Application of FNR1 in genetic engineering of heat-tolerant and stable-yield rice germplasm

Abstract

This invention relates to the field of bioengineering and discloses the application of FNR1 in the creation of heat-resistant and stable-yielding rice germplasm through genetic engineering. This invention screens Fd1 interacting proteins using yeast Y2H experiments and verifies FNRs interacting with Fd1 using BiFC, GST-Pull down, and luciferase complementation experiments, confirming that FNR1 is the downstream electron acceptor of Fd1 in linear electron transport. Based on this, this invention further discovers for the first time through experiments that overexpression of FNR1 in rice can effectively improve the high-temperature tolerance of rice, enabling stable yield under high-temperature stress, which is of great significance for breeding new heat-resistant rice varieties.

Description

Technical Field

[0001] This invention relates to the field of bioengineering, and more particularly to the application of FNR1 in the creation of heat-resistant and stable-yielding rice germplasm through genetic engineering. Background Technology

[0002] Global warming is becoming increasingly severe, impacting Earth's ecosystems and human lives, with a particularly serious effect on food security. Climate warming affects the yield and quality of food crops; it is predicted that for every 1°C increase in global temperature, food production will decrease by 9%-10%. Plants rely on photosynthesis for material conversion and energy metabolism, and high-temperature stress has a significant impact on photosynthesis. High-temperature stress can cause a series of damages to the plant's photosynthetic system, such as damaging the thylakoid membrane, the light-harvesting antenna system of the photosynthetic system, the oxygen-releasing complex on the donor side, and reaction centers, and affecting the efficiency of electron transport on the acceptor side. High-temperature stress also causes the accumulation of reactive oxygen species in chloroplasts, resulting in oxidative stress, which affects the photosynthetic efficiency of plants by influencing the activity of enzymes involved in photosynthetic reactions such as Rubisco.

[0003] Our previous patent CN111100867A, "Rice Ferroreductin Encoding Gene OsFd1, Protein Encoded by This Gene and Its Uses," disclosed that Fd1, as the most important leaf-type Fd protein in rice, is crucial for rice photosynthesis. Building on this, our team further discovered that overexpression of the rice ferrooxidase protein OsFd1 can increase the photosynthetic capacity, carbon assimilation efficiency, growth, and yield of rice under high-temperature stress (not yet published). Fd1, as a major photosynthetic electron transport protein, can receive electrons from photosystem I and transfer them to downstream electron acceptors such as FNR. FNR, as the terminal acceptor in the linear electron transport chain, can transfer electrons to NADP. + The reducing power generated is used for carbon fixation. However, rice has two leaf types of FNR, and it is unclear which one is the direct electron acceptor of Fd1. Furthermore, since increasing Fd1 expression can improve the heat tolerance and yield stability of rice, it is still unknown whether increasing other electron transporters in the photosynthetic electron transport chain can achieve the same purpose. Therefore, in-depth research on this topic may bring potential practical application value. Summary of the Invention

[0004] This invention provides the application of FNR1 in the creation of heat-resistant and stable-yielding rice germplasm through genetic engineering. This invention discovers that overexpression of rice FNR1 can effectively enhance the high-temperature tolerance of rice, enabling it to maintain stable yields under high-temperature stress, which is of great significance for breeding new heat-resistant rice varieties.

[0005] The specific technical solution of the present invention includes: In a first aspect, this invention provides the application of the FNR1 gene in improving photosynthetic stability or heat tolerance in rice: by overexpressing rice leaf-type ferrugin-NADP. + The redox enzyme FNR1 enhances the photosynthetic stability or heat resistance of rice.

[0006] First, this invention screened Fd1 interacting proteins using yeast Y2H experiments and verified FNRs proteins interacting with Fd1 using BiFC, GST-Pulldown, and luciferase complementation experiments, confirming that FNR1 is the downstream electron acceptor of Fd1 in linear electron transport. Based on this, this invention further discovered for the first time through experiments that overexpression of FNR1 in rice can effectively improve rice's high-temperature tolerance, specifically manifested in improved photosynthetic efficiency, carbon assimilation efficiency, growth status, and rice yield under high-temperature stress.

[0007] The growth status includes plant height, number of tillers, fresh weight and dry weight of above-ground parts, etc.; the rice yield includes seed setting rate, thousand-grain weight, yield per plant and rice pollen fertility, etc.

[0008] This invention, through experiments, found that FNR1-overexpressing rice lines did not show significant advantages over wild-type rice under normal field conditions, but exhibited significant advantages under high-temperature stress. For example, they were significantly superior to wild-type rice in terms of plant height, number of tillers, seed setting rate, aboveground fresh weight, dry weight, thousand-grain weight, yield per plant, and pollen fertility at both tillering and maturity stages.

[0009] Furthermore, the overexpression of rice leaf-type ferroredoxin-NADP+ oxidoreductase FNR1 is achieved through transgenic methods or gene editing methods, etc.

