Application of LrbZIP44 gene in promoting lateral branch and inhibiting spine in Lycium ruthenicum Murr.

Abstract

This invention relates to the field of forestry biotechnology, specifically to the application of the LrbZIP44 gene in promoting lateral branching and inhibiting thorn development in black goji berries. After transplanting, three LrbZIP44-OE lines showed a significantly increased number of new lateral branches per plant compared to WT lines, with a significantly lower thorn development rate, thorn length, and thorn base diameter. Some even exhibited a phenotype where thorns transformed into lateral branches. After transplanting, three typical RNAi-LrbZIP44 lines showed a significantly reduced number of new lateral branches per branch compared to WT lines, with an increased proportion of thorny lateral branches. Their thorn development rate, thorn length, and thorn base diameter were significantly greater than those of WT lines. In conclusion, LrbZIP44 significantly promotes lateral branch formation in black goji berries, significantly inhibits thorn development and growth, and plays a positive regulatory role in the transformation of thorns into lateral branches.

Description

Technical Field

[0001] This invention relates to the field of forest biotechnology, and in particular to the application of the LrbZIP44 gene in promoting lateral branches and inhibiting thorn formation in black goji berries. Background Technology

[0002] Black goji berry (Lycium ruthenicum Murr.) is a shrub belonging to the genus Lycium in the family Solanaceae. Its branches are thorny (Ke et al., 2025), and it is commonly distributed in arid deserts and saline-alkali areas of Northwest China (Sun et al., 2025), and is also found in Central Asia, the Caucasus, and Europe (Liu et al., 2024). Black goji berry possesses excellent characteristics such as drought tolerance, salinity tolerance, tolerance to poor soil, and strong root suckering ability (Wen et al., 2024), making it an excellent tree species for improving saline-alkali land in Northwest China (Ai et al., 2023; Cheng et al., 2026), and also a pioneer plant unique to desert regions (Du et al., 2022). Furthermore, the fruit of black goji berry is rich in anthocyanins, polysaccharides, vitamins, and trace minerals (Sun et al., 2025), and has antioxidant, anti-tumor, and lipid-lowering effects (Shen and Zheng, 2024). Black goji berry fruit is not only edible and medicinal, but also used to extract pigments (for coloring products) and anthocyanins (as antioxidants), resulting in high market demand (Chen et al., 2025). While plant thorns protect against predation by herbivores, pathogen infection, and mechanical damage, and reduce water loss, they can also negatively impact harvesting, transportation, and field operations (Figueiredo et al., 2024). In the case of black goji berry, the dense thorns on its branches also pose challenges to daily management and fruit harvesting (Zhou et al., 2026). Therefore, cultivating superior thornless black goji berry varieties is of great significance for economic production. The thorns of black goji berry are branch thorns, originating from the meristematic tissue in the leaf axils (Ke et al., 2025), and are different from bark thorns. Studies have shown that removing bark thorns from Solanum cleistogamum using gene editing technology does not alter the fruit's morphology and sweetness (Satterlee et al., 2024).

[0003] The basic leucine zipper (bZIP) gene family is one of the most abundant and conserved transcription factor families in eukaryotic plants, divided into 13 groups (named AL and S, respectively) (Wang et al., 2017). It participates in various physiological processes, including abiotic stress responses, anthocyanin accumulation, and the regulation of plant growth and development (Liu et al., 2025). bZIP44 is a member of the S1-bZIP family and can form a heterodimer with class C bZIPs (Wildenhain et al., 2025). bZIP44 proteins play important roles in various abiotic stress responses, including adaptive regulation of drought stress, salt stress (Sun et al., 2021), lead stress (Wu et al., 2025), cadmium stress (Wu et al., 2023), and nitrogen deficiency stress (Lu et al., 2021). Furthermore, the bZIP44 protein also functions in secondary metabolism (Zhang et al., 2023; Jiang et al., 2025), growth and development (Jiang et al., 2021; Iglesias-Fernández et al., 2013), and disease resistance regulation (Li Xian, 2022; Nie Jingyuan, 2022). However, no reports have been found regarding the regulation of lateral branching, thorn formation, or development by the plant bZIP44 gene. This invention is the first to discover that the LrbZIP44 gene in black wolfberry has a novel function of promoting lateral branching and inhibiting thorn formation. Summary of the Invention

[0004] To address the aforementioned issues, this invention provides the application of the LrbZIP44 gene in promoting lateral branches and inhibiting thorn formation in black goji berries.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] This invention provides the application of the LrbZIP44 gene in promoting lateral branches and inhibiting thorn formation in black goji berries.

[0007] Preferably, the nucleotide sequence of the LrbZIP44 gene is shown in SEQ ID No. 1.

[0008] Preferably, overexpression of the LrbZIP44 gene promotes lateral branching and inhibits thorn formation in black goji berries.

[0009] Preferably, overexpression of the LrbZIP44 gene inhibits the occurrence of black fruit thorns, causing the thorns to transform into lateral branches.

[0010] The beneficial effects of this invention are:

[0011] This embodiment successfully constructed the LrbZIP44 overexpression vector pRI101-LrbZIP44 and the repressive expression vector pRNAi-LrbZIP44. Three OE-LrbZIP44 overexpression lines and nine RNAi-LrbZIP44 repressive expression lines were successfully obtained through stable transformation. Although the expression of the LrbZIP44 downstream gene LrTPP3 was upregulated in the OE-LrbZIP44 lines and downregulated in the RNAi-LrbZIP44 lines, neither regulation was statistically significant and not significantly correlated with the LrbZIP44 gene expression level. After transplanting, compared with WT, the three LrbZIP44-OE lines showed a significantly increased number of new lateral branches per plant, a significantly lower thorn development rate on thorny lateral branches, and smaller thorn length and thorn base diameter. Some even exhibited a phenotype where thorns transformed into lateral branches. After transplanting, the three typical RNAi-LrbZIP44 lines showed a significant decrease in the number of newly developed lateral branches per branch compared to WT, and an increased proportion of thorny lateral branches. The thorn development rate, thorn length, and thorn base diameter of the thorny lateral branches were all significantly greater in LrbZIP44 than in WT. In conclusion, LrbZIP44 significantly promotes the formation of lateral branches in black goji berries, significantly inhibits the occurrence and growth of thorns, and plays a positive regulatory role in the transformation of thorns into lateral branches. Attached Figure Description

[0012] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0013] Figure 1 The expression structures of LrbZIP44 overexpression and inhibition vectors in black wolfberry are shown.

[0014] Figure 2 The specific sequence for constructing the RNAi vector of LrbZIP44 from black goji berries;

[0015] Figure 3 PCR electrophoresis image of E. coli overexpression vector pRI101-LrbZIP44. M, D2000 Plus DNAMaker; 1-2, single-clone bacterial culture; 3, water;

[0016] Figure 4 PCR electrophoresis image of Agrobacterium tumefaciens overexpression vector pRI101-LrbZIP44; M, D2000 Plus DNAMaker; 1-2, single-clone bacterial culture; 3, pRI101-LrbZIP44 plasmid; 4, water;

[0017] Figure 5PCR electrophoresis image of E. coli culture containing the forward-directed target fragment of the pRNAi-LrbZIP44-F vector; M, D2000 DNA Maker; 1-4, single-clone bacterial cultures; 5, water;

[0018] Figure 6 PCR electrophoresis image of E. coli culture containing the reversed target fragment of the pRNAi-LrbZIP44 vector; M, D2000 DNAMaker; 1-4, single-clone bacterial culture; 5, water;

[0019] Figure 7 PCR electrophoresis image of Agrobacterium tumefaciens bacterial culture containing the pRNAi-LrbZIP44 repressive expression vector; M, D2000 Plus DNAMaker; 1-8 and 1'-8', single-clone bacterial cultures; +, pRNAi-LrbZIP44 plasmid; W, water;

[0020] Figure 8 The process of obtaining resistant plants of black goji berry overexpressing LrbZIP44 is as follows: A, pre-culture of leaf tip explants; B, rooting of leaf tip explants; C, growth of resistant buds from leaf tip explants; D, propagation of resistant plants by stems.

