Application of the AcGA2ox gene in kiwifruit for resistance to gray mold
By silencing the AcGA2ox gene in kiwifruit and activating the jasmonic acid disease resistance signaling pathway, the problems of pesticide resistance and environmental pollution in the control of gray mold in kiwifruit were solved, achieving a balanced improvement in disease resistance and growth, and a green and sustainable disease resistance strategy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHONGQING UNIV OF ARTS & SCI
- Filing Date
- 2026-04-02
- Publication Date
- 2026-07-31
AI Technical Summary
Current technologies rely on chemical pesticides to control gray mold in kiwifruit, which poses risks of pesticide resistance, environmental pollution, and food safety issues. Furthermore, chemical regulators have systemic side effects on plant growth.
By silencing the AcGA2ox gene in kiwifruit through genetic means, gibberellin levels can be precisely regulated, jasmonic acid disease resistance signaling pathway can be activated, and plant resistance to gray mold can be improved.
It achieves a balanced improvement in disease resistance and growth, with stable and long-lasting effects, avoiding the use of chemical pesticides, reducing environmental pollution and costs, and providing a green and sustainable disease resistance strategy.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of Fusarium head blight control technology, specifically to the application of the AcGA2ox gene in kiwifruit in resistance to gray mold. Background Technology
[0002] Kiwifruit is a fruit with high nutritional and economic value, and it is widely cultivated worldwide. However, during its pre-harvest growth and post-harvest storage and transportation, kiwifruit is highly susceptible to infection by various pathogenic fungi, among which gray mold caused by Botrytis cinerea is one of the most serious diseases. This disease not only causes the fruit and leaves to rot in the field, but also causes huge economic losses during post-harvest storage, severely hindering the healthy development of the kiwifruit industry.
[0003] For a long time, the control of gray mold has mainly relied on chemical fungicides. However, the overuse of chemical pesticides not only leads to drug resistance in pathogens and reduces the effectiveness of control, but also causes problems such as pesticide residues, environmental pollution, and food safety. With the increasing demand from consumers for green and safe food, the development of new and environmentally friendly disease control strategies has become particularly urgent.
[0004] Over a long period of evolution, plants have developed a complex immune system to defend against pathogens. Studies have shown that plant immune responses are finely regulated by various endogenous hormones. The salicylic acid (SA) pathway primarily combats biotrophic pathogens, while the jasmonic acid (JA) / ethylene (ET) pathway primarily combats necrotrophic pathogens (such as gray mold). These hormonal pathways engage in complex crosstalk, collectively forming the plant's defense network.
[0005] GA2ox (gibberellin 2-oxidase) is a key enzyme in the metabolism of gibberellins (GAs). Gibberellins are an important class of plant hormones that widely participate in regulating plant growth and development, such as promoting stem elongation, seed germination, flowering, and fruit setting. The main function of GA2ox is to catalyze the inactivation of active gibberellins (such as GA1 and GA4), thereby reducing the level of active gibberellins in the plant. Therefore, GA2ox is a crucial "brake" component in the gibberellin metabolic pathway.
[0006] Traditionally, gibberellins (GAs) are thought to primarily promote growth and development while often inhibiting plant disease resistance. This is because GAs suppress the accumulation of DELLA proteins (a core repressor protein that negatively regulates GA signaling), which have been shown to positively regulate GA-mediated disease resistance responses. Therefore, high levels of GA signaling are typically associated with susceptibility to necrotrophic pathogens such as gray mold. Based on this, theoretically, reducing GA levels or signaling should enhance disease resistance.
[0007] Therefore, some have proposed reducing gibberellin levels in plants through exogenous application of gibberellin biosynthesis inhibitors (i.e., chemical regulation), thereby indirectly studying or utilizing its effects on plant disease resistance. However, although the aim of this method is to regulate endogenous plant hormones rather than directly kill bacteria, the substances used are essentially artificially synthesized chemical regulators. Their degradation behavior in the environment, potential impacts on non-target organisms (such as soil microorganisms), and possible food residue issues, like those of traditional chemical pesticides, still require consideration of environmental and safety factors.
