AAP gene regulating salt tolerance in lettuce, its functional modules and their applications

Abstract

This invention discloses the AAP gene, functional module, and application of regulating salt tolerance in lettuce, relating to the field of molecular biology. The invention discloses a nucleic acid molecule regulating salt tolerance in lettuce, wherein the nucleic acid molecule is a gene as shown in (a), (b), or (c) below: (a) an LsAAP7a gene with a CDS sequence as shown in SEQ ID NO: 3, or an LsAAP1b gene with a CDS sequence as shown in SEQ ID NO: 4; (b) a nucleic acid molecule encoding an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2; and (c) a variant sequence having at least 95% sequence identity with the nucleotide sequence defined in (a) or (b), derived from lettuce, and encoding a protein with the same function. This invention identifies two positive regulators of lettuce salt stress response, LsAAP7a and LsAAP1b, and preliminarily studies their functional mechanisms, providing a certain material basis for cultivating salt-tolerant lettuce varieties, and has potential application and economic value.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to the AAP gene, functional modules, and applications of regulating salt tolerance in lettuce. Background Technology

[0002] Soil salinization is mainly caused by neutral salts such as NaCl and Na₂SO₄. Studies have found that a soil salinity of 0.3% can interfere with the normal growth and development of most plants, while when the salinity exceeds 0.5%, most plants will cease growth. According to incomplete statistics, approximately 20% of irrigated farmland and over 6% of the land area globally are affected by salinization, leading to reduced crop yields or even crop failure, causing huge losses to agricultural economic development. In addition, soil salinization can further induce secondary ecological problems such as soil erosion, desertification, biodiversity loss, and forest shrinkage, disrupting regional ecological balance and becoming one of the important limiting factors for the sustainable development of my country's land resources.

[0003] Lettuce (Lactuca sativa L.), commonly known as romaine lettuce, is a cultivated species of the genus Lactuca in the family Asteraceae. Originating in temperate regions of Asia, it is rich in vitamins and dietary fiber, possessing high nutritional value, and is widely cultivated globally. In 2017, the genome data of lettuce was released, providing ample basic data and genetic resources for molecular breeding and the discovery of superior traits in lettuce.

[0004] Cultivars of lettuce are highly sensitive to salt stress, with significant reductions in yield indicators such as root length, fresh weight, dry weight, and leaf area under such conditions. In Lola lettuce, the expression levels of SnRK2, P5CS, JAR4, NPR1, and GST in leaves, as well as the expression levels of genes related to reactive oxygen species scavenging such as POD and SOD, were significantly upregulated under salt stress, thus mitigating the harmful effects of salt on the plant.

[0005] Current research on lettuce salt stress primarily focuses on the addition of exogenous substances to enhance its salt tolerance, with limited research into its molecular mechanisms. Salicylic acid (SA) is an endogenous plant hormone; foliar application of SA significantly increases root length, plant height, chlorophyll and proline content in lettuce plants under salt stress, while reducing salt damage to plant cells. Gamma-aminobutyric acid (GABA) improves seed and seedling germination, regulates oxidative stress, and enhances photosynthesis and salt tolerance in lettuce under salt stress. Furthermore, foliar application of glycine betaine can reduce cell membrane permeability, MDA and H2O2 content in lettuce plants under salt stress, and also reduce sodium content in the plant. +Accumulation increases the content of gibberellin, salicylic acid, and indoleacetic acid. Nitric oxide (NO), as a signaling molecule, can activate the antioxidant system through exogenous application, increasing the content of ascorbic acid, total phenols, antioxidant enzymes (SOD, POD, CAT, and APX), and MDA in lettuce leaves under salt stress, while decreasing H2O2 content. Similarly, ascorbic acid can reduce oxidative damage in lettuce and mitigate the adverse effects of salinity by enhancing the content of SOD, POD, and CAT. Furthermore, iodine application can improve plant tolerance to abiotic stresses and provide humans with a nutrient diet rich in iodine and antioxidants. Low iodine concentrations can enhance the antioxidant capacity of lettuce under saline-alkali conditions, reduce toxic compounds, improve nutritional status, maintain physiological balance, and promote plant growth and yield; conversely, high iodine levels can interfere with physiological processes and reduce productivity. Phenolic compounds play a positive role in plant resistance to abiotic stress. Chlorogenic acid (CA), the first phenolic product in the phenylpropane biosynthesis pathway, can reverse membrane damage and lipid oxidation in apple leaves and induce the transcription of genes related to antioxidant capacity, including peroxidase, catalase, and polyphenol oxidase. In lettuce, exogenous application of chlorogenic acid and hesperidin (HES) can increase the relative water content, carbon assimilation rate, stomatal conductance, and transpiration rate of plants under salt stress.

[0006] Currently, research on lettuce's response to salt stress mainly focuses on physiological and biochemical aspects, or on mitigating the effects of salt on lettuce by applying exogenous chemicals such as nitric oxide and ascorbic acid. Research on its molecular mechanisms is relatively limited. In recent years, with the development of omics technologies, transcriptome sequencing has become a common tool for studying specific traits, enabling the discovery of key genes and pathways, providing strong support for phenotypic characteristics and physiological indicators. For example, comparative transcriptome analysis between two rice varieties with different salt sensitivities revealed that the salt-tolerant variety RPY geng can regulate the expression of multiple stress-related genes, and several genes responding to salt stress, such as NAC, KAT, PR10, and MGD, were identified. Under salt stress, the genes upregulated in grape leaves were mainly enriched in signal transduction, amino acid metabolism, and lipid metabolism pathways. In addition, KEGG analysis of cotton leaves showed that the MAPK signaling pathway, starch and sucrose metabolism, plant hormone signal transduction, photosynthesis, and fatty acid metabolism are key pathways in response to salt stress, and genes such as MYB4, MYB105, MYB36, bZIP19, bZIP43, FRS2, SMARCAL1, BBX21, and F-box play important roles in cotton salt tolerance. Peng et al. identified the GhSAP6 gene in transcriptome data of cotton under salt stress and found through VIGS silencing and yeast double hybridization that GhSAP6 can interact with the RAD23C protein, thereby regulating protein function and negatively regulating the salt stress response. Ge et al. identified the PeERF1 gene in transcriptome data of poplar under salt stress. Under 75 mM NaCl, transgenic poplar overexpressing PeERF1 had higher SOD and POD contents, and the root length was 1.45 times that of the wild type and the fresh weight was 2.11 times that of the wild type.

[0007] Whether mitigating salt stress damage through physiological and biochemical means or by adding exogenous chemicals, these exogenous substance addition strategies have significant shortcomings: the application of exogenous substances requires precise control of concentration and timing, which is cumbersome and costly; the effectiveness of exogenous substances is greatly affected by environmental factors, their stability is difficult to guarantee, and they cannot fundamentally improve the salt tolerance of lettuce genetically. Therefore, identifying endogenous salt tolerance genes in lettuce, elucidating their molecular regulatory mechanisms, and then cultivating salt-tolerant lettuce varieties through molecular breeding is a more fundamental and economical solution.

[0008] Amino acid permeases (AAPs) are a plant-specific gene family, belonging to the amino acid / auxin permease family (ATF / AAAP) superfamily. The AAP gene family has relatively many members: 8 in Arabidopsis, 21 in sorghum (Sorghum bicolor L.), 19 in tea (Camellia sinensis), 11 in apple (Malus × domestica Borkh.), and 19 in Chinese cabbage (Brassica oleracea L.). The expression of plant AAP genes is closely related to the content of free amino acids. Studies have shown that silencing the potato StAAP1 gene via RNAi reduces the free amino acid content in tubers by 50%; while in tomatoes, SlAAP6 overexpression significantly increases the free amino acid content in roots and leaves. The SlAAP6 gene promotes root growth by facilitating the uptake and transport of branched-chain amino acids, resulting in overexpressing plants having longer root systems than wild-type plants under both control and salt stress conditions. However, direct evidence that SlAAP6 enhances plant salt tolerance is currently lacking, and there are no studies on the molecular mechanisms regulating SlAAP6 expression. No reports have yet been published regarding the genome-wide identification of AAP genes in lettuce and their functional studies under salt stress.

[0009] In summary, current technologies lack systematic identification of the AAP gene family in lettuce, and even more so, in-depth research on the biological functions of its members under salt stress. Therefore, identifying key members of the AAP family in lettuce that respond to salt stress and elucidating their molecular regulatory mechanisms for salt tolerance is of significant theoretical and practical value for breeding salt-tolerant lettuce varieties. Summary of the Invention

[0010] The technical problem to be solved by this invention is to provide the AAP gene, functional module and application for regulating salt tolerance in lettuce.

[0011] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0012] A nucleic acid molecule that regulates salt tolerance in lettuce, said nucleic acid molecule being a gene as shown in (a), (b), or (c) below:

[0013] (a) The LsAAP7a gene with a CDS sequence as shown in SEQ ID NO: 3, or the LsAAP1b gene with a CDS sequence as shown in SEQ ID NO: 4;

[0014] (b) Nucleic acid molecules encoding amino acid sequences as shown in SEQ ID NO: 1 or SEQ ID NO: 2;

[0015] (c) A variant sequence that has at least 95% sequence identity with the nucleotide sequence defined in (a) or (b) and is derived from lettuce and encodes a protein with the same function.

[0016] A recombinant expression vector includes the aforementioned nucleic acid molecule and a promoter operatively linked upstream of the nucleic acid molecule.

[0017] A method for improving the salt tolerance of lettuce includes upregulating the expression levels of the LsAAP7a gene and / or the LsAAP1b gene in lettuce, wherein:

[0018] (a) The LsAAP7a gene encodes the protein shown in SEQ ID NO: 1;

[0019] (b) The LsAAP1b gene encodes the protein shown in SEQ ID NO: 2.

[0020] A further preferred method for upregulating gene expression is to transform lettuce with a recombinant expression vector containing the gene via Agrobacterium-mediated transformation, thereby obtaining transgenic lettuce that stably expresses the gene.

[0021] One method to improve the salt tolerance of lettuce involves upregulating the expression level of the transcription factor LsTGA4 gene in lettuce.

[0022] The application of transcription factor LsTGA4 in improving salt tolerance of lettuce: LsTGA4 specifically binds to and activates the promoters of LsAAP7a and LsAAP1b genes, promoting the accumulation of free amino acids in lettuce leaves and roots, thereby improving the salt tolerance of lettuce.

[0023] The nucleotide sequence of the LsTGA4 gene is shown in SEQ ID NO: 5, and the amino acid sequence encoding the transcription factor is shown in SEQ ID NO: 6;

[0024] The LsAAP7a gene promoter sequence is shown in SEQ ID NO: 7; the LsAAP1b gene promoter sequence is shown in SEQ ID NO: 8.

[0025] Application of the above-mentioned nucleic acid molecules, recombinant expression vectors, or transcription factors in the cultivation of salt-tolerant lettuce varieties.

[0026] A functional module for regulating salt tolerance in lettuce includes the transcription factor LsTGA4 and target genes LsAAP1b and / or LsAAP7a; the LsTGA4 transcription factor specifically binds to the promoter region of the target gene, positively regulating the expression of the target gene, promoting the accumulation of free amino acids in lettuce, and improving the salt tolerance of lettuce.

[0027] The positive regulation is achieved by overexpressing the LsTGA4 gene or enhancing the activity of its encoded transcription factors.

[0028] A method for screening salt-tolerant lettuce germplasm includes the following steps:

[0029] (1) Total RNA was extracted from the lettuce leaves to be tested and cDNA was obtained by reverse transcription;

[0030] (2) Use specific primers to detect the expression levels of LsAAP1b and / or LsAAP7a genes in cDNA by qRT-PCR; and / or detect the expression level of LsTGA4 gene;

[0031] (3) Using wild-type lettuce as a control, plants with significantly higher LsAAP1b and / or LsAAP7a gene expression levels than the control were selected as salt-tolerant candidate germplasm.

