Safflower MYB transcription factor CsMYB20, encoding gene and application
By cloning the nucleotide sequence of the saffron MYB transcription factor CsMYB20 and constructing a recombinant expression vector, we were able to promote early flowering and pistil growth in saffron, thus solving the problems of low flowering rate and reduced stigma yield, and improving the yield and quality of saffron.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUZHOU AGRI SCI & TECH DEV CENT
- Filing Date
- 2026-07-02
- Publication Date
- 2026-07-31
AI Technical Summary
The low flowering rate and reduced stigma yield of saffron severely restrict its industrial development. Existing technologies have failed to effectively promote early flowering and pistil growth in saffron.
The nucleotide coding sequence of the saffron MYB transcription factor CsMYB20 was cloned, its expression pattern was analyzed by real-time quantitative PCR, and a recombinant expression vector was constructed to overexpress the CsMYB20 gene. Transgenic plants were then bred by transforming plant hosts to promote early flowering and pistil growth in saffron.
Overexpression of the CsMYB20 gene led to earlier flowering and significantly accelerated pistil growth in saffron, improving its yield and quality and providing a theoretical basis for the genetic engineering regulation of saffron.
Smart Images

Figure CN122484151A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering and metabolic regulation technology, specifically involving an important transcription factor that can significantly promote early flowering and pistil growth in saffron, particularly the saffron MYB transcription factor CsMYB20, its encoding gene, and its application. Background Technology
[0002] Saffron is a plant belonging to the Iridaceae family. Crocus sativus The dried stigmas of saffron (L.), also known as saffron, are native to Europe, the Mediterranean, and Central Asia. Saffron's unique natural pigments and aromatic substances make it one of the world's most expensive spices, often referred to as "red gold," and it has significant development value in high-end textiles, daily chemical products, and health products. Currently, the declining flowering rate and reduced stigma yield of saffron are severely hindering its industrial development. The growth of the stigma (i.e., the pistil), the part used for saffron, is crucial to its yield and quality; therefore, promoting earlier flowering and pistil development has become an urgent problem to be solved.
[0003] MYB transcription factors are an important class of transcriptional regulatory proteins in eukaryotes. The conserved MYB domain consists of 1-4 incompletely repeated helix-turn-helix (HTH) motifs. It is one of the largest transcription factor families in plants, widely distributed in both plants and animals. The MYB family has many members and a wide distribution, with diverse functions encompassing secondary metabolism (such as regulating the synthesis of anthocyanins and flavonoids), cell morphogenesis (such as regulating epidermal wax synthesis), hormone responses, and abiotic stress responses. Numerous studies have confirmed that MYB transcription factors can regulate plant flower development. However, there are currently no reports on the intrinsic link between MYB transcription factors and saffron flowering and development. Summary of the Invention
[0004] To address the aforementioned issues, this invention provides the nucleotide coding sequence and amino acid sequence of the saffron MYB transcription factor CsMYB20, its protein subcellular localization, and phenotypic analysis of flowering and pistil development in transgenic plants. This lays the foundation for revealing the role of transcription factor CsMYB20 in saffron flowering and pistil growth, and for cultivating high-quality saffron medicinal materials.
[0005] On the one hand, the present invention provides a saffron MYB transcription factor CsMYB20 that can promote early flowering and pistil growth in saffron, the amino acid sequence of which is shown in SEQ ID NO.2.
[0006] On the other hand, the present invention provides a coding gene that encodes the above-mentioned saffron MYB transcription factor CsMYB20, the nucleotide sequence of which is shown in positions 1 to 714 of SEQ ID NO.1.
[0007] In this invention, "isolated DNA" and "purified DNA" refer to DNA or fragments that have been isolated from sequences flanking them in their natural state, and also to DNA or fragments that have been separated from components that accompany nucleic acids in their natural state, and from proteins that accompany them in the cell.
[0008] In this invention, the gene encoding the saffron MYB transcription factor CsMYB20 refers to the nucleotide sequence encoding a polypeptide with saffron protein activity, such as the nucleotide sequence from position 1 to 714 of SEQ ID NO.1 and its degenerate sequence. The degenerate sequence refers to the sequence generated when one or more codons in nucleotides from position 1 to 714 of SEQ ID NO.1 are replaced by degenerate codons encoding the same amino acid.
