Template-free enzymatic synthesis of nucleotides and applications thereof
By combining template-free enzymes TDT and USER enzymes and using streptavidin magnetic beads for immobilization and separation, the problem of low-cost, traceless preparation of target single-stranded oligonucleotides has been solved, achieving efficient and environmentally friendly DNA synthesis suitable for biological experiments and high-throughput synthesis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- TIANJIN ZHONGHE GENE TECH CO LTD
- Filing Date
- 2026-05-08
- Publication Date
- 2026-07-31
AI Technical Summary
Existing technologies make it difficult to prepare target single-stranded oligonucleotides, especially intact blunt-terminated target single-stranded oligonucleotides, at low cost and without leaving any traces, so they cannot be directly applied to biological experiments.
The template-free enzyme TDT was used to add dUTP with a blocking group to the 3' end of the guide strand, and the target single-stranded oligonucleotide was synthesized and dissociated by USER enzyme digestion. Streptavidin magnetic beads were used for immobilization and separation, avoiding cumbersome chemical synthesis steps and the use of toxic reagents.
It enables low-cost, traceless preparation of blunt-terminated target single-stranded oligonucleotides, suitable for biological experiments, reducing the environmental impact and equipment dependence of chemical synthesis, improving synthesis length and sequence fidelity, and is suitable for high-throughput parallel synthesis.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology and relates to the dissociation of template-free enzymatically synthesized nucleotides and its applications. Background Technology
[0002] Currently, DNA synthesis, as the foundation of life sciences, is a fundamental technology in synthetic biology. With the rapid development of synthetic biology in many fields such as medicine and agriculture, the demand for synthetic DNA is increasing. Compared to chemical synthesis, enzymatic synthesis processes offer milder reaction conditions, reducing damage to DNA and helping to improve the accuracy of DNA synthesis products. Furthermore, the entire reaction process is carried out in an aqueous phase, eliminating the need for toxic compounds. More and more people are beginning to pay attention to enzymatic DNA synthesis. Currently, most enzymatic DNA synthesis methods are based on TdT enzymes (Terminal Deoxynucleotidyl Transferase). In enzymatic DNA synthesis, a template-free polymerase adds a 3'-O-blocking group to the guide strand, then removes the block, and the experimental steps of adding and removing the 3'-O-blocking group are repeated. TdT enzymes are DNA polymerases that can catalyze the binding of deoxyribonucleic acid (dNTPs) to the 3'-OH end of single-stranded DNA molecules under template-free conditions.
[0003] The USER (uracil-specific excision reagent) enzyme creates a single nucleotide nick at the uracil site. The USER enzyme is a mixture of Antarctic thermosensitive uracil-DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII. UDG catalyzes the excision of the uracil base, forming a single-base (depyrimidine) site while maintaining the structural integrity of the phosphodiester bond. The lysinic activity of endonuclease VIII breaks the phosphodiester bonds at the 3' and 5' ends of the debasement site, releasing a base-free deoxyribose. Summary of the Invention
[0004] The technical problem solved by this invention is how to prepare target single-stranded oligonucleotides at low cost and without leaving any trace. These target single-stranded oligonucleotides are complete blunt-terminated target single-stranded oligonucleotides that can be directly applied to biological experiments.
[0005] To address the aforementioned technical problems, the first aspect of this invention provides a method for template-free enzymatic synthesis and dissociation of target single-stranded oligonucleotides, comprising the following steps: A1) Add dUTP with a blocking group to the 3' end of the guide strand connected to the stationary phase using template-free TDT, and then unblock it to obtain a guide strand with U added to the 3' end. The U at the 3' end of this guide strand serves as the initiator for the synthesis of the target single-stranded oligonucleotide. A2) Following the nucleotide residue sequence of the target single-stranded oligonucleotide, the template-free enzyme TDT is used to add a dNTP with a blocking group after the initiator, the blocking is removed, and the cycle is repeated to sequentially add each nucleotide residue of the target single-stranded oligonucleotide to obtain a target single-stranded oligonucleotide with a U-guided chain. A3) The target single-stranded oligonucleotide with the U-guided chain is digested using the USER enzyme to obtain the digestion product, which is the target single-stranded oligonucleotide.
[0006] In the above text, the guide chain is an oligonucleotide chain composed of 10-40 nucleotide residues, wherein the nucleotide residues are A, T, C or G; In some embodiments, the ligand at the 5' end of the guide chain may be biotin linked to the streptavidin magnetic bead.
[0007] In some embodiments, the 3' end of the guide chain is a free hydroxyl group, and its 5'-end is modified with biotin.
[0008] In the above text, the guide chain can be an oligonucleotide chain composed of 18-36 nucleotide residues. The guide chain described above does not contain U.
[0009] In some embodiments, the TDT enzyme is derived from an enzymatic DNA synthesis kit (Tianjin Zhonghe Gene Technology Co., Ltd., DBS-01).
[0010] In the method described above, the dUTP with the blocking group is 3-O-NH2-dUTP; Alternatively, the dNTP with the blocking group may be 3-O-NH2-dATP, 3-O-NH2-dTTP, 3-O-NH2-dGTP, or 3-O-NH2-dCTP.