[0021] Figure 9 PCR verification of DNA from black goji berry resistant plants transformed with pRI101-LrbZIP44 vector: M, D2000 Plus DNA Maker; 1, WT; 2, 44OE-24; 3, 44OE-27; 4, 44OE-29; 5, pRI101-LrbZIP44 plasmid.

[0022] Figure 10 The data in the figure are the mean ± standard error of three replicate experiments. *P<0.05, **P<0.01, ***P<0.001.

[0023] Figure 11 The data in the figure are the mean ± standard error of three replicate experiments. * indicates P < 0.05, and *** indicates P < 0.001.

[0024] Figure 12 The following figures represent the effects of LrbZIP44 overexpression on the phenotype of black wolfberry after transplanting: A, WT plant; B, LrbZIP44 overexpressing plant; C, thorny lateral branch; D, C figure without leaves; E, leaves of thorny lateral branch; F, thornless lateral branch; G, F figure without leaves; H, leaves of thornless lateral branch.

[0025] Figure 13The process for obtaining LrbZIP44-resistant plants in black wolfberry is as follows: A, pre-culture of leaf explants; B, rooting of leaf explants; C, budding of leaf explants; D, propagation of resistant plants from stem segments with terminal buds.

[0026] Figure 14 DNA validation of LrbZIP44-inhibited expression in black goji berry resistant plants; M, D2000 Plus DNAMaker; 1, WT; 2, 44R-2; 3, 44R-26; 4, 44R-27; 5, 44R-29; 6, 44R-52; 7, 44R-57; 8, 44R-67; 9, 44R-81; 10, 44R-89; 11, pRNAi-LrbZIP44 vector; 12, water;

[0027] Figure 15 The data in the figure are the mean ± standard error of three replicate experiments. *** indicates P < 0.001, **** indicates P < 0.0001.

[0028] Figure 16 qRT-PCR validation of LrbZIP44 inhibition expression in potted seedlings of black goji berries. The data in the figure are the mean ± standard error of three replicate experiments. * P < 0.05, *** P < 0.001;

[0029] Figure 17 The images show the representative effects of LrbZIP44 inhibition on the phenotype of black wolfberry after transplanting. A, WT plant; B, LrbZIP44 inhibited plant; C, thorny lateral branch; D, C image without leaves; E, leaves of thorny lateral branch; F, thornless lateral branch; G, F image without leaves; H, leaves of thornless lateral branch. Detailed Implementation

[0030] This invention provides the application of the LrbZIP44 gene in promoting lateral branching and inhibiting thorn formation in black wolfberry. In this invention, overexpression of the LrbZIP44 gene preferably promotes lateral branching and inhibits thorn formation in black wolfberry. In this invention, overexpression of the LrbZIP44 gene inhibits thorn formation in black wolfberry, causing thorns to transform into lateral branches. In this invention, the nucleotide sequence of the CDS of the LrbZIP44 gene is shown in SEQ ID No. 1, specifically as follows (5'-3'):

[0031] ATGGCATCATCAAGTGGGACATCATCAGGGTCAGGTTCAGGGTCATATACAATTCAAAAGCCAGGATCAGAAGAAGATCTACAACAATTGATGGATCAGAGGAAGAGGAAGAGGATGATATCGAACCGCGAATCGGCCCGAAGATCAAGAATGAGGAAACAGAAACATTTGGATGATCTTATGTCCCAATTGGATCATCTTAGGAAAGAAAATAACCAAATCTTGACAAGCATG AATGTGACCACTCAATATTATCTCAATGTTGAGGCTGAGAATTCAATAATGAGAGCTCAAGTTTCTGAATTGGGCCACAGGGCCACAGGCTTGAGTCCCTGATGAAATCATCAGTTTCTCGAATGAGAATGGATCAAATGGTCAAATAATTGAGTCTACTATGGCTGATGGATTTATTCAGAATGAATCTTGGAATTATATGTACCAGCCTATCGTGACTGCAGATATCATGCAATATTAG.

[0032] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0033] Example 1

[0034] 1. LrbZIP44 gene promotes lateral branching and inhibits thorn formation.

[0035] 1.1 Experimental materials and primers, etc.

[0036] 1.1.1 Plant materials

[0037] Leaves from tissue-cultured black wolfberry clones that had grown for 45 days and had large, well-developed leaves were used as the transformation recipient material for constructing stable genetic transformation lines. These plant materials were preserved in the tissue culture room of the Liaoning Provincial Key Laboratory of Forest Genetics, Breeding and Cultivation, where the temperature was maintained at 25±1℃, the light intensity at 2000 lx, and light and dark cycles were repeated for 12 hours each.

[0038] 1.1.2 Main Instruments and Reagents

[0039] 1.1.2.1 Main Instruments

[0040] The instruments used in this experiment include an electrophoresis apparatus, an ultraviolet gel imaging system, a spectrophotometer, a NanoDropone Thermo ultra-micro spectrophotometer, and a PCR instrument.

[0041] 1.1.2.2 Main Reagents (Kits)

[0042] Sma I, Xba I, Kpn I, and EcoR I restriction endonucleases were purchased from LABLEAD; Real Taq DNA polymerase (RTC3102-02), 10 x Real Taq Buffer (RTC3102-02), 10 mM dNTPs (RTN3201-01), agarose gel DNA recovery kit (RTP2201-02), standard plasmid miniprep kit (RTP2102-02), and 50 mg / mL rifampicin solution were purchased from Real-Times; NovoRec® plus One step PCR Cloning Kit was purchased from Suzhou Nearshore Protein Co., Ltd.; T4 DNA Ligase was purchased from Prometheus; Acetyleugenol (As) and cefotaxime sodium (Cef) were purchased from Sangon; TIANGEN RNA extraction kit (DP452); CWBIO DNA extraction kit (CW0531M); Real-time PCR kit (BL697A) were purchased from Beijing Lanjieke Company; 2 × Rapid Taq Master Mix enzyme and HiScript were also used. ® The IIIRT SuperMix for qPCR (+gDNA wiper) (R323-01) kit, SYBR qPCR Master Mix, and ClonExpress Ultra One Step Cloning Kit V3 were purchased from Vazyme.

[0043] 1.1.3 Culture media and formulation used in the experiment

[0044] The formulations of the 1 / 2 MS (liquid / solid), MS (liquid / solid), LB (liquid / solid), and YEP (liquid / solid) media used in this experiment can be found in Jiang Yingyue's paper (2025).

[0045] 1.1.4 Carriers and strains

[0046] The pRI101 and pRNAi-E vectors used in the experiment (Song Mengru et al., 2017) were preserved in the Liaoning Provincial Key Laboratory of Forest Genetics, Breeding and Cultivation. Escherichia coli DH5α (G6016) and Agrobacterium tumefaciens GV3101 (G6039) were purchased from Shanghai Angyu Biotechnology Co., Ltd.

[0047] 1.1.5 Primers used in the experiment

[0048] The primers used in the experiment were synthesized at Suzhou Genewiz Biotechnology Co., Ltd. (https: / / www.genewiz.com.cn / ), and the specific information is shown in Table 1.

