Application of peach transcription factor PpCPRF2 in regulating plant rust or wax production

By constructing an overexpression vector for the peach transcription factor PpCPRF2, the accumulation of waxy substance in the fruit peel and the inhibition of russeting were promoted, thus solving the problem of unclear russeting formation mechanism in peach trees and achieving the effects of improving fruit quality and green pest control.

CN122484141APending Publication Date: 2026-07-31ZHONGYUAN RES CENT +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610850324.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-12
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

Existing research has not clarified the mechanism of fruit russeting in peach trees, especially the function of key genes for wax synthesis, the hormone-mediated wax regulatory network, and the role of bZIP transcription factor in wax deposition in the fruit cuticle.

Method used

By constructing an overexpression vector for the peach transcription factor PpCPRF2 and genetically transforming it in peach fruit and Arabidopsis thaliana, we verified its function in pericarp wax formation, promoting pericarp wax accumulation and inhibiting pericarp rust formation.

Benefits of technology

It significantly promotes the accumulation of wax in fruit peel and effectively inhibits the formation of fruit rust, revealing that PpCPRF2 enhances the accumulation of characteristic alkane components and resists fruit rust by positively regulating the expression of key genes in the wax synthesis pathway. This has the potential to be applied to fruit quality improvement and green prevention and control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122484141A_ABST
    Figure CN122484141A_ABST
Patent Text Reader

Abstract

This invention provides the application of peach transcription factor PpCPRF2 in regulating the formation of fruit rust or wax in plants, belonging to the field of genetic engineering technology. The amino acid sequence of the peach transcription factor PpCPRF2 is shown in SEQ ID NO.2. This invention constructs a peach transcription factor... PpCPRF2 A plant overexpression vector for the peach transcription factor PpCPRF2 was developed and its genetic transformation and functional verification were carried out in peach fruit and Arabidopsis thaliana. The results showed that overexpression of the peach transcription factor PpCPRF2 significantly promoted the accumulation of wax in the fruit peel and effectively inhibited the formation of fruit russeting; inhibiting the expression of this gene reduced the wax content in the fruit peel and exacerbated fruit russeting. This invention reveals for the first time the molecular mechanism by which the peach transcription factor PpCPRF2 resists fruit russeting by positively regulating the expression of key genes in the wax synthesis pathway and increasing the accumulation of characteristic alkane components. This gene and related expression vectors can be used to breed new peach and other fruit tree varieties with less fruit russeting and better commercial quality, and have important application value in fruit quality improvement and green pest control.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of peach transcription factor PpCPRF2 in regulating the formation of fruit rust or wax in plants. Background Technology

[0002] The peach (Prunus persica) is a fruit tree of great economic value worldwide, occupying an important position in the fresh and processed fruit market. However, late-maturing varieties and flat peaches are prone to fruit russeting during their growth and development. This physiological disorder causes brown or rust-like spots to form on the fruit surface, severely affecting the fruit's appearance, quality, and market value, and hindering the efficient and high-quality development of the peach industry. Therefore, exploring the physiological mechanisms and inducing factors of peach fruit russeting is of great significance for formulating prevention and control strategies and improving industry efficiency.

[0003] Fruit russeting is widespread in various fruit trees such as peach, pear, and apple, and its formation is closely related to the disorder of the cuticle and wax layer of the fruit peel and the excessive accumulation of lignin. In peaches, the formation of fruit russeting is positively correlated with the expression of the key gene Pp4CL1 / 2 in lignin biosynthesis, which is regulated by the transcription factor PpMYB5. The R2R3-MYB transcription factors PpMYB25 and PpMYB26 synergistically regulate trichome formation and cuticle wax biosynthesis. In nectarines, PpMYB25 is inactivated due to retrotransposon insertion, resulting in reduced wax accumulation and the formation of a smooth and shiny fruit surface. In pears, the formation of brown skin is related to the synthesis of cuticle and cork and programmed cell death. Bagging treatment can enhance cuticle thickness and reduce russeting by regulating the expression of related genes. Members of the nonspecific lipid transfer protein family also participate in wax transport and inhibit russeting formation.

[0004] Plant cuticle waxes play a crucial role in mitigating environmental stress, reducing water loss, and resisting pathogen invasion. Their biosynthesis primarily revolves around the synthesis and modification of very long-chain fatty acids (VLCFAs). In Arabidopsis thaliana, genes such as CER1, CER3, and CER4 are involved in wax component synthesis, the KCS gene family regulates VLCFA elongation, and ABCG transporters are responsible for the transmembrane transport of wax components. In fruit trees, several key enzyme genes for wax synthesis have been identified in species such as tomato, apple, navel orange, pear, and grape. However, research on the function of genes such as PpCERs in alkane biosynthesis in peach remains relatively scarce.

[0005] Plant hormones are key regulators of wax biosynthesis and accumulation. Abscisic acid (ABA), gibberellin (GA), and jasmonic acid (JA) all affect wax synthesis and structure by regulating the expression of related genes. Among them, ABA can alter the proportion of wax components and crystal structure by regulating the expression of wax metabolism genes, and can also enhance plant stress resistance by activating specific transcription factors. However, the hormone-mediated regulatory network of wax biosynthesis in the cuticle of peach fruit remains unclear.

[0006] Transcription factors play a crucial role in the precise regulation of wax biosynthesis, with members of the R2R3-MYB, AP2 / ERF, and bZIP families all involved in the regulation of wax-related genes. Several transcription factors regulating wax synthesis have been identified in species such as Arabidopsis, citrus, and apple. However, in peaches, the roles of other transcription factors (especially the bZIP family) in the deposition of wax in the fruit cuticle, apart from PpMYB25 and PpMYB26, remain poorly understood.