[0011] In the method described above, the guide chain connecting the stationary phase is obtained by connecting the stationary phase with a ligand at the 5' end of the guide chain.
[0012] In the method described above, the stationary phase is a magnetic bead with different modifications.
[0013] In the method described above, the magnetic beads with different modifications are carboxyl magnetic beads, silica magnetic beads, amino magnetic beads, polymer magnetic beads, agarose magnetic beads, or streptavidin magnetic beads, and are not limited to these.
[0014] In the method described above, the streptavidin magnetic beads have a particle size of 200 nm-10 μm.
[0015] In some embodiments, the magnetic beads with different modifications may have particle sizes of 200 nm, 300 nm, 1 μm, 2 μm, 2.8 μm, 3 μm, 5 μm or 10 μm.
[0016] In one embodiment, the streptavidin magnetic beads are selected as 300 nm magnetic beads with a binding amount ≥450 pmol / mg.
[0017] The streptavidin-biotin system has extremely high binding affinity (Kd=10^-15) and has wide applications in the biological field. By selecting superparamagnetic microspheres with uniform particle size and regular morphology, target molecules can be captured rapidly and magnetic separation can be achieved. Specifically, oligonucleotides carrying biotin and uracil are bound to streptavidin magnetic beads, and subsequent reactions are carried out on the magnetic beads.
[0018] In the method described above, the solution used for unblocking is a sodium nitrite buffer solution with a pH of 4-7.
[0019] In some embodiments, the solution used to unblock the seal is a 700 mM sodium nitrite aqueous solution with a pH of 5 (sodium nitrite is obtained by dissolving sodium nitrite in water).
[0020] In the above text, the User enzyme can be NEB:M5505 USER® Enzyme or NEB:M5508ThermolabileUSER® II Enzyme.
[0021] In some embodiments, in step 1), the working concentration of the template-free enzyme TDT is 1.2 mM.
[0022] In some embodiments, in step 1), the reaction time for adding dUTP with blocking groups is 10 min.
[0023] In some embodiments, step 1) may include the following steps: preparing a U-addition reaction system using a guide strand connected to the stationary phase, 10×Buffer 1, 10×Buffer 2, 3-O-NH2-dUTP, TDT enzyme and water, and then performing a U-addition reaction on the U-addition reaction system to obtain a guide strand with U added to the 3' end.
[0024] In some implementations, 10×Buffer 1, 10×Buffer 2 and TDT enzyme are all derived from an enzymatic DNA synthesis kit (Tianjin Zhonghe Gene Technology Co., Ltd., DBS-01). In some embodiments, the concentration of TDT enzyme in the U-addition reaction system may be 1.2 mM.
[0025] In some implementations, the reaction time for adding U can be 10 minutes.
[0026] In some embodiments, in step 2), the working concentration of the template-free enzyme TDT is 1 mM.
[0027] In some embodiments, in step 2), the reaction time for adding dNTPs with blocking groups is greater than or equal to 300 s.
[0028] In one embodiment, the reaction time for adding dNTPs with blocking groups is 5 minutes.
[0029] In some embodiments, step 2) may include the following steps: preparing an A / T / G / C addition reaction system using a 3' end U-added guide strand, 10×Buffer 1, 10×Buffer 2, 3-O-NH2-dNTP, TDT enzyme and water, and then performing an A / T / G / C addition reaction on the A / T / G / C addition reaction system to obtain a U-added target single-stranded oligonucleotide with a guide strand.
[0030] In some implementations, the concentration of TDT enzyme in the A / T / G / C reaction system can be 1 mM.
[0031] In some implementations, the reaction time for adding A / T / G / C can be greater than or equal to 300 seconds.
[0032] In one implementation, the reaction time for adding A / T / G / C is 5 minutes.
[0033] In one embodiment, step 1) involves adding magnetic beads with fixed guide chains to the reaction solution shown in Table 1 and reacting at 40°C in a shaking reactor for 10 min; then adding 400 μL of deprotection solution (700 mM sodium nitrite buffer, pH 5) and reacting at 40°C in a shaking reactor for 30 s; then washing with TE buffer to obtain magnetic beads with U-guide chains.
[0034] In one embodiment, step 2) is as follows: a) First, add the U-guided magnetic beads to the reaction system for the enzymatic synthesis of bases A / T / G / C (as shown in Table 2), and react at 40°C in a shaking reactor for 1 min; b) Then add 400 μL of deprotection solution (sodium nitrite buffer (700 mM, pH 5), and react at 40°C in a shaking reactor for 30 s; c) Wash with TE buffer, and repeat steps a and c above to add the nucleotides of each target single-stranded oligonucleotide until the nucleotides of the target single-stranded oligonucleotide are added, and the target single-stranded oligonucleotide is obtained linked to the stationary phase.
[0035] The USER (uridine-specific excision reagent) mentioned above can create a single nucleotide gap by recognizing the uridine position at the 3' end of the nucleic acid guide strand, thereby cleaving the single-stranded nucleotide product synthesized by terminal deoxynucleotidyl transferase (TdT) from the nucleic acid support linker to obtain a single strand of DNA.
[0036] Secondly, the present invention provides for the application of the method described in the first aspect in any of the following: B1) Synthesize or prepare the target single-stranded oligonucleotide; B2) Nucleic acid sequence assembly.