[0010] Furthermore, the transgenic method involves constructing an FNR1 overexpression vector and transferring it into rice, thereby achieving overexpression of FNR1 in rice; further, the transgenic method specifically includes: amplifying the FNR1 gene CDS sequence (SEQ ID NO: 2) from rice cDNA by PCR to construct an FNR1 overexpression vector; and using Agrobacterium-mediated transformation to genetically transform the FNR1 overexpression vector into a certain rice variety to obtain FNR1-highly expressed rice.

[0011] Preferably, the rice varieties include the wild-type rice variety Nipponbare, the cultivated variety Xiushui 134, or Huazhan.

[0012] Furthermore, the gene editing method utilizes multiple editing pathways such as CRISPR-Cas9, SF01, and SF02 to edit various functional elements that regulate FNR1 expression, thereby increasing the expression level of FNR1 in rice; more preferably, the gene editing method specifically includes: editing the promoter sequence of the rice FNR1 gene (sites 1-2208 in SEQ ID NO: 1) using gene editing technology to obtain rice with high FNR1 expression.

[0013] Secondly, this invention provides the application of the FNR1 gene in creating new rice germplasm with heat-resistant and stable-yielding characteristics through genetic engineering.

[0014] Furthermore, the heat-resistant and stable-yield characteristics are manifested in the improved photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high-temperature stress.

[0015] Thirdly, this invention provides an overexpression method for rice leaf-type feroxin-NADP. + A recombinant plasmid containing the FNR1 oxidoreductase gene, which contains nucleotide fragments of FNR1.

[0016] Preferably, the recombinant plasmid is pCAMBIA1300-FNR1-GFP-flag recombinant plasmid, which contains a nucleotide fragment of FNR1.

[0017] Fourthly, the present invention provides the application of the above-mentioned recombinant plasmid in the creation of new rice germplasm with heat-resistant and stable yield characteristics.

[0018] Fifthly, the present invention provides a method for improving the photosynthetic stability or heat resistance of rice: by overexpressing rice leaf-type ferrugin-NADP. + The redox enzyme FNR1 can improve the photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high temperature stress.

[0019] Compared with the prior art, the beneficial effects of the present invention are: (1) The present invention screened Fd1 interacting proteins through yeast Y2H experiment and verified FNRs proteins that interact with Fd1 through BiFC, GST-Pull down and luciferase complementation experiments, thus confirming that FNR1 is the downstream electron acceptor of Fd1 in linear electron transfer.

[0020] (2) The present invention further discovered for the first time through experiments that overexpression of FNR1 in rice can effectively improve the high temperature tolerance of rice, and can maintain stable yield of rice under high temperature stress, which is of great significance for breeding new rice varieties resistant to high temperature. Attached Figure Description

[0021] Figure 1 A schematic diagram of the interaction between Fd1 and FNR1 is shown; where: (a) the interaction between Fd1 and FNR1 was detected by yeast two-hybrid assay, and no direct interaction occurred between Fd1 and FNR2 proteins; co-transformation of pGADT7 and pGBK7 empty vectors (AD / BD) was used as a negative control; different combination proteins were transformed into yeast cells and inoculated onto selective media (SD); SD: synthetic complete agar medium; SD / -Leu / -Trp: SD two-deficient (Leu and Trp) medium; SD / -Leu / -Trp / -His / -Ade: SD four-deficient (Leu, Trp, His, and Ade) medium; (b) the interaction analysis between Fd1 and FNR1 was verified by pull-down assay; FNR1-MBP, a recombinant FNR1 protein with an MBP tag. White; Fd1-GST, a recombinant Fd1 protein tagged with GST; (c) Luciferase complementation analysis of Fd1 and FNR1 in tobacco epidermal cells; nLuc and cLuc represent the N-terminus and C-terminus of Luc, respectively; Fd1-nLuc / cLuc represents the fusion of Fd1-nLuc and cLuc; nLuc / FNR1-cLuc represents the fusion of FNR1-cLuc and nLuc; Fd1-nLuc / FNR1-cLuc represents the fusion of the C-terminus of FNR1-cLuc with the N-terminus of Fd1-nLuc; (d) Detection of bimolecular fluorescence complementation (BiFC) of Fd1 and FNR1 in protoplasts; Fd1-nYFP, fusion of Fd1 and nYFP; FNR1-cYFP, fusion of FNR1 and cYFP. Scale bar is 100 μm.

[0022] Figure 2 A schematic diagram of FNR1 homology analysis and the creation of FNR1-OE lines is shown below; (a) a phylogenetic tree was constructed using the neighbor-joining (NJ) method of MEGA7, and the amino acid sequences of FNRs in Arabidopsis and rice were downloaded from the National Rice Data Center database (https: / / www.ricedata.cn / gene / ) and the TAIR database (https: / / www.arabidopsis.org / ); (b) a schematic diagram of the vector expressing the FNR1 gene in rice; FNR1 cDNA fused with the GFP-flg tag; (c) RT-PCR detection of FNR1 in FNR1-OE lines. NIP Expression in homozygous transgenic lines. Data are presented as mean ± standard deviation (n = 3).