[0049] Table 1 Primers used in this experiment.

[0050]

[0051] 1.2 Test Methods

[0052] 1.2.1 Construction of overexpression and repression vectors

[0053] 1.2.1.1 Primer Design

[0054] Using pRI101 as the original vector, and selecting SmaⅠ and XbaⅠ as restriction enzyme sites, primers OE-LrbZIP44-F / R (Table 1) were designed to construct the overexpression vector pRI101-LrbZIP44. Figure 1 For the construction of the repressive expression vector pRNAi-LrbZIP44, a specific sequence of 187 bp was designed based on the CDS sequence of LrbZIP44 using the online website (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ). Figure 2 Using pRNAi-E as the original vector, and selecting Sma I and Xba I as double restriction sites, primers iLrbZIP44-JF / JR (Table 1) were designed and synthesized. The forward fragment of the specific sequence was inserted upstream of the intron of the pRNAi-E vector. Figure 1 Using Kpn I and EcoR I as restriction sites, primers iLrbZIP44-AF / AR (Table 1) were designed to insert the reverse fragment of the specific sequence downstream of the intron in the pRNAi-E vector. Figure 1 ).

[0055] 1.2.1.2 Amplification and Recovery of the LrbZIP44 Target Fragment

[0056] To construct the pRI101-LrbZIP44 vector, the LrbZIP44 target fragment was amplified using the OE-LrbZIP44-F / R primer pair, with a T vector containing the LrbZIP44 gene as the template. The PCR reaction system is as follows:

[0057] Table 2 System

[0058]

[0059] The PCR reaction program was 95℃ for 5 min; 95℃ for 30 s; 65.2℃ for 30 s, 72℃ for 1 min, for 35 cycles; 72℃ for 5 min; and stored at 12℃.

[0060] To construct the pRNAi-LrbZIP44 vector, the forward and reverse target fragments of the specific sequence were amplified using primer pairs iLrbZIP44-JF / JR and iLrbZIP44-AF / AR, respectively. The template for both was a T-vector containing the LrbZIP44 gene. The PCR reaction system is as follows:

[0061] Table 3 System

[0062]

[0063] The PCR amplification process consisted of 35 cycles: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 57℃ annealing for 30 s, and 72℃ extension for 40 s; 72℃ extension for 5 min; and finally storage at 12℃.

[0064] After electrophoresis, the PCR products were observed and photographed using a UV gel imaging system to record gene amplification. The target band was excised with a clean scalpel and placed in a 1.5 mL centrifuge tube. The weight of the excised gel piece was measured. Subsequent procedures were performed according to the instructions of the agarose gel DNA recovery kit (RTP2201-02). The recovered product was stored at -20°C.

[0065] 1.2.1.3 Enzyme digestion of pRI101 and pRNAi-E vectors and ligation with the target fragment

[0066] E. coli containing the pRI101 and pRNAi-E vectors were thawed on ice after being removed from a -80℃ freezer. They were then streaked onto LB solid medium and incubated at 37℃ for 24 h. Single colonies were picked and inoculated into 1 mL LB liquid medium (centrifuge tube) and incubated at 37℃ for 20 h. 100 μL of the bacterial culture from this centrifuge tube was transferred to a larger centrifuge tube containing 10 mL LB liquid medium and incubated at 37℃ with shaking for 16-18 h. 50 mg / L Kan was added to both the LB solid / liquid medium. Plasmids (vectors) were then extracted according to the instructions of the standard plasmid miniprep kit (RTP2102-02), and their concentrations were determined. The extracted pRI101 and pRNAi-E original vector plasmids were digested with Sma I and Xba I enzymes, respectively. The reaction system is as follows:

[0067] Table 4 System

[0068]

[0069] The enzyme digestion program was a 37°C water bath for 4 hours. Products successfully verified by electrophoresis were purified and recovered as DNA, following the instructions of the agarose gel DNA recovery kit (RTP2201-02).

[0070] Homologous recombination was used to ligate the LrbZIP44 target gene fragment and the pRI101 linear vector. The ligation system is as follows:

[0071] Table 5 System

[0072]

[0073] The ligation was performed in a PCR instrument at 50°C for 15 minutes.

[0074] Homologous recombination was used to ligate a specific sequence of the target gene fragment and the pRNAi-E linear vector. The ligation system is as follows:

[0075] Table 6 System

[0076]

[0077] Ligation was performed in a PCR instrument at 50°C for 15 min. The successfully ligated vector was named pRNAi-LrbZIP44-F.

[0078] 1.2.1.4 Enzyme digestion of pRNAi-LrbZIP44-F vector and homologous ligation with the target fragment

[0079] After extracting the pRNAi-LrbZIP44-F vector plasmid according to the method in section 1.2.1.3, it was digested with Kpn I and EcoRI enzymes. The digestion system is as follows:

[0080] Table 7 System

[0081]

[0082] The enzyme digestion procedure is the same as in 1.2.1.3. After the enzyme digestion product is successfully detected by 1% agarose gel electrophoresis, DNA purification and recovery are performed using the same method as in 1.2.1.3.

[0083] The reverse target fragment of the specific sequence was homologously ligated with the pRNAi-LrbZIP44-F linear vector, and the ligation system is as follows:

[0084] Table 8 System

[0085]

[0086] The ligation procedure was to react at 50°C in a PCR instrument for 15 min.

[0087] 1.2.2 Sequencing verification of recombinant vector and transformation into Agrobacterium

[0088] 1.2.2.1 Transformation of E. coli with the recombinant vector and sequencing verification

[0089] The ligated pRI101-LrbZIP44, pRNAi-LrbZIP44-F, and pRNAi-LrbZIP44 vectors were heat-shocked and transformed into *E. coli* DH5α competent cells, following the manufacturer's instructions. Single colonies were picked and inoculated into 1 mL of LB broth (containing 5 mg / L Kan), and cultured at 37°C and 180 rpm for 12–16 h. PCR verification of *E. coli* single colonies containing the pRI101-LrbZIP44, pRNAi-LrbZIP44-F, and pRNAi-LrbZIP44 vectors was performed using primer pairs M13-F / OE-LrbZIP44-R, M13-F / iLrbZIP44-JR, and iLrbZIP44-AF / M13-R (Table 1). The PCR reaction system was the same as in Table 3.

[0090] The PCR reaction program for single colony suspensions containing the pRI101-LrbZIP44 vector was as follows: 95℃ for 5 min; 95℃ for 30 s, 57℃ for 30 s, 72℃ for 2 min, 35 cycles; 72℃ for 5 min; store at 12℃. The PCR reaction program for single colony suspensions containing pRNAi-LrbZIP44-F and pRNAi-LrbZIP44 vectors was as follows: 95℃ for 5 min; 95℃ for 30 s, 57℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min; store at 12℃. PCR products were validated by 1% agarose gel electrophoresis. Positive E. coli suspensions were sequenced. Successfully sequenced strains were mixed with an equal volume of 60% glycerol and stored at -80℃.

[0091] 1.2.2.2 Extraction of recombinant vectors from Escherichia coli

[0092] E. coli containing recombinant vectors pRI101-LrbZIP44 and pRNAi-LrbZIP44 were taken from a -80℃ freezer, and the vectors were extracted after activating the bacterial culture. The operation steps were performed according to 1.2.1.3.

[0093] 1.2.2.3 Transformation of Agrobacterium with recombinant vector

[0094] The recombinant vectors pRI101-LrbZIP44 and pRNAi-LrbZIP44 extracted from *E. coli* were transformed into *Agrobacterium tumefaciens* GV3101 competent cells using a freeze-thaw method. Detailed procedures were performed according to the *Agrobacterium tumefaciens* competent cell transformation instructions.