[0037] In the above text, the target single-stranded oligonucleotide can be a primer.
[0038] Thirdly, the present invention provides a kit for template-free enzymatic synthesis and dissociation of target single-stranded oligonucleotides, comprising the following: C1) Stationary phase; C2) The guiding chain described in the first aspect; C3) dUTP with a blocking group in the first aspect; C4) dNTPs with blocking groups in the first aspect; C5) Template-free TDT; C6) USER enzyme; The kit described above also includes sodium nitrite buffer as a deprotection solution.
[0039] The sodium nitrite buffer solution mentioned above is used as a deprotection solution to deblock the block. It is a 700 mM sodium nitrite aqueous solution with a pH between 3.5 and 6.5, and the pH value can be further adjusted to 5. The pH can be adjusted with acids such as hydrochloric acid, sulfuric acid, and nitrite.
[0040] The term "primer" as used above refers to a natural or synthetic oligonucleotide that can act as the starting point for nucleic acid synthesis after forming a double helix with a polynucleotide template and extends from its 3' end along the template to form an extended double helix. Primer extension is typically performed using nucleic acid polymerases such as DNA or RNA polymerases. The sequence of nucleotides added during extension is determined by the sequence of the template polynucleotide. Primers are usually extended using DNA polymerase. Primers typically have a length ranging from 14 to 40 nucleotides or from 18 to 36 nucleotides. Primers are used in a variety of nucleic acid amplification reactions, such as linear amplification reactions using a single primer or polymerase chain reactions using two or more primers. Guidelines for selecting the length and sequence of primers for a particular application are well known to those skilled in the art.
[0041] In this scheme, "polynucleotide," "single-stranded DNA," and "single-stranded oligonucleotide" are interchangeable and all refer to linear polymers of nucleotide monomers or their analogues. The size range of polynucleotides typically extends from a few monomer units to several thousand monomer units. Whenever a polynucleotide is represented by a letter sequence (uppercase or lowercase, such as "ATGCCTG"), it should be understood that the nucleotides are arranged from left to right in a 5'→3' order, and "A" represents deoxyadenosine, "C" represents deoxycytidine, "G" represents deoxyguanosine, "T" represents thymidine, "I" represents deoxyinosine, and "U" represents uridine.
[0042] Fourthly, the present invention provides the use of the reagent kit described in the third aspect in any of the following: D1) Synthesize or prepare the target single-stranded oligonucleotide; D2) Nucleic acid sequence assembly.
[0043] Fifthly, the present invention provides a method for conducting biological experiments using target single-stranded oligonucleotides, comprising the following steps: E1) Synthesize or prepare the target single-stranded oligonucleotide according to the method described in the first aspect; E2) Biological experiments were conducted using the target single-stranded oligonucleotide.
[0044] In the above text, the target single-stranded oligonucleotide is used as a primer.
[0045] In the above text, the biological experiments mentioned above can be PCR amplification or sequence splicing.
[0046] The beneficial effects of this invention are: 1) This invention is based on template-free enzymatic synthesis of target single-stranded oligonucleotides using TDT. The target single-stranded oligonucleotides are synthesized using template-free TDT enzymatic synthesis. These target single-stranded oligonucleotides are blunt-terminated molecules that can be directly used in subsequent biological experiments (such as as primers for amplification). This synthesis method uses U and USER enzymes added to the 3' end of the guide strand for digestion, which is low-cost and requires no external modification. This synthesis method eliminates the cumbersome cyclic steps (deprotection, coupling, capping, oxidation) in traditional chemical synthesis, avoids the use of large amounts of toxic and expensive chemical reagents (tetrazole activator, acetonitrile solvent), reduces the treatment of hazardous waste, and avoids the extremely harsh environment of chemical DNA synthesis.
[0047] 2) This invention uses template-free enzymes to synthesize DNA of a specific length in a mild solid-phase enzymatic reaction system. A single reaction round takes less than 3 minutes (compared to 8-10 minutes in chemical synthesis). The enzyme reaction conditions are mild and can be carried out in simple constant temperature equipment, reducing dependence on expensive and complex dedicated DNA synthesizers (chemical synthesis). This reduces initial investment and maintenance costs, promotes technology popularization, and allows DNA to be synthesized without restrictions in small and medium-sized laboratories and resource-limited areas. The product is also "cleaner": the synthesized DNA product has a low risk of residual harmful chemical impurities, making it more suitable for downstream applications with high requirements for biological activity, such as cell transfection, in vivo application (gene therapy), in vitro transcription / translation, etc.
[0048] 3) This invention utilizes TDT, which has continuous synthesis capabilities, and theoretically can synthesize very long DNA chains (far exceeding the current economical length limit of 200-300bp for chemical synthesis). By optimizing reaction conditions, it can effectively synthesize thousands of base pairs (kb) while maintaining high sequence fidelity. The length can be designed according to experimental needs, including arbitrary lengths. It can directly synthesize complete functional genes, large gene clusters, viral genomes, and even small artificial chromosomes, advancing the development of cutting-edge fields such as gene therapy (viral vector construction) and artificial life design. It can also efficiently synthesize DNA fragments with long tandem repeat sequences, as well as ultra-long single-stranded DNA as scaffolds or templates for constructing complex and precise DNA nanostructures and functional DNA materials.