[0007] Current research has many gaps, such as the unclear functions of key genes in peach wax synthesis, the lack of elucidation of the hormone-mediated wax regulation network, and the unclear regulatory role of the bZIP transcription factor in peach wax synthesis. Therefore, this study focuses on ABA-mediated regulation of peach fruit wax synthesis, exploring the function and related regulatory pathways of the transcription factor PpCPRF2, providing a theoretical basis for the study of the molecular mechanisms of peach rust control and wax synthesis. Summary of the Invention

[0008] Based on this, this study focuses on the regulation of peach fruit wax synthesis mediated by ABA, and explores the function and related regulatory pathways of the transcription factor PpCPRF2, providing theoretical basis and technical support for the study of the molecular mechanism of peach fruit rust control and wax synthesis.

[0009] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0010] This invention provides the application of peach transcription factor PpCPRF2 in regulating the formation of fruit rust or wax in plants, and the amino acid sequence of the peach transcription factor PpCPRF2 is shown in SEQ ID NO.2.

[0011] The present invention also provides the application of the peach transcription factor PpCPRF2 gene in regulating the formation of wax and / or russeting in plant pericarps, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0012] Preferably, overexpression of the peach transcription factor PpCPRF2 promotes the formation of pericarp wax and inhibits the formation of russeting.

[0013] Preferably, the plants include Arabidopsis thaliana and peach.

[0014] The present invention also provides a method for promoting the formation of fruit peel wax and / or inhibiting the formation of fruit russeting, comprising the following steps:

[0015] (1) Using peach genomic cDNA as a template, the PpCPRF2 gene fragment was amplified;

[0016] (2) The PpCPRF2 gene fragment was ligated to the vector to obtain a recombinant plasmid;

[0017] (3) Introduce the recombinant plasmid into Agrobacterium and culture the recombinant Agrobacterium to OD. 600 =0.4~0.6, centrifuge, and collect the bacterial cells;

[0018] (4) Resuspend the bacterial cells in the infection buffer to obtain the working bacterial solution; incubate the working bacterial solution for 1.5-2.5 hours and then inject it into the peach fruit to obtain the final product.

[0019] Preferably, the primer sequences for amplifying the PpCPRF2 gene fragment are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0020] Preferably, the reaction system for ligating the PpCPRF2 gene with the vector is as follows: 4 μL of PpCPRF2 gene fragment, 1 μL of 5×TA / Blunt-Zero Cloning Mix; ligation is carried out at 37℃ for 15 min.

[0021] Preferably, the components of the infection buffer are: 20 mM 2-(N-morpholine) ethanesulfonic acid, 10 mM magnesium chloride, and 150 mM acetylsuccinone.

[0022] Preferably, the culture conditions for the recombinant Agrobacterium are: 28~30℃, 200~240 rpm.

[0023] Preferably, the OD of the working bacterial solution 600 It ranges from 0.4 to 0.6.

[0024] Preferably, the peach fruit is in the S2 development stage, and the injection volume for each peach fruit is 3-5 mL.

[0025] By adopting the above technical solution, the present invention has the following beneficial effects: The present invention provides the application of peach transcription factor PpCPRF2 in regulating the formation of fruit russeting in plants, belonging to the field of genetic engineering technology. The amino acid sequence of the peach transcription factor PpCPRF2 is shown in SEQ ID NO.2. The present invention constructs a plant overexpression vector of peach transcription factor PpCPRF2 and conducts genetic transformation and functional verification in peach fruit and Arabidopsis thaliana. The results show that overexpression of peach transcription factor PpCPRF2 can significantly promote the accumulation of wax in the pericarp and effectively inhibit the formation of fruit russeting; inhibiting the expression of this gene reduces the wax content in the pericarp and aggravates the occurrence of fruit russeting. The present invention reveals for the first time the molecular mechanism by which peach transcription factor PpCPRF2 resists fruit russeting by positively regulating the expression of key genes in the wax synthesis pathway and increasing the accumulation of characteristic alkane components. This gene and related expression vectors can be used to cultivate new peach and other fruit tree varieties with less fruit russeting and better commercial quality, and have important application value in fruit quality improvement and green control. Attached Figure Description

[0026] Figure 1 Analysis of wax composition of 14 nectarine varieties was conducted. Image A shows the fruits of the 14 selected nectarine varieties, from top to bottom and left to right: TH (Zhongyou Panwei Hou); 36-3 (Beiyuan 36-3); 9-20-1 (9th district, 20th row, 1st row); QN15 (Qiaonan 15); QN53-56 (Qiaonan 53-56); QN53-39 (Qiaonan 53-39); QN6-1 (Qiaonan 6-1); CN27 (Zhongyou 27); CN19 (Zhongyou 19); WD (Zhongyou Panwei Di); 48-23E (Beiyuan 48-23 Dong); QN53-1 (Qiaonan 53-1); QN14 (Qiaonan 14); QN13 (Qiaonan 13); Scale bar: 1 cm; B represents the presence or absence of pericarp rust in 14 peach varieties and its relationship with wax content. In each bar chart, the black line in the box plot represents the mean; groups marked with different letters indicate significant differences at the P < 0.01 level.

[0027] Figure 2 The distribution of wax components in the pericarp of rust- and rust-free peach varieties during the ripening period was shown. Among them, A represents alkanes, B represents fatty acids, C represents primary alcohols, D represents fatty aldehydes, E represents fatty esters, F represents ketones, G represents phenols, H represents triterpenes, and I represents vitamins. The groups marked with different letters indicate significant differences at the P < 0.05 level (n=3).