[0023] Figure 3 Phenotypes of FNR1-OE under normal conditions; among which: (a) NIP and FNR1-OE planted in Lingshui (LS) in 2023. NIP(a) Plant height of homozygous transgenic lines at maturity; (b) Number of tillers at maturity; (c, d) Statistical analysis of seed setting rate and yield per plant; Data are expressed as mean ± standard deviation (a, b, n=10; c, n=20; d, n=10); One-way ANOVA was used, with letters a and b indicating significant differences; P < 0.05.

[0024] Figure 4 Phenotypes of FNR1-OE under high temperature stress; where: (a) NIP and FNR1-OE under NIP background. NIP (a) Whole-plant phenotype of homozygous transgenic lines at tillering and maturity stages; (b) NIP and FNR1-OE NIP (c) Plant height statistics of homozygous transgenic lines at tillering and maturity stages, data are mean ± standard deviation (n=10); (d) Tiller number statistics at tillering and maturity stages, data are mean ± standard deviation (n=10); (e) Field temperature statistics in Chongqing during the 2023 growing season; (f) NIP and FNR1-OE NIP Statistical analysis of the aboveground fresh weight and aboveground dry weight of homozygous transgenic lines, with data presented as mean ± standard deviation (n=10); (f) NIP and FNR1-OE NIP Statistical analysis of seed setting rate of homozygous transgenic lines, data are mean ± standard deviation (n=20); (g, h) NIP and FNR1-OE NIP Yield of homozygous transgenic lines per plant was displayed and statistically analyzed. Data are presented as mean ± standard deviation (n=10). All plants were grown in paddy fields. One-way ANOVA was used, with a, b, and c indicating significant differences; P < 0.05. Scale bar: 10 cm (a); 5 cm (g).

[0025] Figure 5 Photosynthetic capacity of FNR1-OE plants was measured: where (a, b) NIP and FNR1-OE NIP Electron transport rates ETR I and ETR II of PSI and PSII in homozygous transgenic lines; (c, d) Photochemical quantum yields YI and YII of PSI and PSII; (e) Maximum quantum yield of PSII (Fv / Fm); (f) Maximum oxidation level of PSI (Pm); (g) Non-photochemical quenching coefficient (NPQ); (h) At 400 μmol mol -1 CO2 concentration, 1500 μmol / m -2 .s -1 Variation in net photosynthetic rate under light intensity; numerical values ​​represent mean ± standard deviation (n=3); one-way ANOVA was used, and letters a, b, c, and d indicate significant differences, P < 0.05.

[0026] Figure 6Phenotype of FNR1-OE plant in cultivated varieties: Among them: (a) FNR1-OE under the background of Xiushui 134 XS Phenotype of mature plants from homozygous transgenic lines; (b) 400 μmol -1 CO2 and 1500 μmol m -2 .s -1 Net photosynthetic rate under light intensity (n=3); (c) FNR1-OE XS (d) Yield statistics of homozygous transgenic lines per plant (n=10); FNR1-OE under Chinese colony background HuaZ Mature phenotype of homozygous transgenic lines; (e) 400 μmol -1 CO2 and 1500 μmol m -2 .s -1 Net photosynthetic rate under light intensity (n=3); (f) FNR1-OE HuaZ Yield analysis of homozygous transgenic lines per plant (n=10); all data are expressed as mean ± standard deviation; one-way ANOVA was used, and significant differences between labeled groups were defined as P < 0.05; scale bar is 10 cm.

[0027] Figure 7 Detection of carbon assimilation products in FNR1-OE plants: (a) NIP and FNR1-OE under natural high temperature stress in the field NIP Transmission electron microscopy images of chloroplast structure in homozygous transgenic lines; (b) Statistical analysis of starch grains in each chloroplast; (c) Temperature settings for high-temperature treatment of rice during the booting stage; (d) Detection of glucose, fructose, and sucrose content under normal and high-temperature treatments; FHT: natural high-temperature stress in the field; AHT: simulated high temperature in an artificial climate chamber; ACK: simulated normal conditions in an artificial climate chamber; (e) Detection of starch content under normal and high-temperature treatments; Data are mean ± standard deviation (b, n=30; d, e, n=3); One-way ANOVA was used, and the letters a, b, c, d, e, f, and g indicate significant differences, P < 0.05.