[0049] 4) This invention provides a method for efficiently synthesizing homopolymer sequences such as Poly A, Poly T, Poly G, and Poly C, or simple repeating sequences with specific bases. By precisely controlling the order and ratio of dNTP addition, homopolymer tails or repeating units of specific patterns can be conveniently introduced into DNA ends. In molecular cloning and vector construction, it rapidly and efficiently adds homopolymer tails (e.g., Poly A for TA cloning) to PCR products or complementary tails to linearized vectors, simplifying cloning steps and improving ligation efficiency. In NGS library preparation, it efficiently introduces homopolymer sequences required by sequencing platforms (e.g., polyT capture sequences in Illumina sequencing) in adapter ligation or fragment end repair steps, improving library construction throughput and quality. In functionalization modification, it introduces specific sequence modules (e.g., primer binding sites, promoters, ribosome binding sites, protein tag coding sequences, functionalized base analogs) into DNA ends, enabling convenient functionalization of DNA molecules.
[0050] In summary, this invention provides a method suitable for high-throughput, parallel synthesis, where enzymatic reactions can be easily performed on microplates, microfluidic chips, or arrays. The TDT enzymatic synthesis process is relatively simple and highly suitable for multiplexing and automation, enabling the simultaneous synthesis of large quantities of DNA with different sequences. It can be used for large-scale oligonucleotide library synthesis, efficiently synthesizing massive libraries of unique sequences, providing a powerful tool for antibody / protein directed evolution, aptamer screening, and CRISPR sgRNA library construction, accelerating drug discovery and biosensor development. Customized gene fragment combinations and parallel synthesis of large numbers of different gene fragments or mutants are also possible for modular assembly in synthetic biology and saturation mutation studies in protein engineering. Furthermore, it allows for the direct in-situ synthesis of large numbers of different DNA probes on chips for the rapid fabrication of high-density gene chips and personalized medical diagnostic panels.
[0051] The TDT enzymatic DNA synthesis technology provided by this invention has completely revolutionized the DNA synthesis paradigm with its core advantages, including extremely simple process, low cost, breakthrough in synthesis length, flexible and controllable sequence, high-throughput parallelization capability, and environmental friendliness. It not only significantly accelerates the progress of basic life science research (genomics, synthetic biology, structural biology), but more importantly, it provides strong, economical, and scalable technical support for the following high-value application areas: 1) Next-generation gene therapy and cell therapy: rapid, low-cost synthesis of therapeutic genes and viral vectors.
[0052] 2) Precision medicine and molecular diagnostics: Efficient preparation of personalized diagnostic probes, NGS library adapters and standards.
[0053] 3) Innovative drug development: Rapidly constructing giant DNA libraries for screening antibody / protein / small molecule drugs.
[0054] 4) Synthetic biology and biomanufacturing: synthesizing artificial gene circuits, metabolic pathways and biological elements on demand.
[0055] 5) DNA data storage: Provides a potential low-cost, high-throughput method for information-encoding DNA synthesis.
[0056] 6) Advanced biomaterials: Synthesizing long-chain DNA as templates or structural units.
[0057] Therefore, this invention has extremely broad market prospects and huge economic and social value, and is expected to become a disruptive technology in the field of DNA synthesis. Attached Figure Description Figure 1 This is a schematic diagram of the free chain cutting method.
[0058] Figure 2This is a diagram showing the result of enzymatic DNA synthesis forming single strands.
[0059] Figure 3 This diagram represents the optimized formation of single strands in enzymatic DNA synthesis. A shows the results of different modified magnetic beads, B shows the selection of streptavidin-modified magnetic bead size, C shows the TDT enzyme concentration in the U-added synthesis system, D shows the reaction time in the U-added reaction, E shows the TDT enzyme concentration in the A-added synthesis system, and F shows the reaction time in the A-added reaction. Detailed Implementation
[0060] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0061] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0062] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0063] Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Unless otherwise stated, the technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods or materials similar to or equivalent to those described herein may also be used in this invention.
[0064] Example 1: Establishment of a method based on the dissociation of template-free enzymatically synthesized nucleotides. I. Preparation of Guided Chains and Stationary Phases The guide strand can be a 24nt deoxynucleotide with a free OH at its 3' end and biotin modified at its 5' end.
[0065] The stationary phase consists of streptavidin-modified magnetic beads that can be linked to the 5' end biotin of the guide strand.
[0066] The guide chain is connected to a streptavidin-modified magnetic bead via biotin at the 5' end, and has a free OH group at the 3' end.
[0067] II. Synthesis 1. Guide chain fixation 1) After removing the streptavidin-modified magnetic beads (Beaver: Streptavidin magnetic beads Cat.#22308; particle size 300nm) from the refrigerator, place them on a vortex mixer for 20s to resuspend the magnetic beads; use a pipette to take 200μL (i.e. 2mg of magnetic beads) and place it in a new centrifuge tube, place the centrifuge tube in a magnetic separator, and let it stand for 1min (this operation will be referred to as magnetic separation or solid-liquid separation, which are the same operation). Use a pipette to remove the supernatant and remove the centrifuge tube from the magnetic separator.