[0095] Single-clone bacterial cultures were cultured with shaking according to the method described in section 1.2.1.3. PCR verification of Agrobacterium culture containing the pRI101-LrbZIP44 vector was performed using primer pair M13-F / OE-LrbZIP44-R (Table 1). PCR verification of Agrobacterium culture containing the pRNAi-LrbZIP44 vector was also performed using primer pairs M13-F / iLrbZIP44-JR and iLrbZIP44-AF / M13-R (Table 1).

[0096] The PCR reaction system and procedure are the same as in section 1.2.2.1. The PCR products were then subjected to electrophoresis. Agrobacterium suspensions with single bands and correct lengths were selected and added to an equal volume of 60% glycerol, then stored at -80°C.

[0097] 1.2.3 Stable genetic transformation of black goji berries

[0098] 1.2.3.1 Pre-culture of black wolfberry explants

[0099] Leaf tips of black goji berry tissue culture seedlings were cut in a clean bench, reversed onto MS solid medium with the adaxial surface facing down, and pre-cultured in the tissue culture room for 4-5 days.

[0100] 1.2.3.2 Preparation of Infection Solution

[0101] Agrobacterium glycerol strains containing pRI101-LrbZIP44 and pRNAi-LrbZIP44 vectors, taken from the ultra-low temperature freezer, were streaked onto YEP solid medium (containing 300 mg / L Rif and 25 mg / L Kan), respectively. Single colonies were picked and shaken to obtain 1 mL of bacterial suspension, following the same procedure as in 1.2.1.3. The 1 mL single colony suspensions containing different vectors were then further cultured with shaking to obtain 40 mL of OD... 600 Bacterial suspensions with a concentration of 0.5-0.7 were resuspended in 40 mL MS solution (containing 150 μmol / L AS) and treated at 4°C for 50 min.

[0102] 1.2.3.3 Stable transformation of black goji berry explants

[0103] In this experiment, 5 mg / L Kan was used to screen for LrbZIP44 overexpression and inhibition transformation materials in black wolfberry. All transformation materials were cultured in the tissue culture room under the same conditions as in 1.1.1. The specific steps for stabilizing the transformation are as follows:

[0104] ① Co-cultivation

[0105] After pre-culturing, the explants from the leaf tips of *Lycium barbarum* were immersed in empty petri dishes containing the above-mentioned infection solution for 10-15 minutes, with continuous shaking during the immersion process. After immersion, the explants were spread flat on paper and air-dried for 8 minutes to remove excess bacterial solution from the surface of the explants. Then, the explants were reverse-inoculated onto MS+AS (150 μmol / L) solid medium and cultured in the dark at 25°C for 3-5 days.

[0106] ② Screening and Cultivation

[0107] After dark culture, the black goji berry leaf tip explants were washed 3-4 times with sterilized distilled water until the water was clear. After drying on paper, the explants were reverse-inoculated onto MS+Kan+Cef (300 mg / L) solid medium for selection, and the culture was observed regularly. If no Agrobacterium grew on the explants during selection, the selection medium was changed every 14 days. Otherwise, the selection medium was changed immediately. Throughout the process from rooting to bud formation and the development of a complete plant, the explants were cultured on 1 / 2 MS+Kan+Cef (300 mg / L) solid medium for selection.

[0108] ③ Rooting culture

[0109] When the resistant plants grown from leaf tip explants reach 5-6 cm in length, stem segments with terminal buds are cut 1 cm above the root and inoculated into 1 / 2 MS + Kan + Cef (300 mg / L) solid medium for rooting culture. The rooted portions are then subcultured in the same 1 / 2 MS medium. When axillary buds sprout and grow to 5-6 cm, more stem segments with buds are cut off for further culture.

[0110] 1.2.4 Molecular detection of tissue-cultured resistant black goji berries

[0111] 1.2.4.1 DNA testing

[0112] Using black goji berry WT and LrbZIP44 overexpression and inhibition vector-transformed resistant plants in tissue culture flasks inoculated with the strains after approximately 50 days of growth as test material donors, leaf samples were collected. Genomic DNA was extracted using a novel plant genomic DNA extraction kit (CW0531M) and used as templates for PCR amplification. Primer pairs ATA51-F and OE-LrbZIP44-R (Table 1) were designed based on the LrbZIP44 gene and pRI101 vector sequences for PCR verification of DNA from overexpression strains transformed into resistant black goji berries. The PCR reaction system was the same as in Table 3, and the PCR reaction program was: 95℃ for 5 min; 95℃ for 30 s, 64℃ for 30 s, 72℃ for 82 s, 35 cycles; 72℃ for 5 min; stored at 12℃. Primer pairs iDNA-F2 and iLrbZIP44-JR (Table 1) were designed based on the LrbZIP44 gene and pRNAi-E vector sequences for PCR verification of the transformation of resistant black wolfberry DNA by the inhibited expression strain. The PCR reaction system was the same as in Table 3, and the PCR reaction program was: 95℃ for 5 min; 95℃ for 30 s, 58.5℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min; stored at 12℃.

[0113] After electrophoresis, the amplified products are observed to determine the amplification status of the bands. If the resistant black goji berry plant amplifies a single band that is highly consistent with the positive vector, and the WT black goji berry plant does not have a band at that position, it indicates that the corresponding region of the vector has been successfully integrated into the genome of the resistant black goji berry plant.

[0114] 1.2.4.2 RNA detection

[0115] After DNA-verified resistant black goji berry plants were propagated to form lines, leaves from 40-day-old black goji berry rootstocks and tissue culture seedlings transformed with overexpression and inhibition strains were used as experimental materials. After quick-freezing and grinding in liquid nitrogen, total RNA was extracted using a plant tissue RNA extraction kit (DP452) according to the manufacturer's instructions. RNA quality and concentration were determined by 1% gel electrophoresis and a NanoDrop One spectrophotometer (Thermo). RNA that met the quality standards was stored at -80℃ for subsequent reverse transcription. HiScript was used... ® The III RT SuperMix for qPCR (+gDNA wiper) (R323-01) kit was used to reverse transcribe the RNA extracted above. The specific operation was strictly performed according to the instructions.

[0116] To determine whether the successfully validated DNA insertion lines were successful LrbZIP44 overexpression lines (OE-LrbZIP44) or suppressed expression lines (RNAi-LrbZIP44) in *Lycium barbarum*, we further validated the relative expression level of the LrbZIP44 gene in these lines. Using GAPDH-F / R as internal control primers (Table 1) and 44DL-F / R as quantitative primers (Table 1), we performed qRT-PCR using a universal real-time PCR kit (BL697A). Furthermore, the previous chapter revealed that LrbZIP44 binds to the LrTPP3 promoter, suggesting that LrbZIP44 regulates LrTPP3 expression. Therefore, we simultaneously detected the relative expression level of LrTPP3 in the above materials, designing a primer combination of 3DL-F / R (Table 1). The reaction system followed the procedures outlined in Xu Weiman's (2024) paper. The reaction procedure is described in the SYBR qPCR Master Mix instruction manual. Using 2 -△△Ct The relative expression levels of LrbZIP44 and LrTPP3 were calculated using a method similar to SPSS 26.0, and the gene expression levels were analyzed using an independent samples t-test (P < 0.01). The correlation between the gene expression levels of LrbZIP44 and LrTPP3 was analyzed using GraphPad Prism 8.0 software.