[0032] A method for improving salt tolerance in lettuce includes the following steps: upregulating the expression level of the LsTGA4 gene in lettuce plants, so that the LsTGA4 protein simultaneously binds to and activates the transcription of the endogenous LsAAP1b and LsAAP7a genes.

[0033] A method for improving salt tolerance in lettuce includes the following steps: upregulating the LsTGA4 gene in lettuce plants, activating the transcription of the endogenous LsAAP7a gene, and / or activating the transcription of the endogenous LsAAP1b gene.

[0034] The beneficial effects of the above technical solution are as follows: In this invention, our research group found that overexpression of the LsAAP7a or LsAAP1b gene can significantly improve the salt tolerance of Arabidopsis thaliana. The fresh weight of leaves, roots, dry weight of leaves, and dry weight of roots are all significantly higher than those of the mutant control. Simultaneously, the free amino acid content in the leaves and roots of the overexpressing plants is significantly increased. However, transient silencing of these genes in lettuce leads to a significant decrease in free amino acid content, indicating that the genes enhance the plant's adaptability to salt stress by promoting the accumulation of free amino acids. Yeast one-hybrid experiments confirmed that the transcription factor LsTGA4 can specifically bind to the promoter sequences of the LsAAP7a and LsAAP1b genes, and overexpression of LsTGA4 can restore the salt-sensitive phenotype of the Arabidopsis mutant, proving that the transcription factor positively regulates plant salt tolerance by activating AAP gene expression. Furthermore, the expression levels of LsAAP1b, LsAAP7a, and LsTGA4 are significantly increased under salt stress, and they can be used as molecular markers for the screening of salt-tolerant lettuce germplasm and molecular breeding. This invention is the first to identify 18 members of the AAP gene family in the whole genome of lettuce and verify the salt tolerance function of LsAAP7a, LsAAP1b and their upstream transcription factors, filling a research gap in this field. The results provide new insights into the molecular mechanisms of lettuce yield traits and also reserve key gene resources for high-yield breeding practices, possessing potential application and economic value. Attached Figure Description

[0035] Figure 1 This is a schematic diagram of the principal component analysis results of two tissues under salt stress in Lola. cLsaL and sLsaL are the control group and salt stress group of Lola leaves, respectively; cLsaR and sLsaR are the control group and salt stress group of Lola roots, respectively.

[0036] Figure 2 This is a schematic diagram of the results of differentially expressed genes (DEGs) analysis. |log2(FC)| >=1 and P-adj < 0.05 were used as the criteria for screening DEGs. Red represents DEGs that are significantly upregulated, blue represents DEGs that are significantly downregulated, and gray represents DEGs that have no significant change.

[0037] Figure 3 The image shows the GO enrichment results for upregulated and downregulated DEGs in the leaves of Lola.

[0038] Figure 4 The image shows the GO enrichment results for upregulated and downregulated DEGs in Loragan.

[0039] Figure 5 The image shows the KEGG enrichment results of upregulated and downregulated DEGs in the leaves of Lorra.

[0040] Figure 6The image shows the KEGG enrichment results for upregulated and downregulated DEGs in Loragan.

[0041] Figure 7 Phylogenetic tree constructed for AAP protein sequences of five plants: At Arabidopsis thaliana, Ls lettuce, Ha sunflower, Os rice, and Zm maize.

[0042] Figure 8 This is a gene structure diagram of the LsAAP gene family members. Yellow squares represent exons, black lines represent introns, and the 5′ and 3′ untranslated regions (UTRs) are shown in blue squares.

[0043] Figure 9 This is a diagram showing the conserved motif analysis of LsAAPs.

[0044] Figure 10 This is an amino acid sequence alignment diagram of conserved motifs in LsAAPs. The font size indicates the frequency of each amino acid.

[0045] Figure 11 This is a map showing the distribution of the AAP gene in lettuce on chromosomes.

[0046] Figure 12 This is a diagram of intraspecific collinearity analysis of the lettuce AAP gene. The gray lines represent gene duplication events across the entire lettuce genome, while the red lines are used to identify intraspecific collinearity associations within the LsAAP gene family.

[0047] Figure 13 This diagram shows the interspecific collinearity between lettuce, Arabidopsis thaliana, and sunflower. The gray line indicates collinearity between lettuce and other plant genomes, while the blue line indicates collinear AAP gene pairs.

[0048] Figure 14 This is a diagram of the cis-acting elements in the promoter of the lettuce AAP gene.

[0049] Figure 15 This is a predicted three-dimensional structure of the lettuce AAP protein.

[0050] Figure 16 The image shows a heatmap of the expression of the Lora AAP gene in leaves and roots under salt stress. Red indicates high expression and blue indicates low expression.

[0051] Figure 17 Subcellular localization map of the fusion proteins 1300-GFP-LsAAP7a and 1300-GFP-LsAAP1b.

[0052] Figure 18This is a heatmap showing the expression levels of eight transcription factors before and after salt stress. cLsaL1, cLsaL2, and cLsaL3 represent the control group (Lola leaves), while sLsaL1, sLsaL2, and sLsaL3 represent the salt stress group (Lola leaves). Red indicates high expression, and blue indicates low expression.

[0053] Figure 19 The heatmap shows the correlation between LsAAP7a and LsAAP1b and the expression levels of eight transcription factors. Red indicates a positive correlation, and blue indicates a negative correlation. * indicates P ≤ 0.05, which is statistically significant, and ** indicates P ≤ 0.01, which is highly statistically significant.

[0054] Figure 20 The image shows the self-activation detection of the LsAAP7a-pAbAi and LsAAP1b-pAbAi recombinant vectors.

[0055] Figure 21 This is a diagram validating the yeast mono- and heterozygous interactions of eight transcription factors with LsAAP7a.

[0056] Figure 22 This is a diagram validating the yeast mono- and heterozygous interactions of eight transcription factors with LsAAP1b.

[0057] Figure 23 This is a phenotypic diagram of salt stress in T3 generation transgenic Arabidopsis thaliana. LsAAP7a-OE indicates overexpression of lettuce LsAAP7a in Arabidopsis Ataap7 mutant, LsAAP1b-OE indicates overexpression of lettuce LsAAP1b in Arabidopsis Ataap6 mutant, and LsTGA4-OE indicates overexpression of lettuce LsTGA4 in Arabidopsis Attga1 mutant.

[0058] Figure 24 The graph shows the biomass changes of T3 generation transgenic Arabidopsis under salt stress. LsAAP7a-OE indicates overexpression of lettuce LsAAP7a in Arabidopsis Ataap7 mutant, LsAAP1b-OE indicates overexpression of lettuce LsAAP1b in Arabidopsis Ataap6 mutant, and LsTGA4-OE indicates overexpression of lettuce LsTGA4 in Arabidopsis Attga1 mutant. One-way ANOVA was used, with P < 0.05 as the significance criterion. Different letters in the graph represent significant differences.

[0059] Figure 25The figure shows the free amino acid content in leaves and roots of T3 generation transgenic Arabidopsis thaliana under salt stress. LsAAP7a-OE indicates overexpression of lettuce LsAAP7a in Arabidopsis Ataap7 mutant, LsAAP1b-OE indicates overexpression of lettuce LsAAP1b in Arabidopsis Ataap6 mutant, and LsTGA4-OE indicates overexpression of lettuce LsTGA4 in Arabidopsis Attga1 mutant. One-way ANOVA was used, with P < 0.05 as the significance criterion. Different letters in the figure represent significant differences.

[0060] Figure 26 This is a graph showing the expression levels of LsAAP7a and LsAAP1b in VIGS lettuce. pTRV2 represents lettuce injected with the empty pTRV2 vector culture, pTRV2-LsAAP7a represents lettuce injected with the pTRV2-LsAAP7a recombinant vector culture, and pTRV2-LsAAP1b represents lettuce injected with the pTRV2-LsAAP1b recombinant vector culture. One-way ANOVA was used, with P < 0.05 as the significance criterion. Different letters in the graph represent significant differences.

[0061] Figure 27 The phenotypic diagrams of VIGS lettuce under 150 mmol / L NaCl stress for two weeks are shown. pTRV2 represents lettuce injected with pTRV2 empty vector bacterial solution, pTRV2-LsAAP7a represents lettuce injected with pTRV2-LsAAP7a recombinant vector bacterial solution, and pTRV2-LsAAP1b represents lettuce injected with pTRV2-LsAAP1b recombinant vector bacterial solution.

[0062] Figure 28 The graph shows the changes in fresh and dry weight of VIGS lettuce leaves under salt stress. pTRV2 represents lettuce injected with the empty pTRV2 vector bacterial solution, pTRV2-LsAAP7a represents lettuce injected with the recombinant pTRV2-LsAAP7a vector bacterial solution, and pTRV2-LsAAP1b represents lettuce injected with the recombinant pTRV2-LsAAP1b vector bacterial solution. One-way ANOVA was used, with P < 0.05 as the significance criterion. Different letters in the graph represent significant differences.

[0063] Figure 29 This figure shows the free amino acid content in the leaves of lettuce under VIGS salt stress. pTRV2 represents lettuce injected with the empty pTRV2 vector solution, pTRV2-LsAAP7a represents lettuce injected with the recombinant pTRV2-LsAAP7a vector solution, and pTRV2-LsAAP1b represents lettuce injected with the recombinant pTRV2-LsAAP1b vector solution. One-way ANOVA was used, with P < 0.05 as the significance criterion. Different letters in the figure represent significant differences. Detailed Implementation

[0064] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. In the following description of the embodiments, specific details such as particular system structures and techniques are set forth for illustrative purposes and not for limitation, in order to provide a thorough understanding of the embodiments of this application. However, those skilled in the art will understand that the present application can also be implemented in other embodiments without these specific details. In other instances, detailed descriptions of well-known systems, apparatuses, and methods are omitted so as not to obscure the description of this application with unnecessary detail.

[0065] It should be understood that, when used in this specification and the appended claims, the term "comprising" indicates the presence of a described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or a collection thereof. It should also be understood that the term "and / or" as used in this specification and the appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations. As used in this specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrase "if determined" or "if detected [the described condition or event]" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once detected [the described condition or event]," or "in response to detection [the described condition or event]."

[0066] Furthermore, in the description of this application and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" in this application mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in still other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "comprising," "including," "having," and variations thereof mean "including but not limited to," unless otherwise specifically emphasized.

[0067] Example 1: Gene expression analysis and whole-genome analysis of the AAP gene family in lettuce under salt stress

[0068] This embodiment uses a reference transcriptome analysis method to analyze the transcriptome data of cultivated lettuce Lorra under salt stress, screen key genes and pathways responding to salt stress, and perform whole-genome identification, bioinformatics analysis and expression pattern analysis of key genes in lettuce, laying the foundation for subsequent functional verification.

[0069] 1.1 Experimental Materials

[0070] 1.1.1 Plant Samples and Culture Methods

[0071] The plant material used in this experiment, cultivated lettuce L. sativa 'Lollo Rosso' (Lsa), was preserved in our laboratory.

[0072] Cultivation method: Place lettuce seeds soaked in 0.1% agarose solution on a shaker (20℃, 200 rpm) and shake until the seeds show white sprouts. Sow the sprouted seeds into sterilized culture substrate (Zhengzhou Jinshiji Horticulture Materials Co., Ltd.) and cultivate in a light cultivation room (16 h light / 8 h dark, 22℃, 50% humidity).

[0073] Salt stress treatment: Two-week-old seedlings were treated with 150 mmol / L NaCl, and roots and leaves of plants with uniform growth were sampled at 0, 12, 24 and 48 hours of salt stress. Three biological replicates were set up for each tissue for each treatment.

[0074] 1.1.2 Analysis Tools

[0075] The online databases and bioinformatics analysis tools used in the analysis are shown in Table 1.1.

[0076] Table 1.1 List of Online Databases and Bioinformatics Analysis Tools

[0077]

[0078] 1.2.1 Analysis of lettuce transcriptome data

[0079] 1.2.1.1 Sequencing quality assessment, sequence alignment, and quantification of gene expression levels.