[0068] 2) Add 1 mL of binding buffer to the centrifuge tube, cap the tube, and vortex thoroughly to mix. Separate magnetically and remove the supernatant.
[0069] 3) Repeat step “2)” once.
[0070] 4) According to product information Cat.#22308, the binding length of the biotinylated guide chain is 24nt (pmol / mg) with a binding rate ≥450; therefore, the binding ratio of the magnetic bead to the guide chain per mg can be 1pmol-450pmol. The guide chain powder can be diluted to 20uM with TE Buffer (AM9858: TE, pH 8.0, RNase-free Invitrogen™) according to the system provided by the third-party vendor to obtain the diluted guide chain.
[0071] Add 500 μL of binding buffer, dilute with 20 μL of guide chain, add water to 1 mL, and shake thoroughly to resuspend the magnetic beads. Place the centrifuge tube in a rotary mixer and mix at room temperature for 30 min.
[0072] 5) Magnetic separation: Transfer the supernatant to a new centrifuge tube.
[0073] 6) Wash the magnetic beads twice as described in step “2)”. Then, based on the experiment, add Tris TE buffer to resuspend the magnetic beads to obtain the magnetic beads connected to the guide chain.
[0074] The above-mentioned buffer (suitable for binding biotinylated nucleic acids) formulation is: 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 M NaCl, 0.1% (volume percentage) Tween-20, with the remainder being water.
[0075] 2. TDT enzyme is added in a single step and performs DNA biosynthesis. 1) Enzymatic synthesis with single-step addition of U The added U is U with a 3'-O-blocking group (3-O-NH2-dUTP), which is the third carbon atom on the sugar ring of uracil with an oxyamino group, and its structural formula is shown in Formula 1 below: (Equation 1) (1) Transfer the magnetic beads with the guide strand obtained in step 1 to the magnetic rack, discard the supernatant, and then transfer the magnetic beads with the guide strand to the sample plate. Add the corresponding components (10×Buffer 1, 10×Buffer 2 and 20×DBS Enzyme) of the Enzyme-Catalyzed DNA Synthesis Kit (Tianjin Zhonghe Gene Technology Co., Ltd. (hereinafter referred to as Zhonghe Gene), DBS-01) to the corresponding test tube reactor according to Table 1 to obtain the reaction system for enzymatic synthesis and U addition; Table 1 shows the reaction system for enzyme-catalyzed synthesis and addition of U.
[0076] The above-mentioned 3-O-NH2-dUTP(10×) was obtained from Jiangsu Shenji Biotechnology Co., Ltd., with a concentration of 100mM.
[0077] (2) The reaction system obtained in (1) above is reacted in a shaking reactor at 40°C for 10 min at 900 rpm; it is removed from the shaking reactor and transferred to a magnetic rack. After the solution becomes clear, the supernatant is discarded.
[0078] (3) Add 400 μL of deprotection solution (700 mM sodium nitrite aqueous solution, pH 5) and react in a shaking reactor at 40 °C for 30 s to cleave the 3'-ONH group and generate free 3'-OH groups (achieving deprotection). Remove from the shaking reactor, transfer to a magnetic rack, wait for the solution to clarify, and remove the deprotection buffer.
[0079] (4) Use TE buffer (ThermoFisher AM9858) as the washing solution, mix by blowing and blowing for 30 seconds, transfer to the magnetic rack for adsorption, discard the supernatant, repeat the above operation once, and wash the magnetic beads twice in total.
[0080] (5) After the reaction is complete, a magnetic bead with a U-connected guide chain at the 3' end is obtained.
[0081] 2) Enzymatic DNA biosynthesis According to the nucleotide sequence of the target chain to be synthesized, A / T / G / C are added sequentially for enzymatic synthesis.
[0082] A / T / G / C are A / T / G / C with 3'-O-blocking groups, specifically 3-O-NH2-dATP / dTTP / dGTP / dCTP.
[0083] 3-O-NH2-dATP is the third carbon atom of adenine with an oxyamino group, and its structural formula is shown in Formula 2 below; 3-O-NH2-dTTP has an oxyamino group on the third carbon atom of the sugar ring of thymine, and its structural formula is shown in Formula 3 below; 3-O-NH2-dGTP is a guanine compound with an oxyamino group on the third carbon atom of the sugar ring, and its structural formula is shown in Formula 4 below; 3-O-NH2-dCTP has an oxyamino group on the third carbon atom of the cytosine sugar ring, and its structural formula is shown in Formula 5 below.
[0084]
[0085] (1) Transfer the magnetic beads with the U-connected guide strands at the 3' end obtained in 1) above to the magnetic rack, discard the supernatant, and then transfer the magnetic beads to the sample plate. Add the corresponding components (10×Buffer 1, 10×Buffer 2, 3-O-NH2-dNTP (10×) (10x modified substrate A solution, 10x modified substrate T solution, 10x modified substrate C solution or 10x modified substrate G solution) and 20×DBS Enzyme) from the enzyme-catalyzed DNA synthesis kit (Tianjin Zhonghe Gene Technology Co., Ltd., DBS-01) to the corresponding test tube reactor according to Table 2. Add the corresponding reaction system according to Table 2 to obtain the enzyme-catalyzed DNA synthesis reaction system with A / T / G / C.
