain width, and thousand-grain weight; none of these traits showed significant differences compared to the wild type. In conclusion, CRBP is essential for normal rice development, and its overexpression does not affect rice growth, development, or yield. Figure 6 and 7 ).

Claims

1. A CDS sequence of a gene CRBP associated with rice resistance to sheath blight, characterized in that, The CDS sequence is shown in SEQ ID NO.

1.

2. The full-length sequence of the CRBP gene associated with rice resistance to sheath blight as described in claim 1, characterized in that, The full-length sequence of the CRBP gene is shown in SEQ ID NO.

2.

3. A protein encoded by the gene CRBP, as described in claim 1, related to rice resistance to sheath blight, characterized in that... The amino acid sequence of the protein is shown in SEQ ID NO.

3.

4. An overexpression vector pCAMBIA1300-CRBP containing the CRBP gene, which is related to rice resistance to rice sheath blight as described in claim 1.

5. The overexpression vector pCAMBIA1300-CRBP according to claim 4, characterized in that, The overexpression vector pCAMBIA1300-CRBP is constructed by amplifying the CDS sequence of CRBP, ligating it into the pCAMBIA1300 vector, transforming it, extracting the plasmid, and finally obtaining the overexpression vector pCAMBIA1300-CRBP.

6. A gene knockout vector pCXUN-Cas9-CRBP based on the gene CRBP, which is associated with rice resistance to sheath blight as described in claim 1.

7. The gene knockout vector pCXUN-Cas9-CRBP according to claim 6, characterized in that, The gene knockout vector construction method involves designing and synthesizing an sgRNA that recognizes the target site: AGCACTCTCCATCTCAACCCAGG, which is then ligated into the pCXUN-Cas9 vector via enzyme digestion. After transformation with E. coli and Agrobacterium, the gene knockout vector pCXUN-Cas9-CRBP is finally obtained.

8. The application of a CDS sequence of the gene CRBP according to claim 1, the full-length sequence of the gene CRBP according to claim 2, the protein according to claim 3, the gene overexpression vector according to claim 4, or the knockout vector according to claim 6 in regulating rice resistance to sheath blight.

9. The application according to claim 8, characterized in that, Overexpression of the CRBP gene in rice increases the rice's resistance to sheath blight; editing the CRBP gene in rice using CRISPR / Cas9 reduces the rice's resistance to sheath blight.

10. The application of a CDS sequence of the gene CRBP according to claim 1, or the full-length sequence of the gene CRBP according to claim 2, or the protein according to claim 3, or the overexpression vector according to claim 4, or the knockout vector according to claim 6, in the cultivation of rice germplasm resistant to sheath blight.

Images