[0009] In this invention, saffron can be analyzed using real-time quantitative PCR. CsMYB20 The expression pattern of gene products, i.e., analyzing saffron CsMYB20 The presence and quantity of gene mRNA transcripts in cells.
[0010] Furthermore, according to the present invention, saffron CsMYB20 Gene sequences and amino acid sequences can be used to screen saffron based on nucleic acid homology or expressed protein homology. CsMYB20 Gene-related homologous genes or homologous proteins.
[0011] The saffron of this invention CsMYB20 Full-length sequences or fragments of gene-related nucleotides can typically be obtained using PCR amplification, recombination, or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed in this invention, and commercially available cDNA libraries or cDNA libraries prepared using conventional methods known to those skilled in the art can be used as templates to amplify the relevant sequences. When the sequences are long, two or more PCR amplifications are often required, and then the fragments amplified from each amplification are spliced together in the correct order.
[0012] Once the relevant sequence is obtained, it can be obtained in large quantities using recombination methods. This typically involves cloning it into a vector, transferring it into cells, and then isolating the relevant sequence from the proliferated host cells using conventional methods.
[0013] In addition, mutations can be introduced into the protein sequence of the present invention through chemical synthesis.
[0014] Besides being produced by recombinant methods, fragments of the protein of the present invention can also be produced by solid-phase technology through direct peptide synthesis. The individual fragments of the protein of the present invention can be chemically synthesized separately and then chemically linked to produce a full-length molecule.
[0015] This invention also provides a recombinant expression vector containing the encoding gene of the saffron MYB transcription factor CsMYB20. The recombinant expression vector is a 35S- CsMYB20- GFP.
[0016] The present invention also provides an application of the gene encoding the saffron MYB transcription factor CsMYB20 in promoting saffron flowering and pistil growth. Overexpression of the above-mentioned gene promotes earlier flowering and pistil elongation in saffron. The nucleotide sequence of the above-mentioned gene is shown in SEQ ID NO.1. The amino acid sequence of the above-mentioned saffron MYB transcription factor CsMYB20 is shown in SEQ ID NO.2.
[0017] The application of the above-mentioned gene encoding the saffron MYB transcription factor CsMYB20 in promoting saffron flowering and pistil growth includes: constructing a recombinant expression vector containing the gene encoding the above-mentioned transcription factor CsMYB20, transforming it into a plant host, and culturing and screening to obtain transgenic plants.
[0018] Beneficial effects: Saffron is a rare and precious traditional Chinese medicine with high market demand. This invention cloned the coding sequence of CsMYB20, an important regulatory protein in the flowering process of saffron, and analyzed it using real-time quantitative PCR. CsMYB20 Gene expression patterns, transient expression analysis of tobacco leaf epidermal cells, subcellular localization of transcription factor CsMYB20, and overexpression of saffron CsMYB20 Analysis of flowering phenotypes in Arabidopsis thaliana will provide insights for future regulation using genetic engineering techniques. CsMYB20 The study of spatiotemporal gene expression provides a theoretical basis for promoting earlier flowering and pistil growth in saffron, thereby increasing saffron yield and quality and facilitating the breeding of new varieties. It has great application value. Attached Figure Description
[0019] Figure 1 This is a phylogenetic tree analysis of the saffron transcription factor CsMYB20 and Arabidopsis thaliana AtMYB of the present invention. Figure 2 Saffron CsMYB20 Differential expression of genes in different plant tissues; where *** indicates a highly significant difference between the two groups (P<0.001). Figure 3 Saffron induced by MeJA CsMYB20Gene expression analysis diagram; where ** indicates a highly significant difference between the two groups (P<0.01). Figure 4 Map showing the localization of saffron transcription factor CsMYB20 in tobacco leaf epidermal cells; Figure 5 Wild type and overexpression CsMYB20 Phenotypic representation of early flowering in Arabidopsis thaliana based on genes; Figure 6 Wild type and overexpression CsMYB20 Phenotypic diagram of pistil growth in transgenic Arabidopsis thaliana; where A is the pistil phenotype diagram of transgenic Arabidopsis thaliana and B is the pistil length diagram of transgenic Arabidopsis thaliana; * indicates a significant difference between the two groups (P<0.05). Detailed Implementation
[0020] The technical solution of the present invention will be described in detail below through embodiments, but the scope of protection of the present invention is not limited to the embodiments described.