[0086] Table 2 shows the reaction system for enzyme-catalyzed synthesis with A / T / G / C.
[0087] (2) The above-mentioned enzyme-catalyzed synthesis reaction system with A / T / G / C was reacted in a shaking reactor at 40°C for 5 min; it was removed from the shaking reactor, transferred to a magnetic rack, and the supernatant was discarded after the solution became clear.
[0088] (3) Add 400 μL of deprotection solution (700 mM sodium nitrite aqueous solution, pH 5) and react in a shaking reactor at 40 °C for 30 s to cleave the 3'-ONH group and generate free 3'-OH groups (achieving deprotection). Remove from the shaking reactor, transfer to a magnetic rack, wait for the solution to clarify, and remove the deprotection buffer.
[0089] (4) Use TE buffer (ThermoFisher AM9858) as the washing solution to wash the magnetic beads twice.
[0090] (5) Repeat (1)-(4) in a cyclical manner according to the nucleotide residue sequence of the target chain to be synthesized, and add the required nucleotides in sequence to obtain magnetic beads with the target single-stranded oligonucleotide with the U-guided chain.
[0091] (6) The magnetic beads with the target single-stranded oligonucleotide with the U-guided chain were melted back into TE buffer (AM9858: TE, pH 8.0, RNase-free Invitrogen™) to obtain a magnetic bead solution with the target chain.
[0092] 3. Pyrolysis Using USER to identify U, the target chain without U is obtained after cutting. Figure 1 ), as detailed below: The above-mentioned magnetic bead solution containing the target chain was placed on a beaver magnetic rack through a 2mL EP tube and allowed to adsorb for 1 minute. After the liquid became clear, the magnetic beads were separated from the TE buffer. The TE buffer was removed using a pipette with an appropriate volume, and the magnetic beads were removed from the magnetic rack. User enzyme (NEB: M5505 USER® Enzyme or NEB: M5508 Thermolabile USER® II Enzyme) was added to carry out the enzymatic digestion reaction. The reaction system was prepared according to the ratios in Table 3 and the reaction system shown in Table 4 to obtain the digestion product, which is the dissociated target single-stranded oligonucleotide.
[0093] Table 3 shows the enzyme digestion reaction system.
[0094] Table 4 shows the reaction conditions.
[0095] Example 2: Application of single-stranded DNA biosynthesis I. Preparation of Guided Chains and Stationary Phases The nucleotide sequence of the guide chain is 5-Biotin / TTTTTTTTTTTTTTTTTTCGAATT(Sequence 1) / , with a free OH at the 3' end and biotin modified at the 5' end.
[0096] The stationary phase is streptavidin-modified magnetic beads (300 nm in diameter). The recombinant neutral streptavidin is covalently coupled to the magnetic microspheres with regular morphology and uniform particle size using a directional immobilization technique to form a monolayer for the application of biotinylated nucleic acids.
[0097] II. Synthesis 1. Guide chain fixation Same as Example 1.
[0098] 2. TDT enzyme is added in a single step and performs DNA biosynthesis. 1) Enzymatic synthesis with single-step addition of U: Same as in Example 1.
[0099] 2) Biosynthesis of DNA The target DNA strand to be synthesized is GATCATTATG (sequence 2).
[0100] The target chain nucleotides were added sequentially according to the method in Example 1 to carry out the synthesis.
[0101] 3. Pyrolysis As in Example 1, single-chain oligonucleotides were obtained.
[0102] The magnetic bead solutions containing the target strand were lysed after each addition of one nucleotide of the target strand to obtain the target strands with different added nucleotides.
[0103] The obtained enzyme digestion products (each target chain with different added nucleotides) were mixed with an equal volume of 2×TBE urea loading buffer, and the synthesis results were preliminarily determined by 20%-PAGE urea gel electrophoresis.
[0104] The results are as follows Figure 2 As shown, each lane, from left to right, represents the product of adding different nucleotides from the 5' end of the target chain. It can be seen that the USER enzyme, when digested at 37°C, can produce sequence bands of the corresponding length and with good results, indicating the efficient synthesis of single-stranded oligonucleotides.
[0105] Example 3: Biosynthesis of single-stranded DNA molecules for primer synthesis I. Preparation of Guided Chains and Stationary Phases Same as in Example 2; II. Synthesis 1. Guide chain fixation Same as Example 1.
[0106] 2. TDT enzyme is added in a single step and performs DNA biosynthesis. 1) Enzymatic synthesis with single-step addition of U: Same as in Example 1.
[0107] 2) Biosynthesis of DNA Primers used to amplify the GENE1 gene (nucleotide sequence 3) were used as the target strand to be synthesized.
[0108] The target strands to be synthesized are primers F and R, respectively. Primer F: 5'-3': ATGACCGCAATTGATACCCGT (sequence 4); Primer R: 5'-3': TTATTCGTTGCTCTGATGGCT (Sequence 5).
[0109] The target chain nucleotides were added sequentially according to the method in Example 1 to carry out the synthesis.
[0110] 3. Pyrolysis Similar to Example 1, each single-stranded oligonucleotide was obtained, namely primer F and primer R.