[0028] Figure 8 Pollen fertility testing of FNR1-OE homozygous transgenic plants: (a) NIP and FNR1-OE under normal temperature and high temperature stress. NIP (a) K2-KI staining of pollen grains from homozygous transgenic lines; (b) Statistical analysis of pollen grain fertility; data are mean ± standard deviation (n=30); FHT: natural high temperature stress in the field; AHT: simulated high temperature in an artificial climate chamber; ACK: simulated normal conditions in an artificial climate chamber; one-way ANOVA was used, and the letters a, b, c, d and e indicate significant differences, P < 0.05; scale bar is 100 μm (a). Detailed Implementation

[0029] The present invention will be further described below with reference to embodiments.

[0030] General Implementation Examples In a first aspect, this invention provides the application of the FNR1 gene in improving photosynthetic stability or heat tolerance in rice: by overexpressing rice leaf-type ferrugin-NADP. + The redox enzyme FNR1 enhances the photosynthetic stability or heat resistance of rice.

[0031] Furthermore, the photosynthetic stability or heat resistance of rice includes the photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high temperature stress.

[0032] The growth status includes plant height, number of tillers, fresh weight and dry weight of above-ground parts, etc.; the rice yield includes seed setting rate, thousand-grain weight, yield per plant and rice pollen fertility, etc.

[0033] Furthermore, the overexpression of rice leaf-type ferroredoxin-NADP+ oxidoreductase FNR1 is carried out through transgenic methods or gene editing methods (including the use of various editing pathways such as CRISPR-Cas9, SF01, and SF02).

[0034] Furthermore, the transgenic method involves constructing an FNR1 overexpression vector and transferring it into rice, thereby achieving overexpression of FNR1 in rice; further, the transgenic method specifically includes: amplifying the FNR1 gene CDS sequence (SEQ ID NO: 2) from rice cDNA by PCR to construct an FNR1 overexpression vector; and using Agrobacterium-mediated transformation to genetically transform the FNR1 overexpression vector into a certain rice variety to obtain FNR1-highly expressed rice.

[0035] Preferably, the rice varieties include the wild-type rice variety Nipponbare, the cultivated variety Xiushui 134, or Huazhan.

[0036] Furthermore, the gene editing method includes using multiple editing pathways such as CRISPR-Cas9, SF01, and SF02 to edit multiple functional elements that regulate FNR1 expression, thereby increasing the expression level of FNR1 in rice; and more preferably, the gene editing method specifically includes: editing the promoter sequence of the rice FNR1 gene (sites 1-2208 in SEQ ID NO: 1) using gene editing technology to obtain rice with high FNR1 expression.

[0037] Secondly, this invention provides the application of the FNR1 gene in creating new rice germplasm with heat-resistant and stable-yielding characteristics through genetic engineering.

[0038] Furthermore, the heat-resistant and stable-yield characteristics are manifested in the improved photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high-temperature stress.

[0039] Thirdly, this invention provides an overexpression method for rice leaf-type feroxin-NADP. + A recombinant plasmid containing the FNR1 oxidoreductase gene, which contains nucleotide fragments of FNR1.

[0040] Preferably, the recombinant plasmid is pCAMBIA1300-FNR1-GFP-flag recombinant plasmid, which contains a nucleotide fragment of FNR1.

[0041] Fourthly, the present invention provides the application of the above-mentioned recombinant plasmid in the creation of new rice germplasm with heat-resistant and stable yield characteristics.

[0042] Fifthly, the present invention provides a method for improving the photosynthetic stability or heat resistance of rice: by overexpressing rice leaf-type ferrugin-NADP. + The redox enzyme FNR1 can improve the photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high temperature stress. Specific Implementation This invention verified the interaction between FNR1 and Fd1 through Y2H, pull-down, BiFC, and luciferase complementation (Luc) experiments. The results showed that FNR1 is a downstream electron acceptor of Fd1, while FNR2, encoded by another FNR homolog in rice, does not directly interact with Fd1. FNR1 overexpression vectors were constructed and transformed into rice. The photosynthetic rate and parameters of the FNR1-overexpressing rice were measured using a Li-6800 and Dual PAM 100. The results showed that under high-temperature stress, FNR1-overexpressing plants had higher photosynthetic capacity, with better photosynthetic rate and chloroplast fluorescence parameters than the wild type. Agronomical trait studies showed that under high-temperature field conditions, the plant height, tiller number, biomass, and yield per plant of the FNR1-overexpressing lines were significantly higher than those of the wild type. To further verify the application of FNR1 in heat tolerance breeding, this invention used artificial climate chambers to study the FNR1-OE plants during the tillering peak stage. NIP Homozygous transgenic lines and wild-type lines were subjected to high-temperature treatment, and the carbon assimilation products and pollen fertility under high-temperature treatment and normal temperature were detected and statistically analyzed. The gDNA nucleotide sequence of FNR1 is shown in SEQ ID NO:1; the cDNA nucleotide sequence of FNR1 is shown in SEQ ID NO:2; and the amino acid sequence of the FNR1 protein is shown in SEQ ID NO:3.