[0080] Download the NCBI (National Center for Biotechnology Information) website to cultivate Lola lettuce (Lsa) at 0 mmol / L and 150 Transcriptome data of leaves and roots under mmol / L salt stress for 14 days were obtained. The SRR numbers of the samples are: cLsaL_1 (SRR26800544), cLsaL_2 (SRR26800543), cLsaL_3 (SRR26800532), sLsaL_1 (SRR26800527), sLsaL_2 (SRR26800526), ​​sLsaL_3 (SRR26800525), cLsaR_1 (SRR26800524), cLsaR_2 (SRR26800523), cLsaR_3 (SRR26800522), sLsaR_1 (SRR26800521), sLsaR_2 (SRR26800542), and sLsaR_3 (SRR26800541). cLsaL_1, cLsaL_2, and cLsaL_3 were leaf control groups, and sLsaL_1, sLsaL_2, and sLsaL_3 were leaf experimental groups; cLsaR_1, cLsaR_2, and cLsaR_3 were root control groups, and sLsaR_1, sLsaR_2, and sLsaR_3 were root experimental groups.

[0081] Illumina sequencing raw data is stored in FASTQ file format, which includes the identifier, base composition, and sequencing quality score for each sequencing read. Fastp (https: / / github.com / OpenGene / fastp) software was used to perform quality control and filtering on the raw data of each sample. This mainly included removing reads with adapters, reads containing too many N bases (N refers to undetermined base sequences), and low-quality reads (reads with Qphred <= 20 bases comprising more than 50% of the total read length). Through this process, high-quality clean data was finally obtained for subsequent analysis.

[0082] This study used the lettuce genome V11 version data as a reference genome. Hisat2 was used to align the clean data with the reference genome, and Samtools was used to convert the resulting SAM format files to BAM format to evaluate the alignment results. StringTie software was used to obtain the counts and FPKM values ​​for each gene. To eliminate the influence of differences in gene length, sequencing depth, and data volume between samples on expression level comparisons, FPKM value was selected as a standardized quantitative indicator of gene expression levels.

[0083] 1.2.1.2 Principal Component Analysis (PCA) was used to reduce the dimensionality of whole-genome expression data, making it easier to compare differences between samples. The `prcomp` function from the `stats` package in R was used for PCA analysis, and scatter plots containing biological replicates of each sample were generated to assess intragroup consistency and intergroup variability.

[0084] 1.2.1.3 Differentially expressed gene analysis

[0085] Based on the gene counts data in section 2.2.1.1, differential expression analysis was performed on data from different tissues and treatments of lettuce using the Deseq2 package in R. cLsaL and cLsaR were used as control groups, and sLsaL and sLsaR were used as treatment groups. |log2(Fold Change)| >= 1 and P-adj < 0.05 were used as criteria for screening differentially expressed genes (DEGs).

[0086] 1.2.1.4 GO and KEGG enrichment analysis of differentially expressed genes

[0087] The selected DEGs were subjected to functional enrichment analysis using Gene Oncology (GO) and KEGG (Kyoto Encyclopedia of Genes and Genomes, http: / / www.kegg.jp. / ). The GO database provides systematic functional annotations for genes, and its classification system covers three ontologies: cellular component (CC), biological process (BP), and molecular function (MF). The KEGG database contains biological functional data covering multiple levels, including cells, individuals, and even ecosystems, and is of great value for interpreting systemic biological changes reflected in genome sequencing and other high-throughput data. This study used TBtools software for GO / KEGG enrichment analysis and visualized the significant enrichment results using R language.

[0088] 1.2.2 Identification of members of the lettuce AAP gene family and analysis of their protein physicochemical properties

[0089] The genome sequence of lettuce (Lactuca sativa V8) was downloaded from EnsemblPlants. The protein sequence of the Arabidopsis AAP gene was downloaded from the Arabidopsis TAIR website, and a local BLAST search was performed on the lettuce genome. Additionally, a hidden Markov model of the Aa_trans (PF01490) domain was downloaded from the PFAM website, and lettuce protein sequences were screened using the hmmsearch command. Candidate protein sequences obtained through these two methods were uploaded to three online databases: SMART, NCBI CDD, and PFAM. Incomplete sequences and sequences lacking qualified conserved domains were removed. After merging and deduplication, the lettuce AAP gene family members were obtained. The molecular weight (MW) and isoelectric point (pI) of each gene were predicted using the ExPASy online tool, and subcellular localization was predicted using WoLF PSORT for analysis.

[0090] 1.2.3 Phylogenetic analysis of the lettuce AAP gene

[0091] AAP protein sequences from four species (Arabidopsis thaliana, maize, sunflower, and rice) were downloaded from Phytozome. Multiple sequence alignment of these protein sequences and the lettuce sequence was performed using ClustalW in MEGA11 software (default parameters), and a phylogenetic tree was constructed using the Neighbor-Joining (NJ) method with the bootstrap parameter set to 1000 replications. Finally, the phylogenetic tree was visualized and annotated using the EvolView online website.

[0092] 1.2.4 Analysis of gene structure and conserved protein motifs of the lettuce AAP gene

[0093] Gene structure diagrams were drawn using the Gene Structure Display Server (GSDS) online tool, displaying the arrangement of exons and introns. Conserved motif analysis of the lettuce AAP protein family was performed using the MEME program, with the following parameters set: maximum motif number of 10, arbitrary repeat pattern, and motif length ranging from 6 to 50 amino acid residues.

[0094] 1.2.5 Chromosomal localization and collinearity analysis of the lettuce AAP gene

[0095] Based on information from the lettuce genome database, chromosome length and LsAAP gene location data were obtained, and homology analysis was performed on LsAAP family members. Using Mapgene2chrom software, a chromosome location map of the lettuce AAP gene was constructed based on the origin position of each gene and its corresponding chromosome length. To investigate the evolutionary relationships of the AAP gene among different species, the One Step MCScanX plugin of TBtools was used to perform collinearity analysis on three species (lettuce, Arabidopsis thaliana, and sunflower). After removing fragmented sites, the data was visualized using the Dual Systeny Plot plugin.

[0096] 1.2.6 Cis-regulatory element analysis of the lettuce AAP gene

[0097] To elucidate the expression regulation mechanism of the LsAAP gene, the promoter sequence 2000 bp upstream of its transcription start site was extracted using the PlantCARE Server online tool, and the cis-acting elements contained therein were identified. Subsequently, the distribution of these elements in the promoter region was mapped using GSDS.

[0098] 1.2.7 Three-dimensional structure prediction of lettuce AAP gene

[0099] The LsAAP protein sequence was submitted to the SWISS-MODEL online platform, and its three-dimensional structural model was constructed based on the model with the highest QMQE score.

[0100] 1.2.8 Total RNA extraction and cDNA synthesis

[0101] RNA extraction was performed with strict avoidance of RNase contamination, and all procedures were conducted using sterilized consumables (including pipette tips and centrifuge tubes). RNA was extracted from lettuce tissue using the Novizan FastPure® Universal Plant Total RNA Isolation Kit (RC411-01), with three biological replicates for each treatment.

[0102] The specific procedure is as follows: Place approximately 0.1g of sample into a sterile grinding tube containing 3 RNase-free grinding beads and grind thoroughly into powder using a grinder. RNA extraction steps must strictly follow the kit instructions. After extraction, RNA concentration is determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, United States), and purity is assessed using the A260 / A280 ratio. If gel electrophoresis shows no degradation and the concentration meets requirements, the next step is to use the Novizan HiScrip® III All-in-one RT SuperMix Perfectfor qPCR kit (R333-01) for reverse transcription to synthesize cDNA. Reaction system:

[0103]

[0104] 1.2.9 Real-time quantitative PCR

[0105] For the 18 members of the lettuce AAP gene family, primers were designed based on the CDS sequence of the genes using SnapGene software, following the principle that PCR products should be around 200 bp. The primers were then submitted to the Primer-BLAST database of NCBI (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) for verification of the amplification product specificity. The primer sequences were synthesized by Zhengzhou Branch of Sangon Biotech Co., Ltd., and TUB was selected as the internal reference gene, referring to the study by Borowski et al.

[0106] Table 1.2 LsAAP gene qPCR primer sequences

[0107]

[0108] The qRT-PCR kit used was CWBIO UltraSYBR Mixture (LowROX) (Beijing Kangwei Century Biotechnology Co., Ltd.). The following reagents were added to the 96-well plate:

[0109]

[0110] Each gene and internal control gene was configured with 3 biological replicates and 2 technical replicates. qRT-PCR was performed using a LightCycler® 96Instrument (Roche Diagnostics GmbH, Germany) according to the following procedure:

[0111]

[0112] 1.3.1 Genetic response of lettuce to salt stress

[0113] 1.3.1.1 Quality control, quantification, and principal component analysis of sequencing data

[0114] The quality of all sequencing data was verified using the Fastp program, yielding a total of 529,691,038 raw reads. The Q30 base correctness rate for all samples was 100%, indicating good sequencing quality (Table 1.3). GC content ranged from 43.22% to 44.65%, consistent with the GC content characteristics of lettuce. Statistical results indicate high reliability of the sequencing results. After filtering the data for quality issues, a total of 526,975,678 high-quality clean reads and 77.99 G of clean bases were obtained.

[0115] Table 1.3 Quality control of transcriptome data and results of alignment with reference genome.

[0116]

[0117] Principal component analysis results showed that the first two principal components cumulatively explained 90.1% of the total variance, with the first principal component accounting for 84.0% and the second principal component accounting for 6.1%. Furthermore, the leaf and root tissues were completely separable, indicating good tissue specificity. Figure 1 ).

[0118] 1.3.1.2 Differential Gene Identification and Enrichment Analysis

[0119] A total of 3747 DEGs were identified in the Lola leaflets, including 2474 upregulated DEGs and 1273 downregulated DEGs. Figure 2 -A), a total of 2737 DEGs were identified in Loragan, including 1157 upregulated DEGs and 1580 downregulated DEGs ( Figure 2 -B).

[0120] In Lola leaves, upregulated DEGs were significantly enriched to 51 GO terms, among which the main biological processes included transmembrane transport (GO:0055085, P-adj = 1.95E-07), DNA replication (GO:0006260, P-adj = 4.03E-04), translocation (GO:0006810, P-adj = 0.003), localization (GO:0051234, P-adj = 0.0036), localization (GO:0051179, P-adj = 0.0036), and DNA double-strand unwinding (GO:0032508, P-adj = 0.0189). Cellular components were mainly the cell membrane (GO:0016020, P-adj = 4.28E-11) and cellular anatomy (GO:0110165, P-adj = 0.016). The activities of oxidoreductase (GO:0016491, P-adj = 4.25E-14), UDP-glycosyltransferase (GO:0008194, P-adj = 4.25E-14), catalytic activity (GO:0003824, P-adj = 9.92E-14), glycosyltransferase (GO:0016757, P-adj = 1.49E-13), copper ion binding (GO:0005507, P-adj = 1.30E-12), and monooxygenase (GO:0004497, P-adj = 3.09E-11) were enriched by molecular function. Figure 3 -A).

[0121] Downregulated DEGs in Lola leaf tissue were significantly enriched to 46 GO terms, mainly including protein biosynthesis (GO:0160307, ​​P-adj = 4.91E-04), translation (GO:0006412, P-adj = 4.91E-04), biosynthesis (GO:0009058, P-adj = 6.47E-04), monocarboxylic acid biosynthesis (GO:0072330, P-adj = 8.24E-04), fatty acid biosynthesis (GO:0006633, P-adj = 0.001), and fatty acid metabolism (GO:0006631, P-adj = 0.0013). Ribosomes (GO:0005840, P-adj = 2.65E-08), membraneless organelles (GO:0043228, P-adj = 6.34E-08), nucleosomes (GO:0000786, P-adj = 8.70E-04), protein-DNA complexes (GO:0032993, P-adj = 0.0013), organelles (GO:0043226, P-adj = 0.004), ribosome structural components (GO:0003735, P-adj = 2.75E-08), structural molecule activity (GO:0005198, P-adj = 4.17E-07), DNA sequence-specific binding (GO:0043565, P-adj = 0.004) Figure 3 -B).