[0021] Experimental methods not specifically described in the following examples are generally performed under standard conditions, such as those described in Molecular Cloning: A Laboratory Manual (4th Edition), or as recommended in the reagent instructions.
[0022] Example 1, Saffron CsMYB20 Cloning of genes 1. Obtaining plant materials Select healthy saffron bulbs and harvest the saffron flowers on the day of flowering into sterile centrifuge tubes. Quickly freeze the tubes in liquid nitrogen for the extraction of total RNA from the saffron flowers.
[0023] 2. RNA extraction Total RNA was extracted from saffron according to the instructions of the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (TIANGEN). The integrity of the RNA was identified by gel electrophoresis, and the purity and concentration of the RNA were determined by spectrophotometer (Nanodrop 2000).
[0024] 3. Full-length cloning of genes Based on the nucleic acid sequence and protein function annotation results provided by the laboratory's previous full-length transcriptome analysis, saffron was obtained CsMYB20 Full-length gene. The extracted RNA was reverse transcribed (TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix) to obtain cDNA. Using the first-strand cDNA as a template, primers were used... CsMYB20 -F (5'-ATGGTGATTGGTAACTACTCTGATATCTT-3') and CsMYB20PCR was performed using -R (5'-TTATTGGAATTTTACATCTGCTGCTGA-3') to amplify a 714bp gene fragment, which was then recovered and ligated into the pMD18-T vector and sent to a sequencing company for sequencing.
[0025] The secondary and tertiary structures of the saffron transcription factor CsMYB20 protein were predicted using the online software SOPMA (Secondary Structure Prediction Analysis Software) and SWISS-MODEL (Tertiary Structure Prediction Analysis Software). The prediction results showed that the secondary structure of the CsMYB20 protein consisted of 28.27% α-helices, 0% extended strands, 0% β-turns, and 71.73% random coils.
[0026] Example 2, Saffron CsMYB20 Gene sequence information and homology analysis The saffron of this invention CsMYB20 The full-length open reading frame (ORF) sequence of the gene is 714 bp, and the detailed sequence is shown in SEQ ID NO. 1. Based on the ORF sequence, the amino acid sequence of the saffron transcription factor CsMYB20 protein was deduced, consisting of 237 amino acids, a molecular weight of 27.27 kDa, and an isoelectric point (pI) of 5.38. The detailed sequence is shown in SEQ ID NO. 2.
[0027] 131 AtMYB transcription factor sequences were downloaded from the Arabidopsis thaliana protein database (TAIR database) and used to construct a phylogenetic tree with the screened CsMYB transcription factors. Phylogenetic analysis showed that the saffron transcription factor CsMYB20 exhibited high homology with MYB transcription factors from other known species in the phylogenetic tree, such as... Figure 1 As shown.
[0028] Example 3, Saffron CsMYB20 Spatiotemporal expression analysis of genes 1. Material acquisition: Saffron bulbs with uniform growth were selected. On the day the saffron flowers bloomed, samples were taken from the bulbs, leaves, petals, stamens, and stigmas. The samples were then rapidly frozen in liquid nitrogen and stored at -80℃ for tissue expression analysis. Saffron stigmas treated with 100 μmol / L MeJA for 0 h, 0.5 h, 1 h, 3 h, 6 h, 9 h, 12 h, and 24 h were rapidly frozen in liquid nitrogen and stored at -80℃ for expression analysis in response to JA signals.
[0029] 2. RNA extraction, determination of RNA integrity, purity, and concentration, and cDNA acquisition are described in Example 1.
[0030] 3. Design specific primers for real-time quantitative PCR analysis of gene expression levels in various tissues, based on the obtained saffron... CsMYB20 Gene sequence designed for use in real-time PCR CsMYB20 Specific primers for gene quantification analysis, primers CsMYB20 -qF(5'-GCCTGGTAGGACGGATAACG-3'), primer CsMYB20 -qR(5'-CAGACGTGGCACCCATAAGT-3'), internal reference gene Actin Primers are CsActin- F(5'-ACCATGTTTCCCGGGATTGC-3'), CsActin -R (5'- TGCGGTGAACGATTGAAGGG -3').