[0117] 1.2.5 Detection of LrbZIP44 expression level after transplantation of transgenic lines

[0118] 1.2.5.1 Transplanting

[0119] In the OE-LrbZIP44 and RNAi-LrbZIP44 lines of black goji berries, three lines with the most significant upregulation and downregulation of the LrbZIP44 gene were selected from each line. When these lines reached about 50 days of growth and had relatively robust and developed root systems, they were transplanted together with the WT line of black goji berries, which was propagated at the same time and had the same growth status. The experiment was set up with three biological replicates.

[0120] Sterilize the potting soil at 120℃ for 1 hour, then let it cool. Mix the potting soil, perlite, and vermiculite in a ratio of 18:5:3. Add cool water and mix well to moisten the mixture, providing a suitable growing environment for the roots. Divide the mixed substrate into pots of the same size, ensuring that each pot has the same volume of substrate.

[0121] Weigh 2 g of carbendazim and mix it in 1 L of water. Remove the LrbZIP44 overexpression, inhibited expression, and WT black goji berry tissue culture seedlings from the culture flasks and gently rinse off the solid culture medium to avoid damaging the roots. Then, immerse the seedlings in the prepared carbendazim solution for 30 min for sterilization. After soaking, transplant one seedling into each pot containing substrate and cover the seedling with a transparent plastic cup with holes at the bottom to retain moisture.

[0122] 1.2.5.2 Detection of LrbZIP44 expression level after transplantation

[0123] To ensure stable overexpression or suppression of the LrbZIP44 gene in OE-LrbZIP44 and RNAi-LrbZIP44 lines after transplanting, each potted black goji berry seedling was pruned 25 days after transplanting, retaining 5 nodes on each branch. After 30 days of growth, before phenotypic testing, leaves from LrbZIP44 overexpressing, suppressed, and WT potted plants were used as experimental materials for RNA extraction and qRT-PCR analysis. The method was the same as in section 1.2.4.2.

[0124] 1.2.6 Phenotypic determination of transgenic lines after transplantation

[0125] Gene expression level detection of transgenic lines after transplantation showed that this example obtained lines with stable overexpression and suppressed expression of LrbZIP44. Based on this, the thorn and stem-leaf phenotypes of black goji berry OE-LrbZIP44, RNAi-LrbZIP44, and WT lines pruned for 30 days were measured and analyzed using calipers and a measuring tape. Phenotypic measurement indicators include the total number of new branches (lateral branches) per plant (total number of new lateral branches ÷ total number of plants), the number of new lateral branches per branch (total number of new lateral branches ÷ total number of pruned branches), the proportion of new completely thornless lateral branches (new completely thornless branches ÷ total number of new branches × 100%), the proportion of new thorny lateral branches (new thorny branches ÷ total number of new branches × 100%), the thorn production rate of new thorny lateral branches (number of thorny leaf axils ÷ total number of leaf axils × 100%), the thorn-to-lateral branch ratio (number of small lateral branches of new thorny lateral branches ÷ total number of thorns and small lateral branches of new thorny lateral branches × 100%), and the thorn length and thorn width of new thorny lateral branches. Leaf length, leaf width, leaf thickness, number of leaves per cluster (total number of leaves ÷ number of leaf clusters), branch length, branch width, internode length [lateral branch length ÷ (number of leaf clusters + 1)], and lignification degree (length of white part of new lateral branch ÷ total length × 100%) were recorded for both thorny and thornless lateral branches. Leaf thickness was measured using the clamping method. One-way ANOVA analysis was performed on the statistical phenotypic data using SPSS 26.0 (P < 0.05).

[0126] 1.3 Results and Analysis

[0127] 1.3.1 Construction of the pRI101-LrbZIP44 vector

[0128] Electrophoresis results of PCR verification of positive monoclonal bacterial cultures after transformation of E. coli DH5α competent cells with pRI101-LrbZIP44 vector are as follows: Figure 3 As shown, the target lanes (1 and 2) exhibit a correctly positioned and single target band, indicating that the pRI101-LrbZIP44 vector has been successfully transformed into E. coli. Successful bacterial culture sequencing confirmed that the sequence and orientation were correct. Figure 3 ).

[0129] The pRI101-LrbZIP44 plasmid, which was successfully sequenced and validated, was freeze-thawed into Agrobacterium GV3101. PCR validation was performed on single-clone bacterial cultures, and the electrophoresis results are shown below. Figure 4 As shown, a single band appeared in the target bacterial culture (lanes 1 and 2), consistent with the band position of the plasmid positive control (lane 3), indicating that the pRI101-LrbZIP44 plasmid had been successfully transformed into Agrobacterium. Figure 4 ).

[0130] 1.3.2 Construction of pRNAi-LrbZIP44 vector

[0131] After transforming E. coli DH5α competent cells with the pRNAi-LrbZIP44-F vector, the electrophoresis results of PCR verification of positive monoclonal bacterial cultures are as follows: Figure 5 As shown, the bacterial culture samples in lanes 1-4 exhibited correctly positioned and singular target bands, indicating that the pRNAi-LrbZIP44-F vector was successfully transformed into E. coli. Bacterial culture sequencing results showed that the orientation of the inserted fragment and the DNA sequence were correct.

[0132] After homologous ligation of the inverted target fragment with the specific sequence and the correctly sequenced pRNAi-LrbZIP44-F plasmid, the fragment was transformed into *E. coli* DH5α competent cells. Electrophoresis results for PCR verification of positive monoclonal cultures are shown below. Figure 6 As shown, the reversed target fragment of the specific sequence was successfully ligated into the pRNAi-LrbZIP44-F vector. The successfully validated bacterial culture was sent to the company for sequencing, and the results showed that the sequence and insertion direction were correct.

[0133] The pRNAi-LrbZIP44 plasmid, whose sequencing results were correctly matched, was freeze-thawed and injected into Agrobacterium GV3101. Double PCR verification was performed on single-clone bacterial cultures in the same tube using primer pairs M13-F / iLrbZIP44-JR and iLrbZIP44-AF / M13-R, respectively. Electrophoresis results are shown below. Figure 7 As shown, except for the sample in tube 7, all other samples were successfully verified, indicating that the pRNAi-LrbZIP44 plasmid has been successfully transformed into Agrobacterium bacteria other than tube 7, and can be used for subsequent experiments.

[0134] 1.3.3 Obtaining and identifying LrbZIP44 overexpression resistant plants of black wolfberry

[0135] 1.3.3.1 Obtaining LrbZIP44 overexpression resistant plants of black wolfberry

[0136] The process of obtaining LrbZIP44 overexpression resistant plants is as follows: Figure 8 As shown, black wolfberry leaf tip explants that had been pre-cultured for 4 days were used ( Figure 8 (A) was subjected to stable transformation. After culturing on the selection medium for 16 days, the leaf tip explants began to grow adventitious roots. They were then cultured for another 15 days until the root system was well-developed and robust. Figure 8 After inoculating the plate into the tissue culture bottle and continuing to culture for 10 days, resistant shoots began to grow. When the resistant shoots grew to 2-3 cm ( Figure 8 (C) Stem segments with terminal buds were cut and inoculated into rooting medium for propagation, eventually yielding resistant plants (C). Figure 8 (D).