[0122] In the loragan, upregulated DEGs were significantly enriched into 25 GO terms, including biological processes such as cell recognition (GO:0008037, P-adj = 6.55E-04), pollen recognition (GO:0048544, P-adj = 6.55E-04), carbohydrate metabolism (GO:0005975, P-adj = 0.0077), and sucrose metabolism (GO:0005985, P-adj = 0.0077). Cellular components were mainly cell membrane (GO:0016020, P-adj = 1.46E-05), membrane protein complex (GO:0098796, P-adj = 8.69E-04), and oxidoreductase complex (GO:1990204, P-adj = 0.001). Oxidoreductase activity (GO:0016491, P-adj = 1.79E-13), flavin adenine dinucleotide binding (GO:0050660, P-adj = 1.79E-13), catalytic activity (GO:0003824, P-adj = 1.91E-08), heme binding (GO:0020037, P-adj = 3.67E-05), tetrapyrrole binding (GO:0046906, P-adj = 4.35E-05), and monooxygenase activity (GO:0004497, P-adj = 4.39E-05) are the cellular functions enriched by (GO:0004497, P-adj = 4.39E-05). Figure 4 -A).

[0123] Loragan downregulated DEGs significantly enriched 72 GO terms, mainly including homeostasis processes (GO:0042592, P-adj = 7.4E-04), monatomic ion homeostasis (GO:0050801, P-adj = 7.4E-04), chemical homeostasis (GO:0048878, P-adj = 7.4E-04), cellular homeostasis (GO:0019725, P-adj = 7.4E-04), cell membrane homeostasis (GO:0016020, P-adj = 9.23E-04), DNA-binding transcription factor activity (GO:0003700, P-adj = 2.01E-06), transcription regulatory factor activity (GO:0140110, P-adj = 3.09E-06), and transport protein activity (GO:0005215, P-adj = 7.4E-04). 3.86E-06), transmembrane transporter activity (GO:0022857, P-adj = 4.04E-06), passive transmembrane transporter activity (GO:0022803, P-adj = 4.68E-06) Figure 4 -B).

[0124] Lola leaf upregulation significantly enriched 35 KEGG pathways, mainly including terpene and polyketide metabolism (ko09109, P-adj = 4.51E-08), amino acid metabolism (ko09105, P-adj = 0.0015), lipid metabolism (ko09103, P-adj = 1.99E-04), carbohydrate metabolism (ko09101, P-adj = 4.12E-05), DNA replication (ko03030, P-adj = 4.68E-07), transport proteins (ko02000, P-adj = 1.56E-07), zeatin biosynthesis (ko00908, P-adj = 0.006), and terpene skeleton biosynthesis (ko00900, P-adj = 0.006). 0.0098), α-linolenic acid metabolism (ko00592, P-adj = 0.0042), glutathione metabolism (ko00480, P-adj = 0.006), tyrosine metabolism (ko00350, P-adj = 2.33E-04), arginine and proline metabolism (ko00330, P-adj = 0.0011), cysteine ​​and methionine metabolism (ko00270, P-adj = 0.0022), fatty acid degradation (ko00071, P-adj = 1.51E-04), glycolysis (ko00010, P-adj = 8.04E-07) Figure 5 -A).

[0125] Downregulated DEGs in Lola leaves significantly enriched 17 KEGG pathways, including lipid metabolism (ko09103, P-adj = 6.16E-06), plant hormone signal transduction (ko04075, P-adj = 0.017), ribosomes (ko03010, P-adj = 1.45E-08), lipid biosynthesis proteins (ko01004, P-adj = 0.0049), porphyrin and chlorophyll metabolism (ko00860, P-adj = 0.009), glycerol ester metabolism (ko00561, P-adj = 0.039), cytochrome P450 (ko00199, P-adj = 0.008), photosynthesis-antenna proteins (ko00196, P-adj = 5.13E-14), and photosynthetic proteins (ko00194, P-adj = 0.008). 8.75E-09), keratin, substituent and wax biosynthesis (ko00073, P-adj = 2.11E-06), fatty acid elongation (ko00062, P-adj = 1.04E-06) Figure 5 -B).

[0126] Loragan upregulated DEGs significantly enriched 14 KEGG pathways, mainly including the metabolism of terpenoids and polyketides (ko09109, P-adj = 0.012), ion channels (ko04040, P-adj = 7.51E-04), phenylpropane biosynthesis (ko00940, P-adj = 0.048), starch and sucrose metabolism (ko00500, P-adj = 0.011), and tyrosine metabolism (ko00350, P-adj = 0.038). Figure 6 -A).

[0127] Downregulated DEGs in Lorragen significantly enriched 15 KEGG pathways, mainly including signal transduction (ko09132, P-adj = 0.022), plant hormone signal transduction (ko04075, P-adj = 0.022), transcription factors (ko03000, P-adj = 3.10E-05), transport proteins (ko02000, P-adj = 1.29E-08), nitrogen metabolism (ko00910, P-adj = 1.17E-05), starch and sucrose metabolism (ko00500, P-adj = 0.042), tryptophan metabolism (ko00380, P-adj = 0.048), phenylalanine metabolism (ko00360, P-adj = 0.011), and tyrosine metabolism (ko00350, P-adj = 0.041). Figure 6 -B).

[0128] 1.3.1.3 Identification and Analysis of Key Differentially Expressed Genes in Response to Salt Stress

[0129] Differential gene analysis under salt stress identified that the expression levels of many transporter-related genes were significantly upregulated under salt stress (Table 1.4), such as PIPs (aquaporins), PIN (auxin efflux carriers), and AAP (amino acid permeases).

[0130] Table 1.4 Identification of key response genes in lettuce under salt stress

[0131]

[0132] 1.3.2.1 Identification of members of the lettuce AAP gene family and analysis of protein physicochemical properties

[0133] This study identified 18 AAP genes in the whole genome of lettuce, which were named according to their homology with Arabidopsis AAP genes (Table 1.5). Physicochemical analysis showed that the full-length CDS of LsAAP ranged from 972 bp to 1539 bp, with protein lengths ranging from 323 aa to 512 aa, relative molecular masses from 35.39 kDa to 57.08 kDa, and theoretical isoelectric points ranging from 5.22 to 9.23. Except for LsAAP10a, LsAAP7a, LsAAP9, LsAAP7c, LsAAP7d, and LsAAP10b, the other LsAAP proteins were basic. Subcellular localization prediction results showed that most LsAAPs were located in the cell membrane, while LsAAP10a and LsAAP10b were located in vacuoles.

[0134] Table 1.5 LsAAP Family Member Information

[0135]

[0136] 1.3.2.2 Phylogenetic analysis of the lettuce AAP gene

[0137] Phylogenetic trees constructed from 93 AAP protein sequences showed that the AAP proteins of the five species could be divided into five groups. Among them, there were three members of the lettuce AAP family in Group 1 (LsAAP2a, LsAAP3a, LsAAP3b), eight members in Group 2 (LsAAP1a, LsAAP1b, LsAAP1c, LsAAP1d, LsAAP1e, LsAAP6a, LsAAP6b, LsAAP6c), and seven members in Group 3 (LsAAP7a, LsAAP7b, LsAAP7c, LsAAP7d, LsAAP9, LsAAP10a, LsAAP10b). There were no members of the lettuce AAP family in Groups 4 and 5. LsAAP7a is more closely related to AtAAP7, LsAAP6a, LsAAP6b, and LsAAP6c are more closely related to AtAAP6, and LsAAP3a and LsAAP3b are more closely related to AtAAP2 and AtAAP4, indicating that they may have similar functions. Figure 7 ).

[0138] 1.3.2.3 Analysis of gene structure and conserved protein motifs of the lettuce AAP gene

[0139] The lettuce AAP gene family members are structurally relatively conserved, with all members having more than five exons. In addition, the UTR regions of LsAAP3a and LsAAP3b, as well as the introns of LsAAP6a, LsAAP6b, and LsAAP6c, are relatively long. Figure 8 ).

[0140] Ten conserved motifs (motif 1–10) were identified in the lettuce AAP protein sequence, arranged in ascending order of their E-values. The shortest motif contains 21 amino acids (AAs), and the longest contains 50. Except for LsAAP10b, which contains only four motifs (motif 2, motif 5, motif 6, and motif 8), all other genes contain 10 conserved motifs, exhibiting structural conserved characteristics. Figure 9 , Figure 10 ).

[0141] 1.3.2.4 Chromosomal localization and collinearity analysis of the lettuce AAP gene

[0142] The 18 AAP members in lettuce are mainly distributed on 5 chromosomes, with the most on chromosome 9 (6 members) and the fewest on chromosome 3 (1 member). Figure 11 Furthermore, collinearity analysis of the lettuce AAP gene revealed six pairs of homologous genes in lettuce (LsAAP1a and LsAAP1c, LsAAP1a and LsAAP1b, LsAAP1a and LsAAP6a, LsAAP7c and LsAAP7d, LsAAP7c and LsAAP10a, LsAAP1b and LsAAP1c). Figure 12 ).

[0143] Interspecific collinearity analysis in Arabidopsis thaliana, lettuce, and sunflower revealed two pairs of homologous genes in lettuce and Arabidopsis thaliana, while 25 pairs of homologous genes were detected in lettuce and sunflower. Figure 13 ).

[0144] 1.3.2.5 Cis-regulatory element analysis of the lettuce AAP gene

[0145] To further elucidate the transcriptional regulatory mechanism of the AAP gene, the cis-regulatory elements contained in the upstream 2000 bp sequence of the gene's promoter region were analyzed. The results showed that this region mainly contains four types of regulatory elements, related to light response, hormone response, growth and development regulation, and abiotic stress response, respectively. Among these, the light-response elements mainly include Box 4, G-Box, TCT-motif, MRE, GT1-motif, and chs-CMA1a. In addition, the promoter region contains various cis-regulatory elements related to hormone signal transduction, such as the auxin-responsive element AuxRR-core, the abscisic acid-responsive element ABRE, the methyl jasmonic acid-responsive element CGTCA-motif, TGACG-motif, and TGA-element and P-box related to gibberellin and abscisic acid signaling. These cis-regulatory elements can integrate environmental stress signals and play an important role in coordinating plant stress responses (Table 1.6). Figure 14 The above results indicate that the AAP gene may play a key role in light signals and stress environments.

[0146] Table 1.6 Cis-acting elements found in more than 3 LsAAP genes

[0147]

[0148] 1.3.2.6 Three-dimensional structure prediction of lettuce AAP gene

[0149] The three-dimensional structural model prediction results showed that the secondary structure of lettuce AAP protein is mainly composed of transmembrane α-helices, with LsAAP10b having the fewest α-helices. In addition, most AAP proteins have a random coil at the N-terminus, and the C-terminus is located at the end of the transmembrane helical bundle. The overall structure is conserved. Figure 15 ).

[0150] 1.3.2.7 Analysis of AAP gene expression patterns

[0151] Quantitative real-time PCR results showed that the expression levels of all 18 AAP gene family members in *Lola* changed significantly under salt stress. In leaves, the expression levels of LsAAP1a, LsAAP6b, LsAAP6c, LsAAP1c, LsAAP7b, LsAAP7c, LsAAP1d, LsAAP1e, and LsAAP10a showed a decreasing trend after salt stress, while the expression levels of other genes showed an increasing trend. After 12 hours of salt stress, the members with the largest increases in expression in *Lola* leaves were LsAAP7a and LsAAP1b. Therefore, LsAAP7a and LsAAP1b were subsequently selected for functional verification. Figure 16-A). In the Loragan genome, except for LsAAP7b and LsAAP1e, the expression levels of AAP gene family members showed a similar trend under salt stress, all increasing in response to salt stress. Most AAP gene expression peaked at 24 hours of salt stress, while LsAAP6c, LsAAP3b, LsAAP7d, and LsAAP9 peaked at 12 hours. Figure 16 -B).