[0031] 4. Standard curves for the target gene and internal reference gene: The standard cDNA solution was serially diluted with ddH2O. Then, using the diluted cDNA as templates, Real-time PCR amplification was performed with specific primers for the target gene and internal reference gene, respectively. Melting curves and standard curves were plotted. The melting curves were analyzed to determine whether a single peak was obtained for the target gene and internal reference gene, in order to determine whether a single PCR amplification product could be obtained using the primers. The appropriate dilution factor of the template cDNA was determined by the standard curves.
[0032] 5. Real-time quantitative analysis of the target gene in the test sample: Using the first strand of the synthesized cDNA as a template, the target gene and the internal reference gene were amplified with specific primers for real-time quantitative analysis. The Bio-Rad CFX real-time quantitative PCR reaction was performed. The reaction system was 20µL. The reaction program was: 98℃ for 2min; 98℃ for 10s; 55℃ for 10s; 72℃ for 15s; 30 cycles.
[0033] 6. Use 2 -△△Ct The method was used for relative quantitative analysis, and the results are as follows: Figure 2 As shown, it can be seen that CsMYB20 The gene is expressed in all five tissues of saffron, with the highest expression level in the petals, followed by the stamens, leaves, and stigmas, and the lowest expression level in the bulb. CsMYB20 Gene expression levels showed a significant increasing trend during MeJA treatment, with 6h and 24h expression levels more than double those of untreated (0h) genes, indicating a positive response to JA signaling. Figure 3 As shown.
[0034] Example 4: Subcellular localization analysis of saffron transcription factor CsMYB20 in tobacco leaves Design specific primers at the start codon and stop codon respectively. CsMYB20-oF (5'- TCGGTACCCGGGGATCCATGGTGATTGGTAACTACTCTGATATCTT -3'), CsMYB20 -oR(5'-TGCTCACCATGTCGACTTGGAATTTTACATCTGCTGCTGAACTA-3'), and introduced on both sides of the full-length gene sequence. Bam HI and Sal I. Restriction Sites. The plasmid containing the target fragment with restriction sites is then coupled with the 35S-GFP vector. Bam HI and Sal I. Double enzyme digestion, recovery of the digested 35S-GFP vector and... CsMYB20 The fragment was ligated overnight at 4°C using T4 ligase to construct the recombinant expression vector 35S- CsMYB20- GFP was used, and the recombinant expression vector was transformed into Agrobacterium GV3101.
[0035] The identified GV3101 strain was used to extract 10 μL of positive bacterial culture and added to 50 mL of LB broth (containing 50 mg / L Kana + 25 mg / L Rif). The culture was incubated at 28°C with shaking at 220 rpm for 36 h until the bacterial culture reached its OD value. 600 The OD value is approximately 0.5-0.6. Take 5 mL of bacterial culture, centrifuge at 5000 rpm / min for 15-20 min, and collect the bacterial cells. Resuspend the bacterial cells in resuspending buffer (containing 4.43 g / L MS medium, 20 g / L sucrose, 10 mmol / L 2-(N-morpholino)ethanesulfonic acid, and 150 μmol / L acetylsyringone). The final OD value is... 600 The concentration was 0.4; the plants were placed at room temperature for 2-3 hours; the solution was injected into tobacco leaves, and the injected tobacco plants were cultured in the dark for 48 hours before being observed under a laser confocal microscope at an excitation wavelength of 514 nm. The results are as follows. Figure 4 As shown, the empty vector (35S-GFP) fluorescent signal is present in the cell nucleus and cell membrane, while the CsMYB20 fluorescent signal is present in the cell nucleus.