[0111] III. Functional Verification of Single-Stranded Primers Using the GENE1 gene shown in sequence 3 as a DNA template, the primers F and R prepared above were directly amplified using PCR enzyme (Vazyme: Phanta Max Super-Fidelity DNA Polymerase-p505) according to the system shown in Table 5 and the procedure shown in Table 6 without needing to be recovered.
[0112] Table 5 shows the PCR amplification system.
[0113] Table 6 lists the amplification conditions.
[0114] PCR amplification products were obtained.
[0115] The PCR products were ligated into vector clones and then transformed into competent E. coli cells. After overnight culture, the single clones were identified by PCR, and single clones with the correct positional bands were screened by agarose gel electrophoresis.
[0116] The above single clones were sent for sequencing. The results of first-generation sequencing showed that the product obtained by PCR reaction was consistent with its corresponding sequence, indicating that the DNA single strand synthesized by TdT enzymatic method can be used as a primer.
[0117] Example 4: Optimization of the enzymatic biosynthesis process for single-stranded DNA molecules 1. Different modified magnetic beads The method using streptavidin-modified magnetic beads (the method of this invention): The nucleotide sequence of the guide strand is 5-Biotin / TTTTTTTTTTTTTTTTTT (Sequence 6) / iPCLink / CGAATTCAGTCTATTA (Sequence 7) / (Sangon Biotech (Shanghai) Co., Ltd., https: / / www.sangon.com / ), with a free OH at the 3' end and biotin modified at the 5' end. The target strand is the guide strand with an A added to the 3' end.
[0118] According to the A-addition method in Example 1, A is added directly to the end of the guide chain without adding U, and the chain is cleaved by irradiation with near-ultraviolet light (300-350nm) (ultraviolet crosslinker), and then melted back into TE buffer to obtain the target chain.
[0119] Azide magnetic bead method: Unlike the streptavidin-modified magnetic bead method, azide magnetic beads are used instead of streptavidin-modified ones. The nucleotide sequence of the guide strand is 5-DBCO / TTTTTTTTTTTTTTTTTT (Sequence 6) / iPCLink / CGAATTCAGTCTATTA (Sequence 7) / (Sangon Biotech (Shanghai) Co., Ltd., https: / / www.sangon.com / ), with a free OH at the 3' end and DBCO modified at the 5' end. The target strand is the guide strand with an A added to the 3' end.
[0120] Electrophoretic analysis was performed on the target chains of magnetic beads with different modifications, and the results were obtained. Figure 3 As shown in Figure A, the reaction of streptavidin-modified magnetic beads (SA beads) is complete.
[0121] 2. Selection of particle size for streptavidin-modified magnetic beads in the biosynthesis of single-stranded DNA molecules Commercially available and readily procurable streptavidin magnetic beads are available in sizes of 300 nm, 1 μm, 5 μm, and 10 μm (from Beaver Biotechnology's official website). The guide strand has the nucleotide sequence 5-Biotin / TTTTTTTTTTTTTTTTTTCGAATT (Sequence 1) / , with a free OH terminus at the 3' end and biotin modification at the 5' end. The target strand is the guide strand with an A added to the 3' end.
[0122] Following the A-addition method of Example 1, A is added directly to the end of the guide chain without adding U, and the target chain is obtained by dissociation. The difference in the method is that the streptavidin-modified magnetic beads are replaced with 300nm, 1um, 5um, and 10um streptavidin magnetic beads.
[0123] The results showed that after mixing with a pipette and reacting for 5 minutes on a mixer, 1µm, 5µm, and 10µm magnetic beads aggregated at the bottom of the tube wall, separating from the reaction solution and forming a suspension, which was detrimental to subsequent reactions. The magnetic beads agglomerated, forming clusters that settled at the bottom of the EP tube instead of being uniformly dispersed in the reagent.
[0124] Electrophoretic detection of target chains obtained from avidin-modified magnetic beads of different sizes was performed, and the results are as follows: Figure 3 As shown in Figure B, the 300nm magnetic beads reacted completely, while magnetic beads of other particle sizes did not react completely as shown in the PAGE gel image.
[0125] Example 5: Optimization of TDT enzyme concentration and reaction time for single-step addition of U in the biosynthesis of single-stranded DNA molecules. The nucleotide sequence of the guide strand is 5-Biotin / TTTTTTTTTTTTTTTTTTCGAATT (Sequence 1) / , with a free OH at the 3' end and biotin modified at the 5' end. The target strand is the guide strand with a U added to the 3' end.
[0126] The enzyme concentration and reaction time in the U synthesis system were optimized.
[0127] 1. TDT enzyme concentration Gradient experiments were conducted to determine the concentration of TDT enzyme in the U-addition synthesis system.
[0128] Following the U-addition method of Example 1, U is added to the end of the guide strand, and then the target strand is obtained by USER cleavage. The difference in the method is that the final concentrations of TDT enzyme in the system are 0.1 mM, 0.3 mM, 0.5 mM, 0.8 mM, and 1.2 mM, respectively.
[0129] Electrophoresis was used to detect the target strands obtained by adding U to different TDT enzyme concentrations, and the results are as follows: Figure 3 As shown in Figure C, it can be seen that the reaction is complete at a TDT enzyme concentration of 1.2 mM.
[0130] 2. Optimization of reaction time Gradient experiments were conducted to determine the reaction time in the U-addition reaction.