[0008] Therefore, there is an urgent need for a new strategy that can overturn the traditional understanding that "reducing gibberellin levels can enhance disease resistance" in order to significantly improve the resistance of kiwifruit to gray mold. Summary of the Invention
[0009] To address the shortcomings of existing technologies, the purpose of this invention is to provide an application of the AcGA2ox gene in kiwifruit for resistance to gray mold, which can overcome the non-specific and systemic side effects of exogenous chemical regulators and achieve precise regulation of disease resistance through genetic means.
[0010] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention proposes a kiwifruit AcGA2ox gene, the key feature of which is that the nucleotide sequence of the AcGA2ox gene is any one of the following: The nucleotide sequence shown in SEQ ID NO.1; Nucleotide sequences encoding proteins with the same function are obtained by substituting, deleting, or inserting one or more nucleotides, as shown in SEQ ID NO.1.
[0011] Secondly, the present invention proposes a kiwifruit AcGA2ox gene, wherein the amino acid sequence of the AcGA2ox gene is any one of the following: The amino acid sequence is shown in SEQ ID NO.2; The amino acid sequence shown in SEQ ID NO.2 is a sequence in which one or more amino acids are substituted, deleted, or added, and which have the same function.
[0012] Thirdly, this invention proposes the application of the kiwifruit AcGA2ox gene and its encoded product as described in the first or second aspect in regulating the resistance of kiwifruit to gray mold.
[0013] Fourthly, the present invention proposes a biomaterial containing the kiwifruit AcGA2ox gene described in the first or second aspect.
[0014] Fifthly, the present invention proposes the application of the biomaterials described in the fourth aspect in plant resistance to gray mold.
[0015] Furthermore, the biological material is recombinant DNA, expression cassette, transcription factor, plasmid vector, viral vector, or engineered bacteria.
[0016] The plant in question belongs to the Actinidiaceae family.
[0017] In a sixth aspect, the present invention proposes an application to improve plant disease resistance by silencing or inhibiting the expression of the kiwifruit AcGA2ox gene as described in the first or second aspect.
[0018] Furthermore, the plant in question belongs to the Actinidiaceae family.
[0019] The significant effects of this invention are: 1. Improved Balance Between Enhanced Disease Resistance and Growth: Existing technologies non-specifically and globally suppress gibberellin synthesis through exogenous chemical inhibitors, leading to severe side effects such as growth inhibition. This invention, however, employs specific gene silencing technology to precisely target the AcGA2ox gene. This gene acts as a "brake" on gibberellin metabolism; its silencing results in a moderate increase in active gibberellin levels. While this may seem contradictory to conventional understanding, experiments have demonstrated that this endogenous and precise regulation actually activates disease resistance signaling pathways such as jasmonic acid. While significantly enhancing gray mold resistance, phenotypic data, including quality indicators, show that it interferes less with normal plant growth, achieving a better balance between disease resistance and growth.
[0020] 2. More stable and lasting effects, and more environmentally friendly: Existing technologies rely on field spraying of chemicals, whose effects are easily affected by the environment and require repeated application. This invention, through genetic modification, constructs a stable gene silencing system within the plant. Once transgenic plants are obtained, their disease resistance traits can be stably inherited and expressed, providing a permanent solution without the need for annual pesticide application. This not only reduces costs and labor but also fundamentally eliminates the risks of pesticide residues and environmental pollution by avoiding the use of chemical inhibitors. It is a more sustainable green technology and can also provide an important gene pool and new germplasm resources for kiwifruit disease resistance breeding. Attached Figure Description
[0021] Figure 1 This is a graph showing the expression level of the AcGA2ox gene in the control group after transgenic Agrobacterium tumefaciens infection of kiwifruit; Figure 2 This is a phenotypic observation of kiwifruit infected with gray mold with inhibited expression of the AcGA2ox gene and the control group; Figure 3 This is a graph showing the changes in GA content in genetically modified and control kiwifruit during Botrytis cinerea infection. Figure 4This is a graph showing the changes in the content of defensive enzymes in genetically modified and control kiwifruit during Botrytis cinerea infection. Figure 5 This is a graph showing the changes in the content of resistance substances in genetically modified and control kiwifruit during Botrytis cinerea infection. Detailed Implementation
[0022] The specific embodiments and working principles of the present invention will be further described in detail below with reference to the accompanying drawings.