[0028] Figure 3 The study investigated the correlation between abscisic acid (ABA) and waxes with the occurrence of TH fruit russeting in flat peaches. A shows images of the two peach varieties selected for this study: WD (Zhongyou Panwei Di) and TH (Zhongyou Panwei Hou); scale bar: 3 cm. B shows the morphology of wax crystals on the exocarp surface of WD and TH. C shows the total ABA content during the development of the exocarp of WD and TH. D shows the total wax content during the development of the exocarp of WD and TH. E shows the analysis results of the proportion of specific wax components in WD and TH. F shows the correlation analysis results between ABA and wax content.

[0029] Figure 4 The content of jasmonic acid (A) and indole-3-acetic acid (B) in the pericarp of WD and TH during fruit development.

[0030] Figure 5To maintain high wax content and reduce rust spot area on TH fruit pericarp during development, ABA treatment was used. A represents the exocarp of TH fruit during development under ABA or the ABA inhibitor sodium tungstate (Na2WO4) treatment. Scale bar: 3 cm; B shows the wax morphology of the exocarp of TH fruit under ABA and Na2WO4 treatments using scanning electron microscopy (SEM); C represents the percentage of rust on TH fruit during development after ABA, Na2WO4, and CK treatments; D represents the total wax content of the exocarp of TH fruit during development after ABA, Na2WO4, and CK treatments; E shows the results of specific wax component ratio analysis.

[0031] Figure 6 Transcriptome analysis revealed that PpCPRF2 is a key ABA response regulator involved in wax synthesis; A is a statistical summary of differentially expressed genes among the transcriptome data; B is a Venn diagram of differentially expressed genes in the transcriptome data; C is a KEGG enrichment analysis of 954 DEGs; D is a heatmap of gene expression profiles related to wax biosynthesis in peach fruit exocarp based on RNA-seq; E is the expression of PpCPRF2 during the development of TH and WD exocarps; F is the relative expression of PpCPRF2 in the exocarp of TH fruit under ABA or Na2WO4 treatment (n=3); G is a schematic diagram of the reporter gene vector used in the GUS experiment; H) the activity of the PpCPRF2 promoter under ABA treatment, its promoter fragment fused with the GUS reporter gene, and transiently expressed in tobacco leaves through Agrobacterium-mediated transient transformation (n=6 biological replicates).

[0032] Figure 7 The figure shows the cis-component analysis results for the PpCPRF2 promoter.

[0033] Figure 8 Transient experiment using the 35S::PpCPRF2 overexpression construct in peach peel; A shows the morphology of waxy crystals under SEM after transient overexpression of 35S::PpCPRF2 in peach peel; B shows the wax content in pSAK277 (CK) and PpCPRF2-pSAK277 (PpCPRF2-OE); C shows the relative expression of PpCPRF2, PpCER3, PpABCG15, PpKCS20 and PpKCR1.

[0034] Figure 9 The content of specific components of the wax surrounding the injection site of peach pericarp was determined by PpCPRF2 overexpression.

[0035] Figure 10PpCPRF2 promotes wax accumulation in Arabidopsis thaliana in response to ABA; A shows the morphology of wax crystals on the stems of WT and transgenic plants after ABA or Na2WO4 treatment; B shows the total wax content of the stems of WT and transgenic plants after ABA and Na2WO4 treatment; C shows the results of specific wax component ratio analysis. Detailed Implementation

[0036] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0037] The sequence data of this invention can be queried in CPBD (Peach Database, http: / / www.peachmd.com / # / ): PpCPRF2 (Prupe.6G217300.v2.1), PpCER3 (Prupe.1G098000.v2.1), PpKCS20 (Prupe.1G025600.v2.1), PpABCG15 (Prupe.4G254600.v2.1).

[0038] Example 1. Functional verification of abscisic acid in regulating wax accumulation and rust spot formation in peach fruit

[0039] 1. Correlation analysis between the differences in wax composition and content of nectarine peel and the formation of russeting

[0040] To explore the physiological regulatory factors of peach fruit russeting, this study selected 14 nectarine varieties and divided them into two main groups based on the russeting phenotype: russeted and russet-free varieties. The components and contents of the epidermal wax of different peach varieties were systematically measured and compared. The results are as follows: Figure 1 As shown.

[0041] The results showed that the total wax content of the pericarp in rust-affected nectarine varieties was significantly lower than that in rust-free varieties. Further correlation analysis between rust trait and the content of various wax components revealed highly significant differences in the content of nine wax components—alkanes, primary alcohols, fatty acids, phenols, triterpenoids, and vitamins—between rust-affected and rust-free varieties (P < 0.01). Specifically, the accumulation of alkanes, fatty acids, and fatty aldehydes in the pericarp of rust-free varieties was 1.4–2.2 times that of rust-affected varieties. Figure 2 In summary, high wax content is beneficial in inhibiting the occurrence of peach russeting and reducing its incidence.

[0042] Based on this, the present invention further selected two nectarine varieties with similar genetic backgrounds, namely TH and WD, and carried out fruit development at different stages. Figure 3Comparative analysis of epidermal wax and fruit russeting in sample A). Scanning electron microscopy (SEM) microscopic observation results ( Figure 3 (B) The results showed that the two varieties had the same waxy crystal structure in their fruit peels, but during the S3-I and S3-III developmental stages, the WD variety had significantly more waxy crystals in its fruit peel than the TH variety. Quantitative analysis of the fruit peel wax using gas chromatography-mass spectrometry revealed significant dynamic changes in the waxy content during peach fruit development, ranging from 5021.8 to 15308.0 μg / dm³. 2 The overall trend was one of initial increase followed by a decrease, reaching its peak content during the S3-III period; during this period, the total wax content of the WD variety was 1.74 times that of the TH variety. The main wax components of peach fruit skin include alkanes, primary alcohols, very long-chain fatty acids, fatty acid methyl esters, and terpenoids. During the critical S3-III period of concentrated fruit russeting, the content of several characteristic alkane components in the WD variety significantly increased, with tricosane, tetracosane, and pentacosane contents reaching 605.13 μg / dm³. 2 64.94 μg / dm 2 1039.99 μg / dm 2 These figures were 3.5 times, 1.2 times, and 2.6 times higher than those of the TH variety, respectively. Figure 3 The presence of high abundance of specific alkane components (as shown in E and Table 1) indicates that the accumulation of these components is an important physiological characteristic of nectarine varieties in resisting the formation of fruit russeting.