[0036] Example 5, Saffron CsMYB20 Arabidopsis thaliana, a model plant for gene transformation 1. Transformation of Arabidopsis thaliana (1) Pre-shaken Agrobacterium (Agrobacterium GV3101 obtained in Example 4): Pick positive single clones into 5 ml of YEP liquid medium containing 50 mg / L Kan, 50 mg / L Gentamicin and 25 mg / L Rif, and shake at 200 rpm for 24 h at 28°C; (2) Agrobacterium expansion: The pre-shaken Agrobacterium culture was expanded at a ratio of 1:100 into YEP medium containing the same resistance, and cultured at 28℃ and 200 rpm for 13-16 h until the absorbance OD reached the specified value. 600 When the concentration reaches approximately 0.6-1.5, bacteria are collected at 18℃, 3500 rpm, and 15 min. (3) Transformation of Arabidopsis thaliana: Prepare 300 mL of 1 / 2 MS solution containing 2% sucrose. Resuspend the collected Agrobacterium tumefaciens in a small amount of MS solution. Add 0.01% (v / v) Tween-20 to the remaining sucrose solution. Immerse the stems and inflorescences of Arabidopsis thaliana plants (after removing all siliques, open flowers, and buds before transformation) in the bacterial solution for 5 min. Remove the plants, drain the bacterial solution, and place them in a disposable plastic bag, sealing and keeping them moist. After all plants have been transformed, cover them with a black box and incubate in the dark for 24 h. Then remove the plants, place them upright, and water them to ensure sufficient moisture.
[0037] 2. Screening of transgenic positive lines After the transformed Arabidopsis thaliana siliques are fully mature, the seeds are harvested, dried, and then the siliques are removed from the seeds. Transgenic T0 generation seeds are collected and sown in seedling trays. Seedling resistance is screened with 0.05% (v / v) Basta to obtain T1 generation transgenic plants. Screening continues until T3 generation homozygous transgenic plants are obtained.
[0038] Example 6: Overexpression of saffron CsMYB20 Flowering phenotypic analysis of Arabidopsis thaliana A small amount of the aforementioned T3 generation Arabidopsis thaliana seeds and wild-type Arabidopsis thaliana seeds (control) were placed in 1.5 mL centrifuge tubes. The tubes were sterilized in a clean bench with 75% alcohol for 5 min, rinsed three times with sterile water, leaving a small amount of sterile water to submerge the seeds. The centrifuge tubes were then placed in a 4°C refrigerator for two days for vernalization. Two days later, the Arabidopsis thaliana seeds were transplanted into a cultivation substrate consisting of nutrient soil and perlite in a 1:1 volume ratio. The Arabidopsis thaliana was cultivated in a greenhouse at 23°C, with a light intensity of 4000 Lux and an air humidity of 60%. In the early post-planting period, the light and dark periods were 12 h and 12 h respectively. After bolting, the light and dark periods were changed to 16 h and 8 h respectively. Observations showed that the transgenic Arabidopsis thaliana flowered approximately 4 days earlier than the wild type. Figure 5 As shown. Observation and measurement of the pistils on the 30th day after sowing revealed overexpression of... CsMYB20 The average length of the pistil in Arabidopsis thaliana was significantly increased compared to the control, such as Figure 6 Figure A in the middle Figure 6 As shown in Figure B. This illustrates... CsMYB20 It has the effect of influencing the flowering time of Arabidopsis thaliana and can promote the growth of pistils (i.e., simultaneously thickening and lengthening them).
[0039] Unless otherwise specified, all technologies mentioned above refer to existing technologies.
[0040] Based on the above-described preferred embodiments of the present invention, and through the foregoing description, those skilled in the art can make various changes and modifications without departing from the inventive concept. The technical scope of this invention is not limited to the contents of the specification.
Claims
1. The application of overexpression of the gene encoding the saffron MYB transcription factor CsMYB20 in promoting saffron flowering and pistil growth, characterized in that, Overexpression of the encoded gene promotes earlier flowering and pistil elongation in saffron; The nucleotide sequence of the encoding gene is shown in SEQ ID NO.1; The amino acid sequence of the saffron MYB transcription factor CsMYB20 is shown in SEQ ID NO.
2.
2. The application of the gene encoding the saffron MYB transcription factor CsMYB20, as described in claim 1, in promoting saffron flowering and pistil growth, characterized in that... The application includes: constructing a recombinant expression vector containing the coding gene of the transcription factor CsMYB20, transforming it into a plant host, and culturing and screening to obtain transgenic plants.