[0044] Example 1: Interaction verification between FNR1 and Fd1 (1) Screening of Fd1 interacting proteins by yeast Y2H assay: Fd1-pGBKT7 and FNR1-pGADT7 plasmids were co-transfected into AH109 cells. They were then plated on two- and four-cell-deficient plates. pGBKT7-p53+pGADT7-Larget and pGBKT7-laminc+pGADT7-Larget were used as positive and negative controls, respectively.

[0045] (2) GST-Pull-down verification: The CDS sequence of Fd1 was cloned into the pGEX-4T-1 vector, and the CDS sequence of FNR1 was cloned into the pmal-c5x (MBP) vector. IPTG was used to induce the expression of Fd1-GST and FNR1-MBP recombinant proteins in *E. coli* BL21 (DE3) strain at 28°C. FNR1-MBP and Fd1-pGEX-4T-GST proteins were purified in vitro. Glutathione beads containing Fd1-GST or GST protein were mixed with FNR1-MBP and incubated in buffer at 4°C for 4 hours. The beads were washed with buffer, and then the protein was eluted with GST elution buffer. The mixture was boiled and detected by Western blot (WB) with GST and MBP antibodies.

[0046] (3) Luciferase complementation experiment to verify the interaction between FNR1 and Fd1: Luciferase was divided into two functional fragments, N-terminus and C-terminus, and the CDS sequences of FNR1 and Fd1 were respectively inserted. The constructed vector was transformed into tobacco by Agrobacterium, and the activity of luciferase was detected using luciferin as a substrate.

[0047] (4) Validation via BiFC: The CDS sequence of Fd1 was cloned into the pSAT4A-nEYFP vector, and the CDS sequence of FNR1 was cloned into the pSAT4A-cEYFP vector. GV3101 co-transformed with Fd1-nYFP and FNR1-cYFP was then transformed into rice protoplasts. Subsequently, the fluorescence signal was observed under excitation light at a wavelength of 514 nm using a laser confocal microscope. (5) The amino acid sequences homologous to FNR1 in rice and Arabidopsis were obtained from the National Rice Data Center database (https: / / www.ricedata.cn / gene / ) and the TAIR database (https: / / www.arabidopsis.org / ), respectively. A phylogenetic tree was constructed using the amino acid sequences of AtFNRs and OsFNRs. Figure 2 a). In the phylogenetic tree, it was found that FNR1 belongs to the leaf type FNR (LFNR), and there are two leaf types FNR in rice: LFNR1 and LFNR2.

[0048] (6) Results: OsFd1 interacts directly with OsFNR1, but does not interact directly with OsFNR2. Figure 1 OsFNR1 plays a major role in linear electron transport.

[0049] Example 2: Creation of FNR1 gene overexpression materials Creation of FNR1 gene overexpression materials: FNR1 overexpression vectors were constructed and transformed into the japonica rice variety Nipponbare, the cultivar Japonica rice Xiushui 134, and the indica rice restorer line Huazhan.

[0050] (I) Construction of FNR1 overexpression vector (1) Cloning of the FNR1 gene fragment Primer pairs were designed based on the coding sequence of FNR1 for overexpression vector construction. Kpn I restriction sites were introduced at the primer ends based on the multiple cloning site on the pCAMBIA1300-GFP-flag plasmid. PCR was performed using cDNA from the rice cultivar Nipponbare (NIP) as a template to amplify a 1131 bp FNR1 gene fragment (SEQ ID NO: 2). The primer sequences are as follows: Forward primer: ttctgcaggagctcggtaccATGGCCGCCGTGAACACA; Reverse primer: tcgctcatggatccggtacc AGCCAGTCGATGCCTACATA; The amplification program was as follows: 95℃ for 5 min; 95℃ for 30 sec, 56℃ for 30 sec, 68℃ for 2 min, 30 cycles; 72℃ for 70 sec; The PCR amplification products were subjected to 1% agarose gel electrophoresis, and the band of about 1168 bp was recovered and purified using the Spide gel recovery kit.

[0051] (2) Construction of recombinant expression vector The pCAMBIA1300-GFP-flag plasmid was digested with Kpn I to obtain the linear pCAMBIA1300-GFP-flag vector; the FNR1 CDS sequence was ligated into the pCAMBIA1300-GFP-flag vector via homologous recombination; the ligation product was heat-shocked and transformed into Escherichia coli DH5α strain, cultured overnight at 37°C, and positive clones were picked for sequencing; the recombinant plasmid pCAMBIA1300-FNR1-GFP-flag was obtained. Figure 2 b).