[0137] 1.3.3.2 Detection of DNA and RNA in LrbZIP44 overexpression vector-transformed resistant tissue culture plants

[0138] (1) DNA level detection

[0139] DNA was extracted from the bacterial culture of the LrbZIP44 overexpression vector in black wolfberry and transformed into resistant plants. Using this DNA as a template, PCR detection was performed using primers ATA51-F / OE-LrbZIP44-R (Table 1). Electrophoresis results are shown below. Figure 9 As shown, lanes 2, 3, and 4 exhibit highly consistent and single bands with lane 5 (pRI101-LrbZIP44 plasmid), while no bands are observed in the WT, indicating that the T-DNA region of the pRI101-LrbZIP44 vector has been successfully integrated into the DNA of the tested resistant plants. The experimental numbers for these three resistant lines are 44OE-24, 44OE-27, and 44OE-29, which will be referred to by abbreviations below.

[0140] (2) RNA level detection

[0141] The qRT-PCR results after reverse transcription of RNA from the three strains 44OE-24, 44OE-27, and 44OE-29 showed that the relative epigenetic level of the LrbZIP44 gene in the three strains was upregulated to 1.90-fold, 2.87-fold, and 1.71-fold of the WT, respectively, and reached a significant level. Figure 10 This demonstrates that these three lines are black wolfberry lines overexpressing the LrbZIP44 gene. The relative expression levels of the LrTPP3 gene were upregulated to 1.17-fold, 1.10-fold, and 1.31-fold, respectively. Figure 10 However, the correlation between LrbZIP44 and LrTPP3 was not statistically significant. Correlation analysis showed that the correlation between LrbZIP44 and LrTPP3 in the three OE-LrbZIP44 lines was P = 0.8001 > 0.05, which was not statistically significant. These results indicate that LrbZIP44 does not directly participate in the regulation of LrTPP3 expression.

[0142] 1.3.4 Changes in gene expression in the OE-LrbZIP44 line after transplanting

[0143] To ensure stable upregulation of LrbZIP44 expression in the transplanted 44OE-24, 44OE-27, and 44OE-29 lines, the relative expression levels of LrbZIP44 and LrTPP3 genes in the three overexpressing and WT black wolfberry lines were analyzed again. qRT-PCR analysis showed that the relative expression level of LrbZIP44 in the 44OE-24, 44OE-27, and 44OE-29 lines was significantly upregulated to 5.21-fold, 7.96-fold, and 8.48-fold of that in the WT lines, respectively. Figure 11 The upward adjustment was more significant than that at the tissue culture seedling stage. Figure 11 vs. Figure 10 The relative expression levels of the LrTPP3 gene were 1.15-fold, 2.09-fold, and 1.11-fold higher than those of WT, respectively, but none of them reached a statistically significant level. Figure 11 The above results indicate that the expression level of LrbZIP44 in the three lines remained significantly upregulated after transplantation. These three lines are ideal LrbZIP44 overexpression transgenic lines for subsequent phenotypic analysis and gene function verification. Correlation analysis showed that the correlation between LrbZIP44 and LrTPP3 was P=0.4693>0.05, which was not statistically significant and therefore not considered a significant correlation.

[0144] 1.3.5 Overexpression of LrbZIP44 inhibits thorn formation and partially converts thorns into lateral branches.

[0145] Since no thorns were produced in the tissue culture seedlings of black wolfberry in the bottles (Ke et al., 2025), the thorns and stem-leaf phenotypes were measured after transplanting. Phenotypic data analysis of the three OE-LrbZIP44 lines and the WT line revealed that the number of newly developed lateral branches per plant was significantly higher in the three OE-LrbZIP44 lines than in the WT line (Table 9). Figure 12 In the middle A and B sections, the proportion of newly developed thornless lateral branches per plant was lower than that of WT, while the proportion of newly developed thorny lateral branches per plant was higher than that of WT, but neither reached a significant level (Table 9). Figure 12 (A and B in the middle).

[0146] Table 9. Effects of LrbZIP44 overexpression on the number of new lateral branches and the presence or absence of thorns in black goji berry.

[0147]

[0148] Data are the mean ± standard deviation of three replicates. Different lowercase letters in the same column indicate significant differences (P < 0.05).

[0149] It is noteworthy that the thorn emergence rate of the three OE-LrbZIP44 lines was significantly lower than that of the WT line in newly developed thorny lateral branches, and the thorn emergence rates of the 44OE-27 and 44OE-29 lines were also significantly lower than that of the 44OE-24 line (Table 10). Combined with the changes in the expression levels of the target gene in the three OE-LrbZIP44 lines (… Figure 11 It was found that the thorn production rate of thorny lateral branches of black wolfberry decreased with increasing LrbZIP44 gene expression level. Furthermore, typical thorn-to-lateral branch conversion was observed in the thorny lateral branches of all three OE-LrbZIP44 lines, while this change was not observed in WT (Table 10). Figure 12 (CD). The spine length and spine base diameter of the spiny lateral branches of the OE-LrbZIP44 strain were both less than WT, but did not reach a significant level (Table 10; Figure 12 (D).

[0150] Table 10 Effects of LrbZIP44 overexpression on the phenotypic characteristics of newly emerging lateral branches and thorns of *Lycium chinense*.

[0151]

[0152] Data are the mean ± standard deviation of three replicates. Different lowercase letters in the same column indicate significant differences (P < 0.05).

[0153] Among the thorny lateral branches, the leaf length and number of leaves per cluster of the 44OE-24 line were significantly greater than those of the 44OE-27 line, but the leaf length and number of leaves per cluster of the three OE-LrbZIP44 lines showed no significant difference from WT (Table 11). Among the thornless lateral branches, only the lateral branch length of the 44OE-29 line was significantly shorter than WT, while the lateral branch lengths of the other OE-LrbZIP44 lines were shorter than WT but not significantly so (Table 12); among the three OE-LrbZIP44 lines, only the leaf thickness of the 44OE-24 line was significantly shorter than WT (Table 12). Among the thorny and thornless lateral branches, the lateral branch width, lignification degree, and internode length of the LrbZIP44-OE line were all shorter than WT (Tables 11 and 12), and the leaf width of the three OE-LrbZIP44 lines was shorter than WT, but none of these differences were statistically significant (Tables 11 and 12). Figure 12 (E, H). In addition, the stem and leaf phenotypic data of the thorny lateral branches of the same line were greater than those of the thornless lateral branches (Tables 11 and 12; CH in 3-14).

[0154] Table 11 Effects of LrbZIP44 overexpression on the phenotypic characteristics of spiny lateral branches, stems, and leaves of black wolfberry.

[0155]

[0156] Data are the mean ± standard deviation of three replicates. Different lowercase letters in the same column indicate significant differences (P < 0.05).

[0157] Table 12 Effects of LrbZIP44 overexpression on the phenotypic characteristics of thornless new lateral branches, stems, and leaves of black goji berry

[0158]

[0159] Data are the mean ± standard deviation of three replicates. Different lowercase letters in the same column indicate significant differences (P < 0.05).

[0160] 1.3.6 Obtaining and identifying LrbZIP44-resistant plants of black wolfberry

[0161] 1.3.6.1 Obtaining LrbZIP44-resistant plants from black wolfberry

[0162] The process of obtaining LrbZIP44-inhibited resistant plants is as follows: Figure 13 As shown, explants from the leaf tips of black wolfberry plants that have been pre-cultured for 4 days ( Figure 13 (A) is used for stable transformation. Leaf tip explants are reverse-inoculated onto the selection medium and cultured, first growing adventitious roots ( Figure 13 (B), then resistant buds ( Figure 13 (C) When the resistant buds grow to 2-3 cm ( Figure 13 (C) Stem segments with terminal buds were cut and inoculated into rooting medium for propagation, ultimately obtaining LrbZIP44-resistant plants (C). Figure 13 (D).