[0043] Simultaneously, the hormone content in the fruit peel was determined, including abscisic acid (ABA), jasmonic acid (JA), and indole-3-acetic acid (IAA). Figure 4 The results showed that the ABA content in WD was significantly higher than that in TH at all developmental stages, exhibiting a trend of first increasing and then decreasing. Figure 3 (C). It is worth noting that this ABA fluctuation pattern is consistent with the change pattern of total wax content (C). Figure 3 F; correlation coefficient R 2 =0.778). These results indicate that the higher accumulation of alkanes and ABA in WD is a key factor in its higher total wax content compared to TH. Further research into the biosynthesis and regulatory mechanisms of these compounds will provide valuable insights into the formation mechanism of rust spots on peach exocarps.

[0044] Table 1. Composition and content of epidermal wax during TH and WD development stages

[0045] THS3-I1 482.05 1326.50 536.71 117.68 17.16 2.11 73.69 56.18 2770.94 3.37 5386.40 THS3-I2 384.82 979.61 565.80 100.08 32.80 1.61 113.09 76.20 1850.78 3.17 4107.94 THS3-I3 366.75 1043.50 518.35 113.47 29.70 1.88 89.05 42.96 3361.92 3.55 5571.12 THS3-III1 707.25 2055.21 1479.79 445.64 44.77 1.42 212.48 88.31 3784.76 9.79 8829.43 THS3-III2 521.72 2144.35 1706.57 524.24 92.68 7.85 257.88 104.88 4925.37 7.86 10293.40 THS3-III3 789.50 1820.76 1010.66 306.67 51.48 5.55 291.45 94.66 3169.44 3.79 7543.97 THS4-I1 601.78 1331.26 589.64 145.30 22.09 2.22 201.23 84.52 2977.33 7.48 5962.84 THS4-I1 395.36 1330.06 575.73 143.49 38.60 3.91 209.95 74.99 4075.16 3.45 6850.71 THS4-I1 545.82 1368.09 559.16 243.19 71.68 8.65 183.49 53.91 2078.30 2.91 5115.21 WDS3-I1 713.37 1871.64 704.67 162.06 25.19 1.55 145.22 111.56 4287.68 3.96 8026.89 WDS3-I2 870.06 1895.79 877.03 252.24 34.13 5.45 223.32 236.69 5082.14 5.93 9482.78 WDS3-I3 799.50 1668.81 833.48 193.13 60.01 9.35 297.88 185.26 3042.91 7.43 7097.76 WDS3-III1 1815.19 2768.08 1975.81 641.21 51.97 3.87 313.68 237.17 3844.40 13.45 11664.82 WDS3-III2 1880.08 4017.81 3010.37 850.47 67.87 2.42 390.82 317.28 6797.66 15.05 17349.83 WDS3-III3 1742.65 3996.61 2659.68 1184.21 73.89 3.72 479.75 437.69 6315.20 16.11 16909.51 WDS4-I1 754.29 1819.55 953.77 219.39 35.89 2.15 105.39 81.60 4580.52 3.01 8555.56 WD4-I1 817.69 1809.85 835.16 300.42 49.84 3.00 129.52 92.95 3675.05 2.71 7716.20 WDS4-I1 587.10 1894.84 1264.72 163.10 64.08 1.42 104.18 42.80 2774.26 2.05 6898.56

[0046] 2. Verification of exogenous ABA regulating peach fruit epidermal wax synthesis and inhibiting fruit russeting.

[0047] Previous studies have confirmed that plant hormones can regulate the expression of genes related to wax biosynthesis. To clarify the functional regulatory relationship between abscisic acid (ABA) and wax accumulation in the pericarp of peach fruit, this invention conducted a comparative treatment experiment on the rust-prone variety "Zhongyou Panweihou" (TH) during the S2 development stage of the fruit by exogenously spraying it with 200 mg / L ABA solution and 40 mM sodium tungstate solution, respectively.

[0048] The results showed that exogenous ABA spraying significantly reduced the area of ​​russeting on the outer pericarp of TH fruit; conversely, spraying sodium tungstate to inhibit the physiological activity of endogenous ABA significantly aggravated the severity of russeting. Figure 5 The statistical results of fruit russeting area further verified the above phenotypic differences, confirming that the degree of fruit russeting in the TH variety is closely related to the ABA content level. To clarify whether ABA regulation of fruit russeting formation depends on changes in the structure and content of fruit cuticle wax, scanning electron microscopy was used to observe the microstructure of fruit epidermal wax in different treatment groups. The results showed that ABA treatment significantly increased the distribution density of fruit epidermal wax crystals, while sodium tungstate treatment significantly reduced the number of wax crystals. Figure 5 (B)

[0049] Further quantitative analysis of the pericarp wax content in each group was performed using GC-MS / MS. The results showed that during the critical S3-III developmental stage, when russeting is most prevalent, the total wax content in the ABA-treated group was significantly higher than that in the control group and the sodium tungstate-treated group; the wax content in the control group was 8888.93 μg / dm³. 2 After ABA treatment, the wax content increased to 14799.88 μg / dm³. 2 The wax content in the sodium tungstate-treated group decreased to 5746.24 μg / dm³. 2 (Table 2). The variation pattern of total wax content in the pericarp under different treatments is consistent with the phenotypic changes in the degree of russeting in each treatment group. Figure 5 D, E).