[0152] Transcriptome analysis of lettuce under salt stress identified 3747 DEGs in leaves and 2737 DEGs in roots. GO and KEGG enrichment analyses revealed that pathways such as transporter protein metabolism, terpene and polyketide metabolism, tyrosine metabolism, arginine and proline metabolism, lipid metabolism, and zeatin biosynthesis are key pathways in lettuce's response to salt stress. Among these, AAP family members showed significant differences in expression before and after salt stress.

[0153] Eighteen LsAAP gene family members were identified in lettuce, with full-length CDS ranging from 972 bp to 1539 bp and theoretical isoelectric points ranging from 5.22 to 9.23. Most LsAAP proteins were basic, and their gene structures were relatively conserved. The promoters of most LsAAP genes contained a number of stress-related cis-acting elements, indicating that AAP genes may be involved in abiotic stress processes in plants. Expression pattern analysis showed that the expression levels of all AAP genes in lettuce changed significantly within 48 h of salt stress.

[0154] Example 2: Functional validation of key members of the lettuce AAP gene family

[0155] Amino acids are the primary form of long-distance transport of organic nitrogen, translocated through the phloem to various plant organs and playing a role in numerous life processes, including protein synthesis, hormone metabolism, cell growth, and urea biosynthesis. Amino acid permeases (AAPs) are a plant-specific gene family, belonging to the amino acid / auxin permease family (ATF / AAAP) superfamily. The AAP gene family has relatively many members: 8 in Arabidopsis, 21 in sorghum (Sorghum bicolor L.), 19 in tea (Camelliasinensis), 11 in apple (Malus × domestica Borkh.), and 19 in Chinese cabbage (Brassica oleracea L.). The expression of plant AAP genes is closely related to the content of free amino acids. Studies have shown that silencing the potato StAAP1 gene with RNAi reduced the content of free amino acids in the tubers by 50%, while the content of free amino acids in the roots and leaves of tomato plants overexpressing SlAAP6 was significantly increased.

[0156] This chapter investigates the expression locations of the LsAAP7a and LsAAP1b genes in lettuce through subcellular localization, and conducts yeast one-hybrid assays, Arabidopsis transformation experiments, and lettuce VIGS silencing experiments to preliminarily explore the functional mechanisms of LsAAP7a and LsAAP1b under salt stress, providing a certain molecular basis for the study of lettuce salt tolerance.

[0157] 2.1 Experimental Materials

[0158] 2.1.1 Plant Samples and Culture Methods

[0159] The Lola and Nicotiana benthamiana seeds used in this experiment were all preserved in the laboratory. AtAAP6 (SALK_140384C), AtAAP7 (SALK_110124C), and AtTGA1 (SALK_125345C) knockout Arabidopsis seeds were purchased from the Arashare website.

[0160] The planting method for lettuce is the same as in 1.1.1.

[0161] Tobacco cultivation: Sow tobacco seeds in sterilized culture medium and cultivate them in a light culture room (16 h light / 8 h dark, 22℃, 50% humidity) for 3 to 4 weeks.

[0162] Cultivation of Arabidopsis thaliana: After sterilization, Arabidopsis thaliana seeds are sown on sterile MS medium and cultured under light for 7 days before being transplanted into small pots to continue growing.

[0163] 2.1.2 Test reagents and equipment

[0164] The main experimental reagents used are: ddH2O and 75% alcohol.

[0165] The kits used in the experiment included: FastPure® Universal Plant Total RNA Isolation Kit (plant total RNA extraction), HiScrip® III All-in-one RT SuperMix Perfect for qPCR Kit (reverse transcription), 2×Taq Plus Master Mix II (Dye Plus) (PCR amplification), FastPure Gel DNA Extraction Mini Kit (product recovery), 5 min TA / Blunt-Zero Cloning Kit (T vector ligation), ClonExpress® II One Step Cloning Kit (seamless cloning), and FastPure® Plasmid Mini Kit (plasmid extraction). All these kits were from Nanjing Novizan Biotechnology Co., Ltd. The CWBIO UltraSYBR Mixture was used for qRT-PCR detection. The (LowROX) kit was from Beijing Kangwei Century Biotechnology Co., Ltd.; reagents used in the yeast one-hybrid experiment, such as PEG / LiAC yeast transformation medium and salmon sperm DNA, were from Beijing Kubo Co., Ltd.; culture medium powder (LB liquid / solid) was purchased from Solarbio Co., Ltd.; restriction endonucleases BamHI, XbaI, KpnI, XbaI, SmaI and EcoRI were from Thermo Fisher Scientific.

[0166] The main equipment used in the experiment included: water bath, shaker, centrifuge, pipette, -80℃ ultra-low temperature freezer, -20℃ freezer, 4℃ freezer, grinder, PCR instrument, clean bench, ice maker, ELISA reader, real-time quantitative PCR instrument, sterilizer, balance, gel imaging system, vortex mixer, intelligent light incubator, ultra-micro spectrophotometer (Thermo Fisher Scientific, NanoDrop2000), oven, etc.

[0167] 2.1.3 Strains and Plasmids

[0168] The strains and plasmids used in the experiment are shown in Table 2.1.

[0169] Table 2.1 Information on strains and plasmids

[0170]

[0171] 2.1.4 Culture medium preparation

[0172] The culture media used in the experiment included LB liquid, LB solid and MS solid media.

[0173] The preparation method for each liter of LB liquid culture medium is as follows:

[0174] Add 25g of liquid culture medium powder to an Erlenmeyer flask containing 900ml of deionized water and stir with a glass rod to dissolve.

[0175] Bring the volume to 1L with deionized water.

[0176] Sterilize at 121℃ for 20 minutes.

[0177] The preparation method for each liter of LB solid culture medium is as follows:

[0178] 1) Add 40g of solid culture medium powder to an Erlenmeyer flask containing 900ml of deionized water and stir with a glass rod to dissolve.

[0179] 2) Make up to 1L with deionized water.

[0180] 3) Sterilize at 121℃ for 20 minutes.

[0181] 4) After sterilization, place it in a 55℃ oven to keep warm. After the temperature drops to a temperature that is not hot to the touch (about 55℃), add the corresponding antibiotics in the clean bench and gently shake to mix.

[0182] 5) Pour about 10 mL of culture medium into each sterile petri dish and let it stand in the laminar flow hood to allow it to solidify naturally.

[0183] The preparation method for each liter of MS solid culture medium is as follows:

[0184] Add 41.45g of solid culture medium powder to an Erlenmeyer flask containing 900ml of deionized water and stir with a glass rod to dissolve.

[0185] Bring the volume to 1L with deionized water.

[0186] Adjust the pH to 5.7-5.9.

[0187] Sterilize at 115℃ for 30 minutes

[0188] After sterilization, place it in a 55℃ oven to keep warm. Once the temperature drops to a comfortable level (approximately 55℃), add the appropriate antibiotics to the clean bench and gently shake to mix.

[0189] Pour about 10 mL of culture medium into each sterile petri dish and let it stand in the laminar flow hood to allow it to solidify naturally.

[0190] 2.2 Experimental Methods

[0191] 2.2.1 Construction of Recombinant Vector

[0192] 2.2.1.1 Full-length cloning of the target gene

[0193] Based on the gene expression pattern analysis results in section 2.3.2.7, LsAAP7a and LsAAP1b, whose expression levels increased the most after salt stress in the leaves of *Lola*, were selected for further functional validation. Primers were designed using SnapGene software based on their CDS sequences, and primer specificity was verified using Primer-BLAST. The primer sequences were synthesized by Zhengzhou Branch of Sangon Biotech Co., Ltd.: LsAAP7a-F / R: ATGGGCGACTACACAGAAGAC (SEQ ID NO: 49) / TCTCAATCTGGCGGATATGAGTC (SEQ ID NO: 50), LsAAP1b-F / R: ATGTCGAGTCATTCGATAGCAG (SEQ ID NO: 51) / GGATACGGATTGAAACGGTTC (SEQ ID NO: 52).

[0194] RNA from Lola leaves was reverse transcribed into cDNA. Then, using the cDNA as a template, PCR amplification was performed using 2×Taq PlusMaster Mix II (Dye Plus) (P213-2, Vazyme Biotech). The PCR system is as follows. The amplification products were detected by 1% agarose gel electrophoresis at 120 V for about 20 min, and analyzed using a gel imaging system.

[0195]

[0196] 2.2.1.2 Purification of the target fragment

[0197] Gel extraction was performed using the FastPure Gel DNA Extraction Mini Kit (DC301, Vazyme Biotech) according to its instructions. After concentration was measured using NanoDrop 2000, the gel was stored at -20°C.

[0198] 2.2.1.3 Target Fragment Fragment Ligation with T-Vector

[0199] T-vector ligation was performed using the 5-min TA / Blunt-Zero Cloning Kit (C601, Vazyme Biotech).

[0200] 2.2.1.4 Transformation of Escherichia coli

[0201] Add 1 µL of the ligation product to 50 µL of competent DH5α cells, mix gently, and incubate on ice for 30 minutes.

[0202] Heat shock in a 42°C water bath for 60 seconds, then immediately transfer to ice to cool for 2 minutes.

[0203] Add 400 µL of antibiotic-free LB liquid medium and incubate at 37°C and 200 rpm for 1 hour.

[0204] Preheat the LB solid medium plates with kanamycin resistance in an incubator at 37°C.

[0205] Centrifuge at 5000 rpm for 1 minute, discard 250 µL of supernatant, resuspend the cells in the remaining culture medium, and spread 100 µL evenly on LB plates containing kanamycin resistance. Incubate at 37°C for 16 hours.

[0206] Pick a single colony and inoculate it into 500 uL of LB liquid medium containing kanamycin resistance. Incubate at 37°C and 200 rpm for 16 hours until the bacterial cells become turbid.

[0207] 2.2.1.5 Colony PCR

[0208] Using the cultured bacterial cells as a template, colony PCR was performed using the universal primers M13-F: CAGGAAACAGCTATGAC (SEQ ID NO: 53) and M13-R: GTAAAACGACGGCCAGT (SEQ ID NO: 54) on the T vector. The system is shown below:

[0209]

[0210] 2.2.1.6 Plasmid Extraction

[0211] Plasmids were extracted from the sequenced bacterial culture according to the FastPure® Plasmid Mini Kit (DC201-01, Vazyme Biotech) method, and the concentration was measured with NanoDrop 2000 before being stored at -20°C.

[0212] 2.2.2 Subcellular localization of LsAAP7a and LsAAP1b in lettuce

[0213] 2.2.2.1 Primer Design

[0214] Based on the CDS sequences of LsAAP7a and LsAAP1b, primers containing XbaI and KpnI restriction sites were designed, including the first 15 bp before the XbaI restriction site and the last 15 bp after the KpnI restriction site in the 1300-GFP vector. The primer sequences were synthesized by Zhengzhou Branch of Sangon Biotech Co., Ltd. (Table 2.2).

[0215] Table 2.2 Subcellular localization seamless cloning primer sequences

[0216]

[0217] 2.2.2.2 Extraction of 1300-GFP empty vector plasmid

[0218] The method for plasmid extraction is the same as in 2.2.1.6.

[0219] 2.2.2.3 Linearized Carrier

[0220] Thaw the 1300-GFP empty plasmid on ice, and then add the following mixture to the ice:

[0221]

[0222] 2.2.2.4 Seamless Cloning

[0223] Seamless cloning and ligation of gene fragments with linearized vectors were performed in accordance with the instructions of the ClonExpress® II One Step Cloning Kit (C112, Vazyme Biotech).

[0224] Pick a single colony that has been cultured for 16 h on a plate and place it in 500 uL of liquid LB medium containing kanamycin resistance. Shake at 37°C and 200 rpm for 16 h until the colony becomes turbid.