[0023] All carriers, the 'Hongyang' kiwifruit variety, and all reagents involved in this embodiment are commercially available. The Botrytis cinerea strain for kiwifruit was provided by the China Agricultural Microbial Culture Collection Center (ACCC CAASF-122).
[0024] 1. Obtaining the AcGA2ox gene from kiwifruit Total RNA was extracted from kiwifruit using the RNAiso Plus kit (Takara). The specific steps were as follows: kiwifruit leaves were ground in liquid nitrogen, then Fruitmate reagent (Takara) was added, and the supernatant was collected after centrifugation. RNAiso Plus was then added, followed by chloroform extraction, isopropanol precipitation, washing of the precipitate with 75% ethanol, and finally dissolution with RNase-free water to obtain RNA. RNA quality was assessed by agarose gel electrophoresis. Subsequently, cDNA synthesis was performed using the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix kit. The reaction system contained 2×ES Reaction Mix, total RNA, gDNA Remover, EasyScript® RT / RI Enzyme, Oligo(dT), and RNase-free water. The reaction conditions were incubation at 42°C for 30 minutes, followed by a 5-second incubation at 85°C to terminate the reaction. The obtained cDNA was stored at -20°C for later use.
[0025] PCR amplification was performed using the following primer sequences: Upstream primer: GGTTCTCTCCAAGCCAGCAA (SEQ ID NO.3) Downstream primer: TGATGGTGGGGCCTTTGTTT (SEQ ID NO.4) The amplified product was ligated into the cloning vector pMD-19T simple vector (TransGen, China), transformed into E. coli Top10, and positive clones were screened for sequencing verification. The nucleotide sequence is shown in SEQ ID NO.1 and the amino acid sequence is shown in SEQ ID NO.2.
[0026] 2. Genetic transformation of the AcGA2ox gene (1) Construction of expression carrier: PCR cloning of gene interference fragments: Using kiwi cDNA as a template, PCR amplification was performed using the Phanta Super-Fidelity DNA Polymerase kit. The PCR reaction system is shown in Table 1, and the reaction procedure is shown in Table 2. After the PCR reaction, agarose gel electrophoresis was performed, and the results were observed and analyzed using a gel imaging system. Correctly amplified bands were excised from the gel and recovered, and then detected by agarose gel electrophoresis. The recovered fragments were stored at -20 ℃. Electrophoresis showed a single band, and the target gene fragment, 385 bp in length, was excised and recovered using the following primers: Upstream primer: CCTCACAACCAGCCCTCAAT (SEQ ID NO.5) Downstream primer: CTGGTCAGGAGGGACAGAGA (SEQ ID NO.6) Table 1 PCR reaction system Table 2 PCR reaction conditions The 1047 bp gene fragment of the AcGA2ox gene shown in SEQ ID NO.1 was ligated into the cloning vector pMD-19B (Full Gold). The AcGA2ox gene fragment and pTRV2 vector were recovered by double digestion with XbaI / BamHI, purified, and the vector backbone was recovered. After ligation with T4 DNA ligase, the fragments were transformed into *E. coli* DH5α, plated on Kana resistant plates, and PCR was performed on resistant colonies. Plasmids were extracted from PCR-positive colonies and sequenced using the universal primers on the vector: RV-XIAYOU (5'aacctaaaacttcagacacg3', SEQ ID NO.7). The sequencing results were consistent with the reference sequence. The constructed AcGA2ox-pTRV2 vector and pTRV1 were mixed at a 1:1 ratio and transformed into *Agrobacterium* GV301.
[0027] (2) Disease resistance analysis Agrobacterium GV301 was used to transiently transform 'Hongyang' kiwifruit, which were uniform in size, undamaged, and free from pests and diseases, 130 days after pollination. Samples were then collected daily at fixed times around the injection wells and stored at -80°C. The expression level of AcGA2ox was detected using qRT-PCR. Figure 1 As shown, the expression level of this gene decreased significantly after 7 days.