[0050] During the critical period of fruit russeting (S3-III), the response of alkanes among the waxy components was the most significant. After exogenous ABA treatment, the relative proportion of alkanes in the fruit peel increased significantly from 7.6% to 13.7%; among them, the accumulation of tricosane, tetracosane, and pentacosane reached 599.36 μg / dm³. 2 72.92 μg / dm 2 1211.27 μg / dm 2 Compared to the blank control group, the levels increased by 3.5 times, 1.3 times, and 2 times, respectively. Conversely, in the sodium tungstate inhibition treatment group, the contents of the above three characteristic alkanes decreased by 5.53%, 39.38%, and 62%, respectively, compared to the control group. Figure 5(E in the text). A consistent regulatory pattern was observed during the S4-I development stage of the fruit: ABA treatment significantly increased the proportion of alkane in the peel from 6.8% to 13.8%, while sodium tungstate treatment reduced the proportion of alkane to 5.7%. The above experimental results indicate that abscisic acid (ABA) can positively regulate the synthesis and accumulation of key alkane wax components in the peach peel, thereby regulating the occurrence and development of rust spots on peach fruits.

[0051] 3. Transcriptome analysis revealed the association between PpCPRF2 expression and the wax content of peach fruit epidermis.

[0052] RNA-seq analysis helps identify upstream regulatory sequences of differentially expressed genes (DEGs), providing insights into transcriptional regulation. Because TH and WD samples showed significant differences in wax content across three different developmental stages, RNA-seq was performed on pericarp samples at these time points to identify DEGs. Strict quality control was implemented to ensure data reliability. Over 94.38% of the sequencing bases achieved a Q30 quality score (Table 2), confirming the high quality of the samples and sequencing data. A total of 14,092 DEGs were identified through RNA-seq analysis. Figure 6 (A). Compared to the TH sample, the WD sample had 2,202 and 2,404 DEGs upregulated and downregulated, respectively, during the S3-I period. Figure 4 In the S3-III period, WD samples showed 2,911 and 1,968 DEGs that were upregulated or downregulated, respectively. Figure 4 In the S4-I period, WD samples had 1,806 and 2,071 DEGs upregulated or downregulated, respectively. Figure 4 (China A, WDS3-I vs THS3-I). The three comparison groups contain a total of 954 DEGs ( Figure 6 (B) To explore the functional significance of DEGs, KEGG enrichment analysis was performed. This revealed a significant enrichment of genes in pathways such as plant hormone signal transduction and fatty acid biosynthesis (B). Figure 6 (C)

[0053] To identify key regulatory genes involved in the biosynthesis of wax in the cuticle of peach fruit, the KEGG pathway of fatty acid metabolism was the primary focus, as fatty acids are the most abundant component of wax. Figure 6(See Table 1). Candidate genes were screened based on the higher expression of WD relative to TH in RNA-seq data, and a heatmap of gene expression profiles related to peach wax synthesis was generated. This revealed differential expression of key alkane synthesis genes (such as PpCER1 and PpCER3) and genes encoding fatty acid elongation complexes (including PpKCR, PpKCS6, and PpKCS10). In addition, extensive transcriptional regulation of the stratum corneum metabolic pathway involving MYB, AP2 / EREBP, and bZIP family transcription factors was observed.

[0054] Among these differentially expressed genes (DEGs), a bZIP-type transcription factor, PpCPRF2, was identified. Throughout fruit exocarp development, the FPKM value of PpCPRF2 was significantly higher in WD than in TH, suggesting a potential role in wax synthesis. Figure 6 (E). To verify this hypothesis, RT-qPCR validation was performed ( Figure 6 As expected, ABA treatment significantly upregulated PpCPRF2 expression, peaking at S3-III with a 3.3-fold increase, while Na2WO4 inhibited its expression by 5.4-fold. Figure 6 Furthermore, analysis of the PpCPRF2 promoter revealed an ABA-responsive element (ABRE) containing the ACGT motif. Figure 7 Subsequent GUS experiments confirmed that the promoter activity of PpCPRF2 was significantly enhanced under ABA treatment, and gradually increased with increasing ABA concentration. Figure 6 Based on these results, PpCPRF2 was selected as a candidate transcription factor for further investigation. It may function as an ABA-responsive regulator involved in the transcriptional regulation of peach fruit wax biosynthesis.

[0055] Table 2 Statistical Analysis of RNA Sequencing

[0056] THS3-I-1 44437802 6.67G 41415150 6.21G 0.01 97.98 93.99 45.5 THS3-I-2 46752598 7.01G 44130648 6.62G 0.01 97.84 93.54 45.57 THS3-I-3 46272694 6.94G 45693600 6.85G 0.01 97.74 93.27 45.31 THS3-III-1 40161558 6.02G 37739136 5.66G 0.01 97.58 92.7 45.53 THS3-III-2 48274560 7.24G 44795568 6.72G 0.01 98.1 94.38 45.6 THS3-III-3 45361408 6.8G 42495052 6.37G 0.01 98.05 94.16 45.56 THS4-I-1 48282752 7.24G 47488698 7.12G 0.01 97.56 92.69 45.54 THS4-I2 40499690 6.07G 40474980 6.07G 0.01 97.93 93.88 45.38 THS4-I-3 48922530 7.34G 44025192 6.6G 0.01 98.09 94.33 45.53 WDS3-I-1 46903864 7.04G 42841458 6.43G 0.01 97.88 93.72 45.54 WDS3-I-2 48724042 7.31G 44431274 6.66G 0.01 98.38 94.96 45.5 WDS3-I-3 41524950 6.23G 41502730 6.23G 0.01 97.59 92.75 45.55 WDS3-III-1 42872942 6.43G 39330750 5.9G 0.01 97.58 92.76 45.44 WDS3-III-2 44260436 6.64G 40128728 6.02G 0.01 97.94 93.89 45.46 WDS3-III-3 53022320 7.95G 52995492 7.95G 0.01 99.01 96.88 45.67 WDS4-I-1 47115084 7.07G 47091050 7.06G 0.01 99.09 97.11 45.49 WD4-I-2 46384018 6.96G 46360490 6.95G 0.01 99.02 96.9 45.75 WDS4-I-3 49535388 7.43G 45868716 6.88G 0.01 99.06 96.98 45.52