[0163] 1.3.6.2 DNA detection of LrbZIP44-inhibited resistant plants

[0164] Using iDNA-F2 / iLrbZIP44-JR (Table 1) as the primer pair, and DNA from LrbZIP44-inhibited resistant plants of black goji berries as a template, PCR detection was performed. The electrophoresis results are as follows: Figure 14 As shown, the specific bands appearing in lanes 2-10 are highly consistent with the band in lane 11 (pRNAi-LrbZIP44 plasmid), and no bands appear in lane 1 (WT), indicating that the pRNAi-LrbZIP44 vector has been successfully integrated into the genome of the tested black goji berry plants. The experimental numbers of the nine lines that validated the inhibition of expression resistance in this study are 44R-2, 44R-26, 44R-27, 44R-29, 44R-52, 44R-57, 44R-67, 44R-81, and 44R-89.

[0165] 1.3.6.3 Gene expression changes in LrbZIP44-inhibited resistant plants

[0166] The relative expression levels of LrbZIP44 and LrTPP3 genes were analyzed in *Lycium barbarum* WT and the nine DNA-verified lines mentioned above. qRT-PCR results showed that the relative expression level of the LrbZIP44 gene was downregulated by 0.17, 0.10, 0.55, 0.30, 0.31, 0.05, 0.24, 0.41, and 0.58-fold, respectively, in the nine lines (44R-2, 44R-26, 44R-27, 44R-29, 44R-52, 44R-57, 44R-67, 44R-81, and 44R-89) compared to WT, reaching a significant level. Figure 15This demonstrates that nine black wolfberry lines with suppressed LrbZIP44 gene expression were successfully obtained in this study. The relative expression levels of the LrTPP3 gene were downregulated to 0.83, 0.81, 0.84, 0.93, 0.76, 0.43, 0.87, 0.61, and 0.94 times that of the WT, respectively. Although the overall trend was downward, none of the levels reached a significant level. Figure 15 Correlation analysis showed that the correlation between LrbZIP44 and LrTPP3 was P=0.0812>0.05, indicating that the expression of the two genes, LrbZIP44 and LrTPP3, was not significantly correlated, and LrbZIP44 may not be a key transcriptional activator directly involved in regulating LrTPP3 expression.

[0167] 1.3.7 Changes in gene expression in the RNAi-LrbZIP44 line after transplanting

[0168] Three suppressed expression lines (44R-2, 44R-26, and 44R-57) with the largest downregulation of the LrbZIP44 gene were selected for transplantation. To ensure stable downregulation of LrbZIP44 expression in these three RNAi-LrbZIP44 lines after transplantation, the relative expression levels of LrbZIP44 and LrTPP3 genes in the three transplanted RNAi-LrbZIP44 lines and the WT line were analyzed again. qRT-PCR results showed that the relative expression level of the LrbZIP44 gene in the 44R-2, 44R-26, and 44R-57 lines was significantly downregulated to 0.20-fold, 0.05-fold, and 0.06-fold of that in the WT line, respectively. Figure 16 The downward adjustment was roughly the same as that at the tissue culture seedling stage. Figure 16 vs. Figure 15 The relative expression levels of the LrTPP3 gene were downregulated to 0.78-fold, 0.33-fold, and 0.47-fold of WT, but none of these levels were statistically significant. Figure 16 The above results indicate that the three transplanted lines remained typical repressed expression lines, which can be used for subsequent phenotypic analysis and gene function verification. Correlation analysis showed that LrbZIP44 and LrTPP3 had no correlation (P=0.1354>0.05).

[0169] 1.3.8 Suppression of LrbZIP44 gene expression significantly promotes thorn formation.

[0170] Three suppressed expression lines with the largest downregulation of LrbZIP44 gene, 44R-26, 44R-57 and 44R-2, were selected. After transplanting, phenotypic determination and analysis were performed. It was found that the number of new lateral branches per branch in the three RNAi-LrbZIP44 lines was significantly lower than that in WT (Table 13). Figure 17(A, B). Compared with WT, the proportion of newly developed thornless lateral branches decreased and the proportion of newly developed thorny lateral branches increased in the three RNAi-LrbZIP44 lines, and only the 44R-26 and 44R-2 lines reached a significant level (Table 13); Figure 17 (A, B)

[0171] Table 13 Effects of LrbZIP44 inhibition on the number of new lateral branches and the presence or absence of thorns in black goji berry.

[0172]

[0173] Data are the mean ± standard deviation of three replicates. Different lowercase letters in the same column indicate significant differences (P < 0.05).

[0174] It is noteworthy that the thorn emergence rate of the three RNAi-LrbZIP44 lines in the newly developed thorny lateral branches was significantly higher than that of WT (Table 14), and the thorn length and thorn base diameter of the thorny lateral branches were significantly greater than those of WT (Table 14). Figure 17 (D). In addition, no branch thorns were observed to become lateral branches in either the RNAi-LrbZIP44 or WT lines (Table 14). Figure 17 (C, D). The above changes in the branch thorn phenotype in the RNAi-LrbZIP44 line are exactly the opposite of those in the OE-LrbZIP44 line, demonstrating in both directions that the LrbZIP44 gene in black goji berries is a negative regulator of branch thorn occurrence and growth.

[0175] Table 14 Effects of LrbZIP44 inhibition on the phenotypic characteristics of newly emerging lateral branches and thorns of black goji berry

[0176]

[0177] Data are the mean ± standard deviation of three replicates. Different lowercase letters in the same column indicate significant differences (P < 0.05).

[0178] Among the thorny lateral branches, only the leaf lengths of the 44R-2 and 44R-26 lines were significantly smaller than WT (Table 15). Figure 17 In the WT, the leaf length of the 44R-57 line was less than that of the WT but did not reach a significant level (Table 15); the leaf thickness of all three RNAi-LrbZIP44 lines was greater than that of the WT, but only the 44R-26 line reached a significant level (Table 15); compared with the WT, the lateral branches of the three RNAi-LrbZIP44 lines were narrower, longer, and more lignified, but none of them reached a significant level (Table 15). Figure 17 (C, D)

[0179] Table 15 Effects of LrbZIP44 inhibition on the phenotypic characteristics of spiny lateral branches, stems, and leaves of black goji berry.

[0180]

[0181] Data are the mean ± standard deviation of three replicates. Different lowercase letters in the same column indicate significant differences (P < 0.05).

[0182] Among the thornless lateral branches, the leaf length and leaf width of the three RNAi-LrbZIP44 lines were significantly smaller than WT, with the leaf width of the 44R-2 line being significantly smaller than that of the 44R-26 line (Table 16). Figure 17 The lateral branch lengths of the 44R-2 and 44R-57 lines were significantly shorter than those of the 44R-26 and WT lines (Table 16); among the three RNAi-LrbZIP44 lines, only the lignification degree of the 44R-26 and 44R-57 lines was significantly greater than that of the WT line (Table 16); compared with the WT line, the lateral branch width and leaf thickness of the three RNAi-LrbZIP44 lines were slightly smaller, but the differences were not significant (Table 16). Figure 17 (F, G).

[0183] Table 16 Effects of LrbZIP44 inhibition on stem and leaf phenotype of thornless new lateral branches of black goji berry

[0184]

[0185] Data are the mean ± standard deviation of three replicates. Different lowercase letters in the same column indicate significant differences (P < 0.05).