[0052] (II) Stable transformation of rice mediated by Agrobacterium EHA105 (1) Transformation of Agrobacterium: Agrobacterium was transformed using the electroporation method. The specific operation was as follows: Take out 50 μL of frozen competent cells, thaw them, add 2 μL of the above recombinant plasmid, and gently tap the tube wall to mix. Transform them in an electroporator, then transfer the electroporated competent cells into 1.5 mL EP tubes, add 600 μL of LB (antibiotic-free) liquid medium, and shake at 28°C at low speed (150 r / min) for 5 h. Centrifuge at 4000 r / min for 30 sec, discard the supernatant, add 100 μL of LB liquid medium, suspend the cells, and plate them (containing 50 mg / mL kanamycin). Incubate at 28°C until single colonies grow, and obtain the EHA105 strain containing the binary plasmid vector.

[0053] (2) Rice transformation mediated by Agrobacterium EHA105 Mature wild-type Nipponbare seeds were selected, shelled, and disinfected with 70% alcohol and 30% sodium hypochlorite solution. After drying in a clean bench, they were cultured on induction medium for 3 weeks. Vigorously growing callus tissue was selected as the recipient for transformation. Rice callus was infected with the EHA105 strain containing a binary plasmid vector and co-cultured at 25°C in the dark for 3 days. Then, it was cultured on selection medium containing 300 mg / L hygromycin. Resistant callus was screened and cultured on pre-differentiation medium containing 250 mg / L hygromycin for 10 days. The pre-differentiated callus was transferred to differentiation medium and cultured under light. Resistant transgenic plants were obtained after one month. The plants were identified by PCR, and FNR1-OE was obtained. NIP Homozygous transgenic plants.

[0054] (III) Detection of FNR1 gene expression level (1) Material acquisition: The material used in the experiment was FNR1-OE. NIP Homozygous transgenic plants were grown in the field.

[0055] (2) mRNA isolation: Rice tissue was ground into powder in liquid nitrogen, and total RNA was extracted from rice leaves using the Miniprep Total RNA Kit (Axygene, China) according to the kit's operating steps for RT-qPCR.

[0056] (3) Reverse transcription to cDNA: The extracted mRNA was reverse transcribed into cDNA using the TaKaRa reverse transcription kit.

[0057] (4) Real-time quantitative PCR analysis: The SuperReal PreMix Plus (SYBR Green) kit from TIANGEN was used. The specific experimental method is as follows: 0.2 μL of the cDNA template obtained in the previous step, 0.2 μL each of the forward and reverse primers, 5 μL of 2x SuperReal PreMix Plus, and 4.4 μL of ddH2O were added to a 10 μL system; the amplification program was: 95℃, 15 min; 95℃, 10 sec; 60℃, 34 sec, 40 cycles; 65℃, 5 sec, 95℃, 5 sec; where: The forward primer is: AGCTCCTGAAGAAGGACCAC; The reverse primer is: ACTTCCACGTTCCATTGCTC.

[0058] (5) Results: FNR1-OE NIP FNR1 expression was upregulated in homozygous transgenic plants. Figure 2 c).

[0059] The results obtained by the above-mentioned transgenic technology show that the present invention has obtained transgenic rice with FNR1 overexpression.

[0060] (iv) Creating FNR1 high-expression materials through gene editing of regulatory regions This invention utilizes various editing pathways, such as CRISPR-Cas9, SF01, and SF02, to edit the FNR1 promoter sequence, obtaining FNR1 expression-upregulated lines. Specifically, this invention designs target sites in the FNR1 promoter sequence using CRISPR-Cas9, SF01, and SF02 systems, constructs gene editing vectors, and obtains transformed seedlings through Agrobacterium-mediated genetic transformation of rice. The gene editing efficiencies reached 95.65%, 79.17%, and 16.67%, respectively.

[0061] Example 3: Agronomic trait analysis of FNR1 overexpressing transgenic rice (1) Phenotypic observation and statistics during the growth period: FNR1-OE NIP Statistical observations were conducted on traits such as plant height and tiller number during the growth period of homozygous transgenic lines.

[0062] (2) Observation and statistics of mature phenotypes: For FNR1-OE NIP The traits of homozygous transgenic lines at maturity, such as plant height, number of tillers, aboveground biomass, and yield, were statistically observed.

[0063] (3) Results: FNR1-OE planted in Lingshui (LS) NIPCompared with WT, homozygous transgenic lines still showed advantages in mature plant height, tiller number, seed setting rate, and yield per plant, but the differences were not significant under high temperature stress. Figure 3 High temperature stress on FNR1-OE NIP Statistical analysis of the field phenotypes of homozygous transgenic lines showed that FNR1-OE NIP The homozygous transgenic lines showed a significant growth advantage over WT and compared with Fd1-OE. NIP Homozygous transgenic lines showed similar phenotypes under high-temperature stress. Under high-temperature field conditions in Chongqing in 2023 (… Figure 4 d) During the tillering and maturity stages, FNR1-OE NIP plant height of homozygous transgenic lines ( Figure 4 a, b), number of tillers ( Figure 4 Statistical analysis was performed on a and c), and the results showed that FNR1-OE NIP The homozygous transgenic lines showed significant superiority over WT. Statistical analysis of the fresh and dry weights of the aboveground parts showed that FNR1-OE... NIP The growth of homozygous transgenic lines was significantly higher than that of wild-type lines. Figure 4 e). For FNR1-OE NIP Statistical analysis of the seed setting rate of homozygous transgenic lines revealed three FNR1-OE lines. NIP The seed setting rate of homozygous transgenic lines increased by 16%, 11%, and 11% respectively relative to WT. Figure 4 f). For FNR1-OE NIP Statistical analysis of the yield of single plants in homozygous transgenic lines revealed that FNR1-OE... NIP On average, homozygous transgenic lines increased yield by about 17%. Figure 4 g, h).