[0057] Example 2. PpCPRF2 positively regulates the accumulation of wax in the cuticle of peach fruit.

[0058] Due to the challenges of stable genetic transformation in peaches, transient transformation was performed in the peach pericarp. At the S3 stage, a critical period for russeting, PpCPRF2 was successfully overexpressed in the TH pericarp, following these steps:

[0059] 1. Cloning of the PpCPRF2 gene

[0060] Total RNA was extracted from peach fruits using the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (Tiangen Biotech Co., Ltd.). After reverse transcription into cDNA, it was amplified using PpCPRF2-F and PpCPRF2-R primers and cDNA template with Novizan high-fidelity enzyme.

[0061] PpCPRF2-F: 5'-tccaaagaattccccggtaccATGTTGTCTACTGTTCCCGCCA-3' (SEQ IDNO.3);

[0062] PpCPRF2-R: 5'-atgatctttgtaatcctcgagCGCAATTAATGATGGGGTTTG-3' (SEQ IDNO.4);

[0063] Reaction system: 1 μL cDNA or genomic DNA, 2 μL each of forward and reverse primers, 25 μL 2×PhantaMax MasterMix (Dye Plus), and 20 μL ddH2O. PCR amplification program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, 40 cycles, and a final extension at 72℃ for 5 min.

[0064] The CDS sequence of the PpCPRF2 gene is 645 bp, as shown in SEQ ID NO.1:

[0065] ATGTTGTCTACTGTTCCCGCCATGCTTCCCTCTGACTCCCTTCTCCATTTCCCTGCTTTCGACGGGGGCTTTACCCCCGGCGGCGGCGGCTTCACGCCGTGGGATTGCTCGGAACTTTTTCCAGCAATTCAATCCCCGAAACCCACAATCTCAACCCTAAGTTCTGGTCCGGTCCAGTCTCCAAAACCGGTCATTTCGAGTTCCGGTTCAGATGACGACCCAAATCGGTCGGTTGAACCGGTCCGGATGAACCGGACCCATGCCAATGCGAAGTCATGCCCAAATGATGCCTCGAACCGGGCGGTTTCTGTGGTGGACGAGAGGAAGAGGAGGCGGATGATATCGAACCGGGAGTCGGCGAGGCGGTCTCGGATGCGAAAACAAAAGCACTTAGAAAACCTAAGGAACCAGGTGAACCGGCTTAGGATTGAGAACAGGGAACTGAAGAACCGGTTGAGTTACGTTTTGTACCATTTTCAGCGGGTTCGGACCGACAACGATAGGCTCCAATCCGAACACGTCCTGCTCCGACAGAAACTGTCGGACATACGTCAAATTTTGGTTTACCGGCAACTGCAGCACATGTCTTCTGCATGGCCATGCAACACCGTTATTCCGGAACAAACCCCATCATTAATTGCGTAA (SEQ ID NO.1).

[0066] The PpCPRF2 gene encodes 214 amino acids, and its amino acid sequence is shown in SEQ ID NO.2:

[0067] MLSTVPAMLPSDSLLHFPAFDGGFTPGGGGFTPWDCSELFPAIQSPKPTISTLSSGPVQSPKPVISSSGSDDDPNRSVEPVRMNRTHANAKSCPNDASNRAVSVVDERKRRRMISNRESARRSRMRKQKHLENLRNQVNRLRIENRELKNRLSYVLYHFQRVRTDNDRLQSEHVLLRQKLSDIRQILVYRQLQHMSSAWPCNTVIPEQTPSLIA (SEQ ID NO.2).

[0068] 2. Construction of a transient vector for PpCPRF2 gene overexpression

[0069] The PCR amplification products were recovered and purified by gel excision, and the cloning vector was constructed using the 5 min TA / Blunt-Zero Cloning Kit. The reaction system was as follows: 4 μL of purified PCR product, 1 μL of 5×TA / Blunt-Zero CloningMix, mixed well, and ligated at 37℃ for 15 min; after the reaction, all ligation products were transformed into E. coli.

[0070] Specific steps for E. coli transformation: Take one DH5α competent cell from -80℃ and immediately place it on ice. When it melts into an ice-water mixture, add the ligation product from the previous step, mix gently, and incubate on ice for 25 min. Then, heat shock in a 42℃ water bath for 90 s, followed by an ice bath for 2 min. After that, add 700 μL of antibiotic-free LB liquid medium to a clean bench and incubate at 37℃ with shaking at 220 rpm for 1 h. Centrifuge at 6000 rpm for 1 min, and aspirate a portion of the supernatant to a final volume of 100 μL in a clean bench. Mix the supernatant with a pipette tip and spread it all onto LB agar plates (containing 50 mg / L spectinomycin). Incubate the plates upside down in a 37℃ incubator for 16 h.