[0028] Subsequently, kiwifruit fruits from the transgenic and control groups were infected with 10 μL of *Botrytis cinerea* spore suspension (10⁴-10⁶ spores / mL) and sterile water, respectively. Phenotypic observation ( Figure 2 The results showed that three days after infection with Botrytis cinerea, there was a significant difference in the degree of rot between the two groups of kiwifruit. At five days, the control group of kiwifruit had extensive rot around the wounds, while the fruit with AcGA2ox silencing showed relatively mild rot symptoms at the wounds.
[0029] Further examination was conducted on the changes in GA content, defense enzymes, and resistance substance content in transgenic and control kiwifruit during Botrytis cinerea infection. The results are as follows: Figures 3-5 As shown. Superoxide dismutase (SOD) activity was determined using the nitroblue tetrazolium (NBT) photochemical reduction method, with one unit of enzyme activity defined as the amount of enzyme used to inhibit NBT photochemical reduction by 50%. Catalytic oxidase (CAT) activity was determined using the ultraviolet absorption method, with the optical density at 240 nm per minute as the value. A It is 240nm, that is A 240) One enzyme activity unit was defined as a reduction of 0.1 units of enzyme amount; the total phenol content was determined using the Folin-Ciocalteu method. The results showed that the SOD, CAT, and total phenol content all increased after AcGA2ox silencing expression. These results indicate that *Botrytis cinerea* infection can induce an increase in SOD and CAT enzyme activities and total phenol content in kiwifruit, thus responding to the pathogen. The increase in related physiological indicators was more pronounced in fruits with AcGA2ox silencing expression after *Botrytis cinerea* infection.
[0030] In summary, this invention has discovered and verified that specifically silencing the AcGA2ox gene in kiwifruit can serve as a novel strategy to significantly enhance the plant's resistance to gray mold. This discovery overturns the traditional understanding that "reducing gibberellin levels enhances disease resistance." This endogenous and precise regulation actually activates disease resistance signaling pathways such as jasmonic acid. While significantly improving gray mold resistance, phenotypic data such as quality indicators show that it interferes less with normal plant growth, achieving a better balance between disease resistance and growth. Furthermore, this invention constructs a stable gene silencing system within the plant through genetic modification. Once transgenic plants are obtained, their disease resistance traits can be stably inherited and expressed, overcoming the non-specific and systemic side effects of exogenous chemical regulators. This provides a permanent solution, eliminating the need for annual pesticide application. This not only reduces costs and labor but also fundamentally eliminates the risks of pesticide residues and environmental pollution by avoiding the use of chemical inhibitors, making it a more sustainable green technology.
[0031] The technical solution provided by this invention has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of this invention. The descriptions of the embodiments above are only for the purpose of helping to understand the method and core ideas of this invention. It should be noted that those skilled in the art can make several improvements and modifications to this invention without departing from the principles of this invention, and these improvements and modifications also fall within the protection scope of the claims of this invention.
Claims
1. A kiwifruit AcGA2ox gene, characterized by: The nucleotide sequence of the AcGA2ox gene is any one of the following: The nucleotide sequence shown in SEQ ID NO.1; Nucleotide sequences encoding proteins with the same function are obtained by substituting, deleting, or inserting one or more nucleotides, as shown in SEQ ID NO.
1.
2. A kiwifruit AcGA2ox gene, characterized by: The amino acid sequence of the AcGA2ox gene is any one of the following: The amino acid sequence is shown in SEQ ID NO.2; The amino acid sequence shown in SEQ ID NO.2 is a sequence in which one or more amino acids are substituted, deleted, or added, and which have the same function.
3. The application of the kiwifruit AcGA2ox gene and its encoded product as described in claim 1 or 2 in regulating the resistance of kiwifruit to gray mold.
4. A biological material comprising the kiwifruit AcGA2ox gene as described in claim 1 or 2.
5. The application of the biomaterial as described in claim 4 in plant resistance to gray mold.
6. The application according to claim 5, characterized in that, The biological material is recombinant DNA, expression cassette, transcription factor, plasmid vector, viral vector, or engineered bacteria.
7. The application according to claim 5, characterized in that, The plant in question belongs to the Actinidiaceae family.
8. An application of improving plant disease resistance by silencing or inhibiting the expression of the kiwifruit AcGA2ox gene as described in claim 1 or 2.
9. The application according to claim 8, characterized in that, The plant in question belongs to the Actinidiaceae family.