[0064] Example 4: Detection of photosynthetic capacity in FNR1-overexpressing transgenic rice To test FNR1-OE NIP The photosynthetic capacity of homozygous transgenic lines, FNR1-OE, under natural high-temperature stress in the field during the tillering stage. NIP The photosynthetic rate and chlorophyll fluorescence parameters of the homozygous transgenic lines and WT were detected, and the results showed that FNR1-OE NIP Homozygous transgenic lines showed better photosynthetic capacity compared to WT. FNR1-OE NIP The homozygous transgenic lines PSI and PSII showed significant advantages in electron transport rates ETR I and ETR II, and photochemical quantum yields YI and YII. Figure 5 a, b, c, d). The maximum quantum yield of PSII, Fv / Fm, and the maximum redox level of PSI, P700, were significantly higher than those of the wild type. Figure 5 e, f). The non-photochemical quenching coefficient is significantly smaller than WT ( Figure 5 g), while the net photosynthetic rate under saturated light intensity increases by about 20% relative to WT, indicating that FNR1-OE NIP The enhanced photosynthetic capacity of homozygous transgenic lines improved the photosynthetic capacity of rice under high temperatures, thereby increasing the heat resistance and yield stability of rice.

[0065] Example 5: Overexpression of FNR1 in the main cultivated varieties Huazhan and Xiushui 134 improves their heat resistance and yield stability. Rice glutamate (NIP) receptors, as classic rice genetic research receptors, are widely used in rice functional genomics studies. However, due to background differences, some receptors that exhibit excellent phenotypes in NIP may not perform well in other backgrounds. To verify whether FNR1 overexpression has functional universality in different materials and expand its application prospects, this application constructed FNR1 overexpression lines in the main cultivated varieties Huazhan and Xiushui 134. In 2024, under natural high-temperature field conditions in Hangzhou (HZ), the agronomic traits and photosynthetic rates of multiple independent lines were detected. FNR1-OE was measured under the Huazhan background. NIP The net photosynthetic rate of homozygous transgenic lines increased by 20% relative to WT and by 21% under the Xiushui 134 background. Figure 6 b, e). Statistical analysis of individual plant yields showed that FNR1-OE under the Xiushui 134 background was... XS On average, homozygous transgenic lines increased yield by about 20%. Figure 6 a, c). FNR1-OE under the Chinese occupation background HuaZ Homozygous transgenic lines can increase yield by about 10% ( Figure 6 (d, f). The above experimental results show that increasing the expression level of FNR1 can also improve the heat resistance of the main cultivated varieties, providing a new approach for the creation of heat-resistant and stable rice varieties.

[0066] Example 6: Detection of carbon assimilation products in FNR1 overexpression transgenic rice To determine the effect of the FNR1 gene on carbon assimilation products under high-temperature stress, we transferred rice in its tillering stage into an artificial climate chamber to simulate field high-temperature treatment. The climate chamber treatment temperature was as follows: Figure 7 As shown in c, leaf tissue samples of flag leaves of rice during the booting stage were collected under natural high temperature in the field, simulated high temperature in the climate chamber, and normal temperature for the detection of soluble sugars (glucose, fructose, sucrose) and starch content.

[0067] (1) Detection of soluble sugar content: To detect the soluble sugar content, leaf tissue samples of flag leaves from rice at the booting stage were collected and frozen in liquid nitrogen. Then, 0.1 g of plant sample was homogenized by adding 1 mL of 80% (v / v) ethanol solution to a 2 mL Eppendorf tube. The sample was sonicated in a water bath for 30 minutes and centrifuged at 12,000 g for 10 minutes at room temperature to remove insoluble residues. The sample was purified through a Millipore 0.22 μm filter. The sugar content in the filtrate was measured using an Angilent 1200 high-performance liquid chromatography system (Angilent Technologies). The concentrations of various soluble sugars were analyzed using a standard curve.

[0068] (2) Starch content detection: Starch content was determined using a starch content assay kit (Grace, Suzhou, China) and analyzed using an ELISA reader (Tecan Infinite M200, Mannedorf, Switzerland) with a wavelength of 510 nm.