[0071] Positive clone screening and identification: After single colonies have grown on the plate, 10 colonies were randomly selected and picked up with a sterile pipette tip and placed into 700 μL of LB liquid medium (containing 50 mg / L kanamycin). The colonies were then incubated at 37°C and 220 rpm for 4 h. After the bacterial culture became turbid, bacterial culture PCR was performed for identification. After successful sequencing, the sequence was compared using BioXM 2.7 software. Single colonies with correct sequences were identified as positive clones.

[0072] 3. PpCPRF2-pSAK277 recombinant plasmid transformed into Agrobacterium

[0073] The recombinant plasmid PpCPRF2-pSAK277 obtained from sequencing was transformed into Agrobacterium GV3101. The specific steps of Agrobacterium transformation are as follows: Take one GV3101 competent cell from -80℃ and immediately place it on ice. After thawing, add 8 μL of the ligation product from the previous step, mix gently, and incubate on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and on ice for 5 min. Then, add 700 μL of antibiotic-free LB liquid medium in a clean bench and incubate at 28℃ with shaking at 220 rpm for 3 h. Take 100 μL of the recovered bacterial culture in a clean bench and spread it on an LB agar plate (containing 50 mg / L spectinomycin and 25 mg / L rifampin). Incubate the plate upside down in a 28℃ incubator for 48 h. After single colonies have grown on the plate, five single colonies are randomly selected and added to 700 μL of LB liquid medium (containing 50 mg / L spectinomycin and 25 mg / L rifampin), and cultured overnight at 28°C with shaking at 220 rpm.

[0074] 4. Instantaneous transformation of peach fruit skin

[0075] (1) Place the overnight activated fresh Agrobacterium culture in a constant temperature shaker at 28℃ and monitor the concentration of the culture up to OD. 600 The culture was stopped when the concentration reached 0.5, and the bacterial cells were then collected by centrifugation and the supernatant of the culture medium was discarded.

[0076] (2) Prepare the infection buffer: 20 mM 2-(N-morpholine) ethanesulfonic acid (MES), 10 mM magnesium chloride, 150 mM acetylsuccinone, and adjust the pH to 5.6 using NaOH.

[0077] (3) The bacterial pellet was washed and resuspended twice using the above-mentioned infection buffer to thoroughly remove residual antibiotics; then the bacterial concentration was adjusted to OD. 600 =0.5, to prepare the final concentration of the working bacterial solution. Incubate the working bacterial solution at room temperature for 2 hours to allow Agrobacterium to reach a suitable state of infection.

[0078] (4) Select “Tianhou” fruits in the S2 development stage with uniform shape and no mechanical damage to the skin as transformation recipients in the field. Five biological replicates were set up for each treatment, and fruits from different positions of the canopy (east, south, west, north and top) were selected for injection. Using a sterile syringe, 2-3 sites were punctured on each fruit, and the bacterial solution was slowly injected until the fruit surface was uniformly moistened.

[0079] (5) After injection, the fruit was tagged and cultured on the tree for another 7 days before harvesting to obtain PpCPRF-OE fruit overexpressing PpCPRF2. The sample processing was divided into two groups. One group cut off the injection site and surrounding pericarp tissue, flash-frozen in liquid nitrogen and stored in an ultra-low temperature freezer at -80℃ for subsequent total RNA extraction and scanning electron microscopy observation. The other group used fresh pericarp samples directly for the extraction and quantitative analysis of cuticle wax.

[0080] The results showed that the transcriptional level of PpCPRF2 increased by approximately 3.05-fold. Figure 8 (C). This upregulation is accompanied by an increase in the expression of wax metabolism-related genes (including PpCER3, PpKCS20, etc.). Figure 8 (C). Compared with the control (pSAK277 empty vector), PpCPRF-OE pericarp showed more dense waxy crystals (C). Figure 8 (A) Higher total wax content and 76.19% increase in alkane content ( Figure 8 China B and Figure 9 ).

[0081] Example 3. PpCPRF2 promotes wax synthesis in Arabidopsis thaliana and responds to ABA.

[0082] To investigate the role of PpCPRF2 in wax synthesis, transgenic Arabidopsis thaliana (Col-0) plants expressing the PpCPRF2 coding sequence via the PpCPRF2-pSAK277 vector under 35S promoter drive were constructed. The recombinant vector was constructed using the same method as in Example 2. The steps for establishing a stable Arabidopsis thaliana genetic transformation system are as follows:

[0083] A stable genetic transformation system for Arabidopsis thaliana was established using the Agrobacterium-mediated floral dip method, which mainly includes four steps: recipient material culture, preparation of Agrobacterium engineered bacteria, infection and transformation during flowering, and screening of transgenic progeny.

[0084] (1) Recipient material culture: Arabidopsis seeds were surface-sterilized with 5% sodium hypochlorite (containing 0.05% Tween-20) for 8 min, washed with sterile water, and sown on MS solid medium (pH=5.8). After vernalization at 4℃ for 3 days, the seeds were transferred to an artificial climate chamber and cultured at 21~23℃, 16 h / 8 h photoperiod, and 60% relative humidity. After 10 days of germination, robust seedlings were selected and transplanted into a peat moss-vermiculite mixed substrate (2:1, v / v) fully soaked with Huawuque compound fertilizer (N:P:K = 20:20:20). The seedlings were covered with film to retain moisture until survival. The plants were thoroughly watered one day before the peak flowering period.