[0225] Colony PCR was performed using universal primers on the vector: GFP-F: GGATAAATAGCCTTGCTTCCT (SEQ ID NO: 59) and GFP-R: CTTGCCGTAGGTGGCATCG (SEQ ID NO: 60). After electrophoresis, the bacterial culture with suitable bands was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0226] 2.2.2.5 Agrobacterium-mediated transformation

[0227] For bacterial cultures with correct sequencing, plasmids were extracted using the same method as in 2.2.1.6. The concentration was measured using a NanoDrop 2000. The extracted 1300-GFP-LsAAP7a and 1300-GFP-LsAAP1b plasmids were introduced into Agrobacterium competent cells according to the instructions of Daling Biotechnology DL-GV3101 Chemically Competent Cell (DLC301).

[0228] Pick a single colony from a plate that has been cultured for 3 days and place it in 2 mL of LB liquid medium (50 mg / mL rifampicin and 50 mg / mL kanamycin). Incubate at 28°C and 200 rpm for 1 day.

[0229] After electrophoresis, the colony PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Once the sequencing results were confirmed to be correct, glycerol was added for preservation, and the products were stored in an ultra-low temperature freezer.

[0230] 2.2.2.6 Instantaneous transformation of tobacco

[0231] 1) Agrobacterium tumefaciens suspension containing the 1300-GFP empty vector, the constructed recombinant vector, and the cell membrane localization vector was streaked onto LB solid medium (50 mg / mL rifampicin and 50 mg / mL kanamycin), inverted in a 28°C incubator, and cultured for 48 h. Single colonies were picked and transferred to 500 μL LB liquid medium (50 mg / mL rifampicin and 50 mg / mL kanamycin), activated at 28°C and 200 rpm for 24 h, and then transferred to 30 mL LB medium (50 mg / mL Kan and 50 mg / mL Rif), and expanded cultured at 28°C and 200 rpm.

[0232] 2) When the bacterial suspension OD600 = 0.6-0.8, collect the bacterial cells by centrifugation at 4000 rpm for 10 min. Resuspend the Agrobacterium cells in infection solution (containing 10 mM MgCl2, 10 mM MES, and 150 µM acetylsylcholine) until OD600 = 0.8-1.0. Incubate at 28°C in the dark for 2 h, and then thoroughly mix equal volumes of the expression vector resuspension and the nuclear localization vector resuspension.

[0233] 3) Using a disposable sterile syringe with the needle removed, draw up an appropriate amount of Agrobacterium infection solution and slowly inject the Agrobacterium infection solution into the entire tobacco leaf through a small incision. Grow in the dark for 12 hours, and then transfer to light conditions to continue growing for 36 hours.

[0234] 4) Cut a 1cm piece with the blade. 2 The left and right leaves were placed on a glass slide and photographed under a confocal microscope.

[0235] 2.2.3 Yeast mono- and hetero-interactions

[0236] 2.2.3.1 Cloning of the target gene

[0237] Based on the first 1500 bp sequences of the promoters of LsAAP7a and LsAAP1b and the CDS sequences of the selected transcription factors, full-length PCR primers were designed using SnapGene software. The product specificity of the designed primer sequences was verified using Primer-BLAST from the NCBI database. The primer sequences were synthesized by Zhengzhou Branch of Sangon Biotech Co., Ltd. (Table 2.3).

[0238] Table 2.3 Primer sequences for yeast one-hybrid gene cloning

[0239]

[0240] 2.2.3.2 Primer Design

[0241] Based on the first 1500 bp sequence of the LsAAP7a promoter, primers containing KpnI and XhoI restriction sites were designed, including the first 15 bp of the KpnI restriction site and the last 15 bp of the XhoI restriction site in the pAbAi vector; based on the first 1500 bp sequence of the LsAAP1b promoter, primers containing EcoRI and SmaI restriction sites were designed, including the first 15 bp of the EcoRI restriction site and the last 15 bp of the SmaI restriction site in the pAbAi vector; based on the CDS sequences of the screened transcription factors, primers containing EcoRI and BamHI restriction sites were designed, including the first 15 bp of the EcoRI restriction site and the last 15 bp of the BamHI restriction site in the PGADT7 vector. The primer sequences were synthesized by Sangon Biotech Co., Ltd., Zhengzhou Branch (Table 2.4).

[0242] Table 2.4 Primer sequences for seamless yeast one-hybrid cloning

[0243]

[0244] 2.2.3.3 Linearized Carrier

[0245] The method for linearizing the vector is the same as in 2.2.2.3. The pAbAi plasmid was linearized using KpnI and XhoI, as well as EcoRI and SmaI restriction enzymes (the optimal temperatures for EcoRI and SmaI restriction enzymes are 37℃ and 25℃, respectively. When linearizing the vector, it was first incubated at 25℃ for 1.5 h and then at 37℃ for 1.5 h). The PGADT7 plasmid was linearized using EcoRI and BamHI restriction enzymes.

[0246] 2.2.3.4 Seamless Cloning

[0247] The seamless cloning method is the same as in 2.2.2.4. The promoter fragments of the LsAAP7a and LsAAP1b genes were inserted into the pAbAi vector containing ampicillin, and the CDS sequences of the selected transcription factors were inserted into the PGADT7 vector containing ampicillin.

[0248] The primer sequences for colony PCR used universal primers on the vector: pAbAi-F: GTTCCTTATATGTAGCTTTCGACA (SEQ ID NO: 101), pAbAi-R: CCATCTCGAAAAAGGGTTTGCC (SEQ ID NO: 102); PGADT7-F: CGACTCACTATAGGGCGAG (SEQ ID NO: 103), PGADT7-R: AGATGGTGCACGATGCACAG (SEQ ID NO: 104).

[0249] For bacterial cultures with correct sequencing results, plasmids were extracted using the method described in 2.2.1.6, and their concentration was measured using a NanoDrop 2000.

[0250] 2.2.3.5 Linearization of pBait-AbAi plasmid

[0251] The linearization method for the vectors is the same as in 2.2.2.3. LsAAP7a-pAbAi and LsAAP1b-pAbAi were linearized using BstBI restriction enzyme at 65℃ for 1 h. The digestion products were run on a 1% agarose gel and purified using the gel recovery method described in 3.2.1.2. After concentration measurement, the products were stored at -20℃.

[0252] 2.2.3.6 pBait-AbAi to convert Y1HGold

[0253] Yeast competent cells were transformed according to the Y1HGold Chemically Competent Cell (YC1001, Weidi Biotechnology) instructions. After colony PCR identification, positive strains were streaked on SD / -Ura plates, incubated at 29℃ for 72 h, and stored at 4℃. This strain is the Y1HGold[Bait / AbAi] strain.

[0254] 2.2.3.7 Screening of Y1HGold[Bait / AbAi] strain based on AbA concentration

[0255] The optimal concentration of AbA (basidiomycin) varies depending on the bait fragment. Therefore, it is necessary to screen the optimal AbA concentration for each bait yeast strain, as follows:

[0256] Pick a single colony (2-3 mm) of Y1HGold[Bait / AbAi] strain and resuspend it in 1 mL of 0.9% sodium chloride solution, and adjust the OD600 to 0.2.

[0257] Dilute with 0.9% sodium chloride solution 10 times, 100 times, and 1000 times in sequence (i.e., OD600 = 0.2, 0.02, 0.002, 0.0002).

[0258] 10 μL was spotted onto SD / -Ura and SD / -Ura with AbA (100 ng / mL, 200 ng / mL, 300 ng / mL, 500 ng / mL, 800 ng / mL, 1000 ng / mL) plates, respectively.

[0259] Incubate at 30℃ for 2-3 days, observe the growth of bait yeast on plates with different AbA concentrations, and determine the optimal AbA concentration.

[0260] 2.2.3.8 Preparation of Y1HGold[pBait] competent cells

[0261] Select a single clone of strain Y1HGold[Bait / AbAi] and culture it in a centrifuge tube containing 3 ml of YPDA and 15 ml of YPDA.

[0262] 30℃, 250rpm, 12h.

[0263] Pipette 5 μL into 50 mL of YPDA and incubate in an Erlenmeyer flask until the OD600 reaches 0.15–0.3.

[0264] Centrifuge at 700g at room temperature for 5 minutes, discard the culture medium, and resuspend in 100ml of fresh YPDA.

[0265] The OD600 of the culture was 0.4-0.5 when cultured at 30℃.

[0266] Aliquot the bacterial culture into 50ml centrifuge tubes, centrifuge at 700g to collect the bacterial culture, discard the culture medium, resuspend in 30ml of sterile water, and centrifuge at 700g for 5min.

[0267] Resuspend in 1.5 ml of 1.1x TE / LiAC and transfer to a 1.5 ml centrifuge tube. Centrifuge at 12,000 rpm for 15 seconds.

[0268] Remove the supernatant and resuspend each tube in 600 μL of 1.1x TE / LiAC. Competent cells are now ready.

[0269] 2.2.3.9 Prey plasmid transformation

[0270] The Prey plasmid was transformed into the prepared competent cells using the method described in 2.2.3.6, and the cells were plated on SD- / Ura / Leu plates and incubated at 30°C for 3–5 days. Positive strains were used for subsequent interaction verification after colony PCR identification.

[0271] 2.2.3.10 Mutual Verification

[0272] After successful transformation, a fresh single colony (2-3 mm) was picked from each sample and resuspended in 1 mL of 0.9% sodium chloride solution, with the OD600 adjusted to 0.2. Then, it was successively diluted 10-fold, 100-fold, and 1000-fold with 0.9% sodium chloride solution (i.e., OD600 = 0.2, 0.02, 0.002, 0.0002). Following the order of experimental group first, then control group, 5 μL of each group was spotted onto the corresponding SD- / Ura / Leu with AbA plates and incubated at 30℃ for 2-3 days. The growth status of each group on the plates was observed to determine whether there was an interaction.

[0273] 2.2.4 Arabidopsis transformation

[0274] 2.2.4.1 Primer Design

[0275] Based on the CDS sequences of LsAAP7a, LsAAP1b, and LsTGA4, XbaI and BamHI restriction sites were designed. Specific primers were designed based on the 15 bp before the XbaI restriction site and the 15 bp after the BamHI site in the vector plasmid p1300-35S-mCherry-Flag. The primer sequences were synthesized by Zhengzhou Branch of Sangon Biotech Co., Ltd. (Table 2.5).

[0276] Table 2.5 Primer sequences for Arabidopsis thaliana transformation

[0277]

[0278] 2.2.4.2 Linearized Carrier

[0279] The p1300-35S-mCherry-Flag plasmid was linearized using XbaI and BamHI restriction enzymes according to the method described in 3.2.2.3 for linearizing vectors.

[0280] 2.2.4.3 Seamless Cloning

[0281] The seamless cloning method is the same as in 2.2.2.4. The CDS fragments of LsAAP7a, LsAAP1b, and LsTGA4 were inserted into the kanamycin-resistant p1300-35S-mCherry-Flag vector, respectively, to recombinantly form 1300-LsAAP7a, 1300-LsAAP1b, and 1300-LsTGA4. The colony PCR primers were: 1300-F: GACACGGGGGACTCTAG (SEQ ID NO: 111), 1300-R: TTGGAGCCGTACATGAACTGA (SEQ ID NO: 112). Plasmids were extracted from the bacterial cultures with correct sequencing results using the method in 2.2.1.6, and their concentration was measured using a NanoDrop 2000.

[0282] 2.2.4.4 Agrobacterium-mediated transformation

[0283] The method for Agrobacterium transformation is the same as in 2.2.2.5.

[0284] 2.2.4.5 Genetic transformation of Arabidopsis mutants

[0285] Take 500 uL of Agrobacterium that has been identified as positive by PCR, add it to 50 mL of LB liquid medium (50 mg / mL rifampicin and 50 mg / mL kanamycin) and culture at 28℃ and 200 rpm.