[0131] Following the U-addition method of Example 1, the target chain is obtained by USER shearing after adding U to the end of the guide chain. The difference in the method is that the reaction is carried out at 40°C in a shaking reactor for 60S, 180S, 300S and 600S respectively.
[0132] Electrophoretic analysis of the target chains obtained by adding U at different reaction times yielded the following results: Figure 3 As shown in Figure D, it can be seen that the reaction is complete in 600 seconds (10 minutes).
[0133] Example 6: Optimization of enzyme concentration and reaction time for the enzymatic synthesis of bases A / T / G / C in the biosynthesis of single-stranded DNA molecules. The nucleotide sequence of the guide strand is 5-Biotin / TTTTTTTTTTTTTTTTTTCGAATT (Sequence 1) / , with a free OH at the 3' end and biotin modified at the 5' end. The target strand is an example of the guide strand with an A added to the 3' end.
[0134] The enzyme concentration and reaction time for synthesizing the A / T / C / G base system were optimized.
[0135] 1. Optimization of enzyme concentration in the reaction system Gradient experiments were conducted to determine the concentration of TDT enzyme in the A-addition synthesis system.
[0136] Following the A-addition method of Example 1, A is added directly to the end of the guide chain without adding U, and the target chain is obtained by dissociation. The difference in the method is that the final concentrations of TDT enzyme in the system are 0.3mM, 0.5mM, 0.8mM and 1mM, respectively.
[0137] Electrophoresis was used to detect the target strands obtained by adding U to different TDT enzyme concentrations, and the results are as follows: Figure 3 As shown in E, it can be seen that the reaction is complete at a TDT enzyme concentration of 1 mM.
[0138] 2. Optimization of reaction time Gradient experiments were conducted to determine the reaction time for the addition of A.
[0139] According to the A-addition method in Example 1, A is added directly to the end of the guiding chain without adding U, and the target chain is obtained by dissociation. The difference in the method is that the reaction is carried out at 40°C in a shaking reactor for 60S, 180S, 300S, 600S and 12000S respectively.
[0140] Electrophoretic analysis of the target chains obtained at different reaction times yielded the following results: Figure 3 As shown in Figure F, the reaction is complete after 300 seconds (5 minutes).
[0141] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. A method for template-free enzymatic synthesis and dissociation of a target single-stranded oligonucleotide, comprising the following steps: A1) Add dUTP with a blocking group to the 3' end of the guide strand connected to the stationary phase using template-free TDT, and then remove the blocking to obtain a guide strand with U added to the 3' end. The U at the 3' end of this guide strand serves as the initiator for the synthesis of the target single-stranded oligonucleotide. A2) Following the nucleotide residue sequence of the target single-stranded oligonucleotide, the template-free enzyme TDT is used to add a dNTP with a blocking group after the initiator, the blocking is removed, and the cycle is repeated to sequentially add each nucleotide residue of the target single-stranded oligonucleotide to obtain a target single-stranded oligonucleotide with a U-guided chain. A3) The target single-stranded oligonucleotide with the U-guided chain is digested using the USER enzyme to obtain the digestion product, which is the target single-stranded oligonucleotide.
2. The method according to claim 1, characterized in that: The dUTP with the blocking group is 3-O-NH2-dUTP; Alternatively, the dNTP with the blocking group may be 3-O-NH2-dATP, 3-O-NH2-dTTP, 3-O-NH2-dGTP, or 3-O-NH2-dCTP.
3. The method according to claim 1 or 2, characterized in that: The guide chain connecting the stationary phase is obtained by connecting the stationary phase with a ligand at the 5' end of the guide chain.
4. The method according to claim 3, characterized in that: The stationary phase is a magnetic bead with different modifications.
5. The method according to claim 4, characterized in that: The magnetic beads with different modifications are carboxyl magnetic beads, silica magnetic beads, amino magnetic beads, polymer magnetic beads, agarose magnetic beads, or streptavidin magnetic beads.
6. The method according to claim 5, characterized in that: The streptavidin magnetic beads have a particle size of 200 nm to 10 μm.
7. The method according to claim 1 or 2, characterized in that: The solution used to unblock the blockage is a sodium nitrite buffer solution with a pH of 4-7.
8. The application of the method according to any one of claims 1-7 in any of the following: B1) Synthesize or prepare the target single-stranded oligonucleotide; B2) Nucleic acid sequence assembly.
9. A kit for template-free enzymatic synthesis and dissociation of target single-stranded oligonucleotides, comprising the following: C1) Stationary phase; C2) The guiding chain as described in any one of claims 1-7; C3) The dUTP with a blocking group as described in any one of claims 1-7; C4) The dNTP with a blocking group as described in any one of claims 1-7; C5) Template-free TDT; C6) USER enzyme; Alternatively, the kit may be used in any of the following applications: D1) Synthesize or prepare the target single-stranded oligonucleotide; D2) Nucleic acid sequence assembly.
10. A method for conducting biological experiments using target single-stranded oligonucleotides, comprising the following steps: E1) Synthesize or prepare the target single-stranded oligonucleotide according to any one of the methods described in claims 1-7; E2) Biological experiments were conducted using the target single-stranded oligonucleotide.