[0085] (2) Agrobacterium transformation and preparation of engineered bacteria: The recombinant plasmid was introduced into Agrobacterium tumefaciens GV3101 competent cells using the heat shock method. Competent cells stored at -80℃ were treated with 1.0 μg of plasmid DNA, followed by sequential ice bath for 5 min, liquid nitrogen for 5 min, heat shock at 37℃ for 5 min, and ice bath for 5 min. After recovery in antibiotic-free LB medium at 28℃ for 2 h, the cells were plated onto a medium containing 50 μg·mL⁻¹ of LB medium. -1 Kanamycin selection plates were incubated at 28°C for 3 days. Positive clones were identified by colony PCR and inoculated into LB broth containing antibiotics, then incubated at 30°C with shaking at 200 rpm for 24 h. The culture was then expanded to OD at a 1% inoculum level. 600 =1.0, collect bacterial cells by centrifugation at 4℃ and 4,000 rpm for 15 min, and use transformation buffer (containing 1×MS macro and micro elements, organic components, iron salts, 5% sucrose, 0.01 mg·L⁻¹) -1 Resuspended to OD in 6-BA and 0.04% SILWET L-77 (pH = 5.8). 600 =1.0 (for backup)

[0086] (3) Inflorescence immersion transformation: Invert the plants in full bloom and immerse all inflorescences in Agrobacterium suspension for 30 seconds to ensure that the flower buds are fully in contact with the bacterial solution. After infection, treat in the dark for 24 hours, then restore normal light, and repeat the infection once after 7 days. After transformation, reduce nutrient supply to promote maturation, and harvest individual plants for drying and storage.

[0087] (4) Screening of transgenic plants: T1 generation seeds were disinfected with 70% ethanol and 7% sodium hypochlorite, and then sown in a solution containing screening antibiotics (50 μg·mL⁻¹). -1 KAN or 30 μg·mL -1 The plants were vernalized at 4°C for 48 h on 1 / 2 MS medium (0.8% agar, sucrose-free, pH 5.8) with HYG or 50 μM glufosinate, and then transferred to an artificial climate chamber for incubation at 20–22°C. After 8–15 days, resistant seedlings showed root elongation and green, flat cotyledons, while non-resistant seedlings exhibited root stunting and yellowing cotyledons. Positive seedlings were selected and transplanted into a nutrient substrate. After hardening off with mulch, transgenic plants were obtained. Genomic PCR and molecular detection confirmed the integration and expression of the exogenous gene, resulting in three lines: OE-1, OE-2, and OE-3.

[0088] Scanning electron microscopy (SEM) revealed that the stem surfaces of all three transgenic lines were covered with dense waxy crystals, while the wild-type stems were relatively smooth. Figure 10 (A). GC-MS analysis showed a significant increase in the total wax content of the stems of transgenic plants, and a significant increase in the levels of alkanes, fatty acids, primary alcohols, and fatty aldehydes. Figure 10(B, C). Furthermore, the same three transgenic lines were treated with ABA and Na2WO4. After ABA treatment, more wax crystal accumulation was observed compared to the control (CK) group. In contrast, Na2WO4 treatment resulted in a significant reduction in wax crystals on the stem surface. Figure 10 (A). Physiological index measurements showed that after ABA treatment, the total wax content and individual wax components of transgenic plants were significantly higher than those of the control group. Conversely, Na2WO4 treatment led to a significant decrease in total wax content, with the most significant reductions in alkanes, primary alcohols, and triterpenoids. Figure 10 (B, C). In summary, these results indicate that the transcription factor PpCPRF2 positively regulates ABA-induced wax synthesis in Arabidopsis thaliana.

[0089] As can be seen from the above embodiments, the present invention provides the application of peach transcription factor PpCPRF2 in regulating the formation of fruit rust or wax in plants. This gene and related expression vectors can be used to cultivate new peach and other fruit tree varieties with less fruit rust and better commercial quality, and have important application value in fruit tree quality improvement and green control.

[0090] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of peach transcription factor PpCPRF2 in regulating the formation of fruit rust or wax in plants, characterized by, The amino acid sequence of the peach transcription factor PpCPRF2 is shown in SEQ ID NO.

2.

2. The application of the gene encoding the peach transcription factor PpCPRF2 as described in claim 1 in regulating the formation of fruit rust or wax, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

3. The application according to claim 2, characterized in that, Overexpression of peach transcription factor PpCPRF2 promotes the formation of pericarp wax and inhibits the formation of russeting.

4. The application according to any one of claims 1 to 3, characterized in that, The plant mentioned includes the peach.

5. A method for promoting the formation of waxy coating on peach peel and / or inhibiting the formation of russeting, characterized in that, Includes the following steps: (1) Using peach genomic cDNA as a template, amplification PpCPRF2 Gene fragments; (2) PpCPRF2 Gene fragments are ligated to vectors to obtain recombinant plasmids; (3) Introduce the recombinant plasmid into Agrobacterium and culture the recombinant Agrobacterium to OD. 600 =0.4~0.6, centrifuge, and collect the bacterial cells; (4) Resuspend the bacterial cells in the infection buffer to obtain the working bacterial solution; incubate the working bacterial solution for 1.5-2.5 hours and then inject it into the peach fruit to obtain the final product.

6. The method according to claim 5, characterized in that, Amplification PpCPRF2 The primer sequences for the gene fragment are shown in SEQ ID NO.3 and SEQ ID NO.

4.

7. The method according to claim 5, characterized in that, PpCPRF2 The reaction system for gene-vector ligation is as follows: PpCPRF2 4 μL of gene fragment, 1 μL of 5×TA / Blunt-Zero Cloning Mix; ligated at 37℃ for 15 min.

8. The method according to claim 5, characterized in that, The components of the infection buffer are: 20 mM 2-(N-morpholine) ethanesulfonic acid, 10 mM magnesium chloride, and 150 mM acetylsuccinone.

9. The method according to claim 5, characterized in that, The OD of the working bacterial solution 600 It ranges from 0.4 to 0.

6.

10. The method according to claim 5, characterized in that, The peach fruit is in the S2 development stage, and the injection volume for each peach fruit is 3-5 mL.