[0286] When the bacterial culture OD600 is 0.6-0.8, collect the bacterial cells by centrifugation at 4000 rpm for 10 min. Resuspend the bacterial cells in 5% sucrose solution (containing 0.03% Silwet L-77) until OD600 = 1.0. After resuspending, add 150 μmol / L AS (acetylsyl eugenol), shake well, and use as the infection solution.

[0287] The day before infection, cut off the pods and fully open flowers of Arabidopsis thaliana and water thoroughly.

[0288] Pour the infection solution into a petri dish, completely immerse the Arabidopsis inflorescence in it, and let it stand for 30-60 seconds.

[0289] After infection, the plants should be kept in darkness for 24 hours, followed by normal light exposure. A second infection can be performed 7 days after the first infection, and subsequent infections can be repeated as needed for the experiment.

[0290] After the Arabidopsis seeds mature, collect them, dry them, and store them in a refrigerator at 4°C.

[0291] 2.2.4.6 Resistance Screening and Molecular Identification in Transgenic Arabidopsis

[0292] T0 generation transgenic Arabidopsis seeds were removed from a 4°C freezer and cultured on a selection medium. The method is as follows:

[0293] Take an appropriate amount of Arabidopsis thaliana seeds for disinfection: disinfect with 75% alcohol for 30 seconds, rinse three times with sterile water, disinfect with 2% NaClO for 60 seconds, and rinse three times with sterile water.

[0294] The seeds were resuspended in sterile water, and a certain amount of suspension was evenly spread on MS medium containing 50 mg / mL hygromycin. After sealing with sealing film, the medium was cultured for one week at 20°C under 16 h light and 8 h darkness.

[0295] After the plants have grown true leaves, individuals with green leaves and roots are selected as positive plants. When they grow to 6-8 true leaves, genomic DNA is extracted and PCR is performed for identification.

[0296] Total RNA was extracted from transgenic Arabidopsis thaliana and reverse transcribed into cDNA. The expression of cDNA was then detected using cDNA as a template.

[0297] 2.2.4.7 Determination of physiological indicators in transgenic Arabidopsis thaliana under salt stress

[0298] Two-week-old mutants and transgenic Arabidopsis were subjected to 150 mmol / L NaCl stress. One week after the stress, the phenotypes of each line and the dry and fresh weights of the aboveground parts (leaves) and underground parts (roots) were recorded. The free amino acid content in leaves and roots after salt stress was determined using the method in the amino acid content assay kit (M0501A, Suzhou Mengxi Biomedical Technology Co., Ltd., Suzhou, China). One-way ANOVA was used, and P < 0.05 was used as the significance criterion.

[0299] 2.2.5 VIGS Silence

[0300] 2.2.5.1 Primer Design

[0301] Based on the CDS sequences of LsAAP7a and LsAAP1b, and following the principle that PCR products should be 200bp-300bp, EcoRI and BamHI restriction sites were designed. Specific primers were designed based on the 15 bp before the EcoRI restriction site and the 15 bp after the BamHI site in the pTRV2 vector plasmid. The primer sequences were synthesized by Zhengzhou Branch of Sangon Biotech Co., Ltd. (Table 2.6).

[0302] Table 2.6 VIGS silencing primer sequences

[0303]

[0304] 2.2.5.2 Linearized Carrier

[0305] The pTRV2 plasmid was linearized using EcoRI and BamHI restriction enzymes according to the method described in section 2.2.2.3 for linearizing vectors.

[0306] 2.2.5.3 Seamless Cloning

[0307] The seamless cloning method is the same as in 2.2.2.4. The CDS fragments of LsAAP7a and LsAAP1b were inserted into the kanamycin-resistant pTRV2 vector, respectively, to recombinantly form pTRV2-LsAAP7a and pTRV2-LsAAP1b. The colony PCR primers were: pTRV2-F: CCCACATATTCGCACGTATG (SEQ ID NO: 117), pTRV2-R: CGAGAATGTCAATCTCGTAGGT (SEQ ID NO: 118). Plasmids were extracted from the bacterial cultures with correct sequencing results using the method in 2.2.1.6, and their concentration was measured using a NanoDrop 2000.

[0308] 2.2.5.4 Agrobacterium-mediated transformation

[0309] The method for Agrobacterium transformation is the same as in 2.2.2.5.

[0310] 2.2.5.5 Instantaneous Transformation of Lettuce

[0311] Agrobacterium suspensions containing pTRV1, pTRV2 empty vectors, pTRV2-LsAAP7a, and pTRV2-LsAAP1b recombinant vectors were streaked onto LB solid medium (50 mg / mL rifampicin and 50 mg / mL kanamycin) and incubated upside down at 28°C for 48 h. Single colonies were picked and transferred to 500 μL of LB medium (50 mg / mL rifampicin and 50 mg / mL kanamycin) and activated at 28°C and 200 rpm for 24 h. Then, the colonies were transferred to 50 mL of LB medium (50 mg / mL Kan and 50 mg / mL Rif) and expanded at 28°C and 200 rpm.

[0312] When the bacterial suspension has an OD600 of 0.8-1.0, collect the bacterial cells by centrifugation at 4000 rpm for 10 min. Resuspend the Agrobacterium cells in infection buffer (containing 10 mM MgCl2, 10 mM MES, and 200 µM acetylsyleugenone) until the OD600 reaches 1.0. Incubate in the dark for 3 h, then thoroughly mix equal volumes of the Agrobacterium resuspension of pTRV1 and pTRV2 for later use.

[0313] Lettuce seedlings were divided into three groups: pTRV1+pTRV2 group (blank control), pTRV1+pTRV2-LsAAP7a group, and pTRV1+pTRV2-LsAAP1b group. Using a disposable sterile syringe with the needle removed, an appropriate amount of Agrobacterium-infected solution was drawn up and slowly injected into the cotyledons of lettuce seedlings with 4 leaves and 1 bud through a small incision. The seedlings were then allowed to grow in the dark for 24 hours.

[0314] 2.2.5.6 Screening for VIGS-positive vaccines

[0315] Two weeks after injection, newly grown lettuce leaves were harvested, and DNA was crudely extracted using the following method:

[0316] Take the middle section of the blade into a grinding tube containing two grinding beads, add 280 μL of coarse extraction buffer, and grind for 1 min.

[0317] Centrifuge at 12000 rpm for 10 min, immediately take 100 μL of supernatant, add 100 μL of isopropanol (-20℃, use immediately on ice), and let stand for 30 min.

[0318] Centrifuge at 12000 rpm for 10 minutes, discard the supernatant, wash once with 500 μL of 70% ethanol, discard the supernatant and let dry.

[0319] After drying, add 50 μL of filtered water (4°C).

[0320] Using the extracted DNA as a template, PCR was performed using universal primers on the pTRV2 vector according to method 3.2.1.1 to detect the transformation of the recombinant vector into plant leaves for preliminary screening. RNA was extracted from the plants after preliminary screening according to method 2.2.8, and the effectiveness of LsAAP7a and LsAAP1b genes being silenced was detected according to the quantitative method in 2.2.9. The quantitative primers are as follows: LsAAP7a-F / R: TAGGCGTGTGAGTGAGCAGT (SEQ ID NO: 119) / AACCCTCGTACTCTGCCTCTT (SEQ ID NO: 120); LsAAP1b-F / R: AAACTTCTGACGCAAGG (SEQ ID NO: 121) / CTCCATTAAATAAACACCC (SEQ ID NO: 122).

[0321] 2.2.5.7 Determination of physiological indicators of VIGS-positive plants under salt stress

[0322] The blank control group and the two experimental groups were subjected to 150 mmol / L NaCl stress. After two weeks, the dry and fresh weights and free amino acid content of the leaves after salt stress were measured according to the method in 2.2.4.7. One-way ANOVA was used, and P < 0.05 was used as the significance criterion.

[0323] 2.3 Results and Analysis

[0324] 2.3.1 Expression of LsAAP7a and LsAAP1b in the cell membrane

[0325] Subcellular localization experiments showed that green fluorescence signals were observed in both the cell membrane and nucleus of tobacco plants injected with the 1300-GFP empty vector, while the green fluorescence signals of tobacco plants injected with 1300-GFP-LsAAP7a and 1300-GFP-LsAAP1b overlapped with the red fluorescence signals, indicating that LsAAP7a and LsAAP1b proteins are localized on the cell membrane, consistent with previous subcellular localization predictions. Figure 17 ).

[0326] 2.3.2 Analysis of yeast heterozygosity and heterozygosity interactions

[0327] 2.3.2.1 Transcription factor screening

[0328] Based on the cis-regulatory elements in the promoter regions of LsAAP7a and LsAAP1b and the expression levels of transcription factors in lettuce leaves under salt stress, eight transcription factors were screened and found to be significantly increased under salt stress: LsbZIP23 (LOC111895643), LsbZIP46 (LOC111903164), LsMYC2 (LOC111899261) (the nucleotide sequence of the LsMYC2 gene is shown in SEQ ID NO: 9, and the amino acid sequence encoding the transcription factor is shown in SEQ ID NO: 10), LsWRKY26 (LOC111876545), LsMYB14 (LOC111881326), LsMYB44 (LOC111880252), LsRAX2 (LOC111893045), and LsTGA4 (LOC111909288). Figure 18 The correlation heatmap shows that LsbZIP23, LsbZIP46, LsMYC2, LsWRKY26, LsMYB14, LsMYB44, LsRAX2, LsTGA4 are all positively correlated with LsAAP7a and LsAAP1b, and the correlations are generally above 0.7, indicating that there may be an interaction between them. Figure 19 ).

[0329] 2.3.2.2 Yeast self-activation screening

[0330] To investigate the gene regulatory mechanisms involved by LsAAP7a and LsAAP1b, yeast one-to-many hybrid interaction experiments were conducted. Since the promoter itself may also activate reporter gene expression, self-activation assays were performed after transforming the LsAAP7a-pAbAi and LsAAP1b-pAbAi recombinant vectors into competent yeast cells to determine the optimal AbA selection concentrations for LsAAP7a-pAbAi and LsAAP1b-pAbAi. The results showed that yeast transformed with the LsAAP7a-pAbAi recombinant vector exhibited colony growth at 0 and 100 ng / mL AbA concentrations, but no colony growth was observed at 200 ng / mL AbA concentration. Therefore, a 200 ng / mL AbA concentration was used as the screening condition for interaction with LsAAP7a. Similarly, yeast transformed with the LsAAP1b-pAbAi recombinant vector exhibited colony growth at 0, 100, and 200 ng / mL AbA concentrations, but no colony growth was observed at 400 ng / mL AbA concentration. Therefore, a 400 ng / mL AbA concentration was used as the screening condition for interaction with LsAAP1b. Figure 20 ).

[0331] 2.3.2.3 Yeast one-hybrid analysis

[0332] Eight constructed pGADT7 recombinant vectors were transformed into prepared Y1HGold[LsAAP7a-pAbAi] competent cells. Single clones were selected for interaction detection. Yeast strains transformed with p53-pAbAi and PGADT7-p53 were used as positive controls, and yeast strains transformed with p53-pAbAi and PGADT7-REC2 were used as negative controls. The results showed that colony growth was observed in all groups at a concentration of 0 ng / mL AbA; however, at a concentration of 200 ng / mL AbA, no colony growth was observed in yeast transformed with PGADT7-LsbZIP23, PGADT7-LsbZIP46, PGADT7-LsWRKY26, PGADT7-LsMYB14, PGADT7-LsMYB44, PGADT7-LsRAX2, and LsAAP7a-pAbAi, respectively. Only yeast transformed with LsAAP7a-pAbAi, PGADT7-LsTGA4, LsAAP7a-pAbAi, and PGADT7-LsMYC2 showed colony growth, indicating that LsTGA4 and LsMYC2 can bind to the promoter of LsAAP7a, thereby activating the expression of LsAAP7a. Figure 21 ).