[0186] In summary, this embodiment successfully constructed the LrbZIP44 overexpression vector pRI101-LrbZIP44 and the repressive expression vector pRNAi-LrbZIP44. Three OE-LrbZIP44 overexpression lines and nine RNAi-LrbZIP44 repressive expression lines were successfully obtained through stable transformation. Although the expression of the LrbZIP44 downstream gene LrTPP3 was upregulated in the OE-LrbZIP44 lines and downregulated in the RNAi-LrbZIP44 lines, neither regulation was statistically significant and not significantly correlated with the LrbZIP44 gene expression level. After transplanting, compared with WT, the three LrbZIP44-OE lines showed a significantly increased number of new lateral branches per plant, a significantly lower thorn emergence rate in thorny lateral branches, and smaller thorn length and thorn base diameter. Some even exhibited a phenotype where thorns transformed into lateral branches. After transplanting, the three typical RNAi-LrbZIP44 lines showed a significant decrease in the number of newly developed lateral branches per branch compared to WT, and an increased proportion of thorny lateral branches. The thorn development rate, thorn length, and thorn base diameter of the thorny lateral branches were all significantly greater in LrbZIP44 than in WT. In conclusion, LrbZIP44 significantly promotes the formation of lateral branches in black goji berries, significantly inhibits the occurrence and growth of thorns, and plays a positive regulatory role in the transformation of thorns into lateral branches.

[0187] References

[0188] [1] Cheng Caixia, Zhao Jingzhong, Zhao Yuhong. Effects of low temperature stratification on seed germination of black wolfberry under sodium salt stress [J]. Journal of Central South University of Forestry and Technology, (02): 13-22.

[0189] [2] Du Yu, Liu Yun, Liu Di, et al. 2022. Identification and bioinformatics analysis of GRF transcription factor family in black wolfberry [J]. Acta Grasslandica Sinica, 30(06): 1403-1412.

[0190] [3] Jiang Yingyue. 2025. LrRNaseH response to auxin IAA regulates the development of thorns on branches of black wolfberry [D]. Shenyang Agricultural University.

[0191] [4] Li Xian. 2022. Study on the interaction mechanism between poplar and rhizosphere microorganisms under the infection of Colletotrichum gloeosporioides [D]. Beijing Forestry University.

[0192] [5] Liu Qiang, Yang Tianbo, Liu Jianfeng, et al. Effects of foliar spraying of 6-BA on physiological indicators and photosynthetic characteristics of black wolfberry seedlings from different sources under salt stress in 2024. Journal of Northeast Forestry University, 52(09): 30-35+45.

[0193] [6] Nie Jingyuan. 2022. Preliminary analysis of the function and mechanism of XopG, an effector protein of rice bacterial blight pathogen [D]. Nanjing Agricultural University.

[0194] [7] Shen Yamei, Zheng Bo. 2024. Research progress on the effects of the main active ingredients of black wolfberry on the hematopoietic system [J]. Chinese Journal of Hospital Pharmacy, 44(10): 1235-1240.

[0195] [8] Song Mengru, Chen Keqin, Guo Yunna, et al. Construction of a novel RNAi vector for plant gene silencing [J]. Journal of Shenyang Agricultural University. 48(06): 719-724. 2017.

[0196] [9] Wen Lin, Gu Wenyi, Yang Ji, et al. Functional verification of key differentially expressed genes LrF3'5'H and LrDFR in anthocyanin synthesis in black and white goji berries of black goji berries [J]. Molecular Plant Breeding, 22(22): 1-16.

[0197]

[10] Ai PY, Xue DL, Wang Y, et al. 2023. An efficient improved CRISPRmediated gene function analysis system established in Lycium ruthenicum Murr.[J]. Industrial Crops and Products, 192: 116142.

[0198]

[11] Chen SR, He T, Gu WY, et al. 2025. Transcriptomic analysesreveal light-induced anthocyanin accumulation in Lycium ruthenicum Murray[J].Horticulturae, 11(3): 256.

[0199]

[12] Figueiredo YG, Gasparini K, Bulut M, et al. 2024. The geneticbasis of prickle loss in the Solanaceae[J]. Trends in Plant Science, 30(2):119-121.

[0200]

[13] Iglesias-Fernández R, Barrero-Sicilia C, Carrillo-Barral N, etal. 2013. Arabidopsis thaliana bZIP44: a transcription factor affecting seedgermination and expression of the mannanase-encoding gene AtMAN7[J]. PlantJournal, 74(5): 767-780.

[0201]

[14] Jiang F, Zhu XD, Wu MH, et al. 2025. Domestication has reshapedgene families, gene expressions and flavonoid metabolites in green jujube(Ziziphus mauritiana Lam.) fruit[J]. Horticulturae, 11(8): 974.

[0202]

[15] Ke HF, Zhou YL, Cui JG, et al. 2025. Developmental study ofthorns in tissue culture clone of Lycium ruthenicum[J]. Trees, 39(2): 37.

[0203]

[16] Liu QH, Fang HW, Zhou H, et al. 2025. Identification andcharacterization of bZIP gene family combined transcriptome analysis revealedtheir functional roles on abiotic stress and anthocyanin biosynthesis inmulberry (Morus alba)[J]. Horticulturae, 11(6): 694.

[0204]

[17] Lu L, Zhang YY, Li L, et al. 2021. Physiological andtranscriptomic responses to nitrogen deficiency in Neolamarckia cadamba[J].Frontiers in Plant Science, 12: 747121.

[0205]

[18] Satterlee JW, Alonso D, Gramazio P, et al. 2024. Convergentevolution of plant prickles by repeated gene co-option over deep time[J].Science, 385(6708): eado1663.

[0206]

[19] Sun Y, Zhao JY, Li YT, et al. 2021. Genome-wide analysis of theC2 domain family in soybean and identification of a putative abiotic stressresponse gene GmC2-148[J]. Frontiers in Plant Science, 12: 620544.

[0207]

[20] Sun Y, Zheng H, Wang WW, et al. 2025. Establishment of anefficient and versatile genome editing platform for L. ruthenicum[J]. PlantPhysiology, 199(2): kiaf486.

[0208]

[21] Wang L, Cao HL, Qian WJ, et al. 2017. Identification of a novelbZIP transcription factor in Camellia sinensis as a negative regulator offreezing tolerance in transgenic arabidopsis[J]. Annals of Botany, 119(7):1195-1209.

[0209]

[22] Wildenhain T, Smaczniak C, Marsell A, et al. 2025. A subset ofgroup S1 bZIP transcription factors controls resource management duringstarvation and recovery in Arabidopsis[J]. Plant Cell, 37(7): koaf149.

[0210]

[23] Wu X, Ma Q, Zhang Z, et al. 2025. The transcription factorbZIP44 enhances lead tolerance by activating the expression of PDR12 inArabidopsis[J]. Plant Physiology and Biochemistry, 229(Part C): 110559.

[0211]

[24] Zhang X, Wang J, Li PH, et al. 2023. Integrative metabolome andtranscriptome analyses reveals the black fruit coloring mechanism ofCrataegus maximowiczii C. K. schneid[J]. Plant Physiology and Biochemistry,194: 111-121.

[0212]

[25] Zhou YL, Jiang YY, Chen WX, et al. 2026. Mechanism of specificinhibition of thorn formation by salicylic acid in Lycium ruthenicum[J].Journal of Plant Growth Regulation, 45(2): 1086-1099.

[0213] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of LrbZIP44 gene in promoting lateral branch and inhibiting spine of Lycium ruthenicum Murr.

2. Use according to claim 1, characterized in that, The nucleotide sequence of the LrbZIP44 gene is shown as SEQ ID No.

1.

3. Use according to claim 1, characterized in that, Overexpression of LrbZIP44 gene promotes lateral branch and inhibits spine of Lycium ruthenicum Murr.

4. Use according to claim 3, characterized in that, Overexpression of LrbZIP44 gene inhibits spine of Lycium ruthenicum Murr and converts spine into lateral branch.

Images