[0069] (3) Preparation and observation of chloroplasts for transmission electron microscopy: Take FNR1-OE NIP The flag leaf of the homozygous transgenic line and the wild-type spike-in stage were cut into small pieces; the cut sample pieces were placed in 2 mL centrifuge tubes, 2.5% glutaraldehyde solution (pH 7.2) was added, and vacuum was applied in a vacuum instrument until the leaves completely sank. Rinse three times with 0.1 M phosphoric acid every 15 minutes, then fix with 1% osmium tetroxide for 3 hours until the sample turns black. Dehydrate the sample sequentially with 50%, 70%, and 90% ethanol solutions, treating for 20 minutes at each concentration. Then treat with a 1:1 ethanol and acetone solution for 20 minutes, all at 4°C. Finally, treat the sample with pure acetone at room temperature for 20 minutes. Incubate the sample in a 3:1 mixture of anhydrous acetone and embedding agent for 4 hours, then in a 1:1 mixture of anhydrous acetone and embedding agent for 3 hours, and finally in pure embedding agent for 12 hours. Place the sample in an embedding cassette and incubate overnight at 37°C, then for 12 hours at 45°C, and finally for 24 hours at 60°C to obtain the embedded sample. Cut the embedded sample into 60-70 mm pieces using an ultramicrotome. Ultrathin sections of approximately nm were prepared, stained with lead citrate solution for 10 minutes, then stained with uranium acetate solution for 30 minutes, washed three times with double-distilled water, and air-dried. The sections were then observed using a Hitachi H-7650 transmission electron microscope, and photographed at a clear magnification.

[0070] (4) Results: FNR1-OE NIP Homozygous transgenic lines have a higher soluble sugar content compared to wild-type lines ( Figure 7 d) and starch ( Figure 7The accumulation of carbon assimilation products (a, b, e) increases, especially under high temperature stress. In stark contrast, the photosynthetic capacity of WT is inhibited and the accumulation of carbon assimilation products decreases under high temperature stress, while the overexpression lines remain at stable levels.

[0071] Example 7: FNR1 overexpression transgenic rice pollen fertility analysis (1) K2-KI detection of pollen: In order to determine the effect of FNR1 gene on rice pollen fertility under high temperature stress, we transferred rice in the tillering stage into an artificial climate chamber to simulate field high temperature treatment, stained the anthers with K2-KI, and counted the percentage of fertile anthers.

[0072] (2) Results: FNR1-OE NIP The pollen fertility of homozygous transgenic lines remained stable under high temperature stress. Figure 8 a, b). High field temperatures and high temperature treatment in artificial climate chambers, FNR1-OE NIP Homozygous transgenic lines consistently exhibited superior pollen fertility. Pollen fertility is inextricably linked to the accumulation and distribution of carbon assimilation products, FNR1-OE NIP The photosynthetic capacity and carbon assimilation product accumulation of homozygous transgenic lines are more likely to be FNR1-OE. NIP The reason why homozygous transgenic lines have an advantage in maintaining pollen fertility.

Claims

1. Application of FNR1 in improving photosynthetic stability or heat tolerance of rice, characterized in that: Increasing photosynthetic stability or heat tolerance in rice by overexpressing leaf-type ferredoxin-NADP + oxidoreductase FNR1.

2. Use according to claim 1, characterized in that: The photosynthetic stability or heat resistance of rice includes the photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high temperature stress.

3. The application as described in claim 2, characterized in that: The growth status includes at least one of plant height, number of tillers, fresh weight of above-ground parts, and dry weight; The rice yield includes at least one of the following: seed setting rate, thousand-grain weight, yield per plant, and rice pollen fertility.

4. Use according to any one of claims 1 to 3, characterized in that: The overexpression of the rice ferredoxin-NADP + The means of overexpression of the oxidoreductase FNR1 is either transgenic or gene editing.

5. Application of FNR1 in the creation of new rice germplasm with heat resistance and stable yield through genetic engineering.

6. The use according to claim 5, characterized in that: The heat-resistant and stable-yield characteristics are manifested in the improved photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high-temperature stress.

7. A recombinant plasmid overexpressing a rice ferredoxin-NADP + oxidoreductase FNR1 gene, characterized by: The recombinant plasmid contains a nucleotide fragment of FNR1.

8. The recombinant plasmid of claim 7, wherein: The recombinant plasmid is pCAMBIA1300-FNR1-GFP-flag, which contains a nucleotide fragment of FNR1.

9. The application of the recombinant plasmid as described in claim 7 or 8 in the creation of new rice germplasm with heat resistance and stable yield characteristics.

10. A method for improving the photosynthetic stability or heat resistance of rice, characterized in that: Increasing photosynthetic capacity, carbon assimilation efficiency, growth trend or rice yield under high temperature stress in rice by overexpressing leaf-type ferredoxin-NADP + oxidoreductase FNR1

Images