[0333] Similarly, the constructed pGADT7 recombinant vector was transformed into the prepared Y1HGold[LsAAP1b-pAbAi] competent cells, and single colonies were selected for interaction detection. Yeast strains transformed with p53-pAbAi and PGADT7-p53 were used as positive controls, and yeast strains transformed with p53-pAbAi and PGADT7-REC2 were used as negative controls. The results showed that colony growth was observed in all yeast groups at a concentration of 0 ng / mL AbA; however, at a concentration of 400 ng / mL AbA, no colony growth was observed in yeast transformed with PGADT7-LsbZIP23, PGADT7-LsbZIP46, PGADT7-LsMYC2, PGADT7-LsWRKY26, PGADT7-LsMYB14, PGADT7-LsMYB44, PGADT7-LsRAX2, and LsAAP1b-pAbAi, respectively. Only yeast transformed with LsAAP1b-pAbAi and PGADT7-LsTGA4 showed colony growth, indicating that LsTGA4 can bind to the promoter of LsAAP1b, thereby activating the expression of LsAAP1b. Figure 22 ).

[0334] 2.3.3 Validation of overexpression in Arabidopsis thaliana

[0335] 2.3.3.1 Statistical analysis of salt stress phenotypes in transgenic Arabidopsis thaliana

[0336] Based on the phylogenetic tree of AAP genes in different species ( Figure 7 In Arabidopsis thaliana, AtAAP7 is most closely related to LsAAP7a, and AtAAP6 is most closely related to LsAAP1b. Therefore, mutant Arabidopsis thaliana of AtAAP7 and AtAAP6 were selected as recipient Arabidopsis thaliana for overexpressing LsAAP7a and LsAAP1b, respectively. Furthermore, yeast single-hybrid analysis revealed that LsTGA4 can interact with both LsAAP7a and LsAAP1b. Therefore, mutant Attga1, which has the highest protein similarity to LsTGA4 in Arabidopsis thaliana, was selected as the recipient Arabidopsis thaliana for overexpressing LsTGA4.

[0337] T3 generation Arabidopsis thaliana (OE) overexpressing LsAAP7a, LsAAP1b, and LsTGA4 genes and mutant Arabidopsis thaliana were treated with 150 mmol / L NaCl for one week. The mutant plants had smaller and wilted leaves, while the overexpressing plants had larger leaves, indicating that LsAAP7a, LsAAP1b, and LsTGA4 can compensate for the phenotype of Arabidopsis thaliana mutants. Figure 23 ).

[0338] 2.3.3.2 Determination of physiological indicators in transgenic Arabidopsis thaliana under salt stress

[0339] To investigate the effects of LsAAP7a, LsAAP1b, and LsTGA4 on Arabidopsis biomass under salt stress, the biomass of T3 generation overexpressing Arabidopsis (OE) and mutant Arabidopsis was measured after one week of treatment with 150 mmol / L salt stress. The results showed that the fresh weight of leaves (… Figure 24 -A), Fresh weight of roots ( Figure 24 -B), leaf dry weight ( Figure 24 -C) and root dry weight ( Figure 24 In all four indicators (-D), the overexpressing Arabidopsis thaliana was higher than the mutant Arabidopsis thaliana, indicating that LsAAP7a, LsAAP1b, and LsTGA4 play an important role in the plant's response to salt stress.

[0340] 2.3.3.3 Determination of free amino acid content in transgenic Arabidopsis under salt stress

[0341] The content of free amino acids in leaves and roots of T3 generation overexpressing Arabidopsis thaliana and mutant Arabidopsis thaliana after one week of 150 mmol / L salt stress was determined using the ninhydrin colorimetric method. The results showed that the leaves of the overexpressing line Arabidopsis thaliana ( Figure 25 -A) and root ( Figure 25 The free amino acid content in LsAAP7a and LsAAP1b was higher than that in the mutant Arabidopsis thaliana, indicating that under salt stress, LsAAP7a and LsAAP1b can promote the accumulation of free amino acids in Arabidopsis thaliana.

[0342] 2.3.4 Lettuce Transient Silence Experiment

[0343] 2.3.4.1 Identification of VIGS-positive seedlings

[0344] To investigate the functions of LsAAP7a and LsAAP1b in lettuce under salt stress, these two genes were transiently silenced using virus-induced gene silencing (VIGS) technology. The expression levels showed that compared to plants injected with the empty vector (pTRV2), the expression levels of LsAAP7a and LsAAP1b in VIGS-treated plants were significantly reduced, indicating good silencing efficiency. Figure 26 ).

[0345] 2.3.4.2 Statistical analysis of salt stress phenotypes in silent lettuce lines

[0346] Empty vector (pTRV2) and VIGS-positive lettuce were subjected to 150 mmol / L NaCl stress, and phenotypic differences among the groups were recorded after two weeks. The results showed that under salt stress, compared with pTRV2, pTRV2-LsAAP7a and pTRV2-LsAAP1b plants had more dead leaves and slower growth, indicating that LsAAP7a and LsAAP1b play a positive regulatory role in lettuce salt tolerance. Figure 27 ).

[0347] 2.3.4.3 Determination of VIGS plant physiological indicators under salt stress

[0348] To investigate the effects of LsAAP7a and LsAAP1b on lettuce biomass under salt stress, the biomass of empty vector (pTRV2), pTRV2-LsAAP7a, and pTRV2-LsAAP1b plants was measured after two weeks of salt stress at 150 mmol / L. The results showed that the fresh leaf weight of pTRV2-LsAAP7a and pTRV2-LsAAP1b plants (…) Figure 28 -A) and blade dry weight ( Figure 28 -B) was significantly lower than that of pTRV2 empty plants, indicating that LsAAP7a and LsAAP1b play an important role in regulating lettuce's salt stress response.

[0349] 2.3.4.4 Determination of free amino acid content under salt stress

[0350] The free amino acid content in the leaves of lettuce plants subjected to 150 mmol / L salt stress for two weeks was determined using the ninhydrin colorimetric method. The results showed that the free amino acid content in the leaves of pTRV2-LsAAP7a and pTRV2-LsAAP1b plants was significantly lower than that of the empty vector, indicating that LsAAP7a and LsAAP1b can positively regulate the accumulation of free amino acids in lettuce leaves under salt stress. Figure 29 ).

[0351] Subcellular localization experiments showed that both LsAAP7a and LsAAP1b were localized on the cell membrane. Yeast one-hybrid assays indicated that LsTGA4 and LsMYC2 could interact with the promoter sequence of LsAAP7a, and LsTGA4 could interact with the promoter sequence of LsAAP1b. Furthermore, under salt stress, transgenic Arabidopsis overexpressing LsTGA4 could recover its mutant phenotype, and the biomass and free amino acid content of transgenic Arabidopsis overexpressing LsAAP7a and LsAAP1b were higher than those of the mutant Arabidopsis. The biomass and free amino acid content of leaves of lettuce plants with silenced LsAAP7a and LsAAP1b were significantly lower than those of the control group, indicating that LsAAP7a and LsAAP1b play an important role in lettuce's response to salt stress.

[0352] In this study, LsAAP7a and LsAAP1b were overexpressed in Arabidopsis mutants. The results showed that under salt stress, the biomass of the overexpressing plants was higher than that of the mutant plants, and the roots and leaves also had higher free amino acid content. Similarly, LsTGA4 in lettuce could also compensate for the phenotype of the Arabidopsis mutants. Combining the fresh weight, dry weight, and free amino acid content data of the leaves of lettuce plants with silenced LsAAP7a and LsAAP1b, it was found that LsTGA4 may regulate the accumulation of free amino acids and thus regulate salt tolerance in lettuce by binding to the promoter sequences of LsAAP7a and LsAAP1b.

[0353] Consistent with the findings of this study, numerous studies have demonstrated the correlation between amino acid content and plant tolerance to abiotic stresses. For example, most amino acid transporters promote amino acid accumulation and enhance plant stress resistance; in Arabidopsis, increased AtAAP1 expression promotes proline (Pro) accumulation, contributing to enhanced salt tolerance; overexpression of rice OsAAP4 can increase tillering and grain yield by increasing the content of neutral amino acids proline (Pro) and threonine (Thr), thus promoting plant growth. Furthermore, overexpression of SlAAP6 in plants accelerates the accumulation of intracellular free amino acids and promotes root growth in tomatoes under both control and salt stress conditions.

[0354] This study identified two positive regulators of salt stress in lettuce, LsAAP7a and LsAAP1b, and preliminarily investigated their functional mechanisms. This provides a certain material basis for cultivating salt-tolerant lettuce varieties and has potential application and economic value.

[0355] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail or recorded in a certain embodiment, please refer to the relevant descriptions of other embodiments.

[0356] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. A nucleic acid molecule for regulating salt tolerance in lettuce, characterized in that, The nucleic acid molecule is a gene as shown in (a), (b), or (c) below: (a) The LsAAP7a gene with a CDS sequence as shown in SEQ ID NO: 3, or the LsAAP1b gene with a CDS sequence as shown in SEQ ID NO: 4; (b) Nucleic acid molecules encoding amino acid sequences as shown in SEQ ID NO: 1 or SEQ ID NO: 2; (c) A variant sequence that has at least 95% sequence identity with the nucleotide sequence defined in (a) or (b) and is derived from lettuce and encodes a protein with the same function.

2. A recombinant expression vector, characterized in that, It includes the nucleic acid molecule of claim 1, and a promoter operatively linked upstream of the nucleic acid molecule.

3. A method for improving the salt tolerance of lettuce, characterized in that, This includes upregulating the expression levels of the LsAAP7a and / or LsAAP1b genes in lettuce, where: (a) The LsAAP7a gene encodes the protein shown in SEQ ID NO: 1; (b) The LsAAP1b gene encodes the protein shown in SEQ ID NO:

2.

4. The method for improving the salt tolerance of lettuce according to claim 3, characterized in that, The method for upregulating gene expression is as follows: a recombinant expression vector containing the gene is transformed into lettuce using Agrobacterium-mediated transformation to obtain transgenic lettuce that stably expresses the gene.

5. A method for improving the salt tolerance of lettuce, characterized in that, This includes upregulating the expression of the transcription factor LsTGA4 gene in lettuce.

6. The application of transcription factor LsTGA4 in improving salt tolerance in lettuce, characterized in that, The transcription factor LsTGA4 specifically binds to and activates the promoters of the LsAAP7a and LsAAP1b genes, promoting the accumulation of free amino acids in lettuce leaves and roots and improving the salt tolerance of lettuce. The nucleotide sequence of the LsTGA4 gene is shown in SEQ ID NO: 5, and the amino acid sequence encoding the transcription factor is shown in SEQ ID NO: 6; The LsAAP7a gene promoter sequence is shown in SEQ ID NO: 7; the LsAAP1b gene promoter sequence is shown in SEQ ID NO:

8.

7. The application of the nucleic acid molecule of claim 1, the recombinant expression vector of claim 2, or the transcription factor of claim 6 in the cultivation of salt-tolerant lettuce varieties.

8. A functional module for regulating the salt tolerance of lettuce, characterized in that, It contains the transcription factor LsTGA4 and the target genes LsAAP1b and / or LsAAP7a; the LsTGA4 transcription factor specifically binds to the promoter region of the target gene, positively regulates the expression of the target gene, promotes the accumulation of free amino acids in lettuce, and improves the salt tolerance of lettuce. The positive regulation is achieved by overexpressing the LsTGA4 gene or enhancing the activity of its encoded transcription factors.

9. A method for screening salt-tolerant lettuce germplasm, characterized in that, Includes the following steps: (1) Total RNA was extracted from the lettuce leaves to be tested and cDNA was obtained by reverse transcription; (2) Use specific primers to detect the expression levels of LsAAP1b and / or LsAAP7a genes in cDNA by qRT-PCR; and / or detect the expression level of LsTGA4 gene; (3) Using wild-type lettuce as a control, plants with significantly higher LsAAP1b and / or LsAAP7a gene expression levels than the control were selected as salt-tolerant candidate germplasm.

Images