Methods, compositions, and devices for information storage
By combining a nanofluidic system and a nanopore reader, the problems of low information density and insufficient stability in DNA storage methods are solved, enabling fast and accurate data storage and retrieval, which is suitable for long-term data storage.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- IRIDIA INC
- Filing Date
- 2017-02-28
- Publication Date
- 2026-07-31
AI Technical Summary
Existing DNA storage methods suffer from low information density, insufficient stability, and complex reading processes that are prone to errors, making it difficult to achieve long-term, efficient data storage.
Nucleic acid sequences are synthesized using a nanofluidic system and rapidly read using a nanopore reader. Data is stored and read through nanopores on a nanochip, and the movement and state of DNA are detected using a nanopore sensor, enabling rapid and accurate sequencing.
It increases information density, reduces the proportion of sequence identification information, and provides fast and accurate sequencing, enabling long-term stable data storage.
Smart Images

Figure CN122484263A_ABST
Abstract
Description
[0001] This application is a divisional application of Chinese Patent Application 201780025380.6 (PCT / US2017 / 020044), filed on February 28, 2017, entitled "Method, Composition and Apparatus for Information Storage".
[0002] Cross-reference to related applications
[0003] This application claims priority to U.S. Provisional Patent Application No. 62 / 301,538, filed February 29, 2016, and U.S. Provisional Patent Application No. 62 / 415,430, filed October 31, 2016, the contents of which are incorporated herein by reference in their entirety. Technical Field
[0004] This invention relates to novel methods, compositions, and devices for synthesizing and sequencing polymers (e.g., nucleic acids) using nanopore devices for information storage and retrieval. Background Technology
[0005] The need to store more data on or within physical media is constantly growing, and storage devices are becoming smaller as capacity increases. It's reported that the amount of data stored doubles every two years, and according to one study, by 2020, the amount of data created and copied annually will reach 44 zettabytes, or 44 trillion gigabytes. Furthermore, existing data storage media such as hard drives, optical media, and magnetic tapes are relatively unstable and can degrade after prolonged storage.
[0006] There is an urgent need for alternative methods to store large amounts of data over long periods of time, such as decades or centuries.
[0007] Some have suggested using DNA to store data. DNA is very stable and, theoretically, can encode large amounts of data and store it for very long periods. See, for example, Bancroft, C., et al., Long-Term Storage of Information in DNA, Science (2001) 293: 1763-1765. Furthermore, DNA as a storage medium is less susceptible to the security risks of traditional digital storage media. However, there is no practical way to implement this idea.
[0008] For example, WO2014 / 014991 describes a method for storing data on DNA oligonucleotides, where information is encoded in binary format, one bit per nucleotide, in 96-bit (96 nucleotide) data blocks, with a 19-nucleotide address sequence and flanking sequences for amplification and sequencing. The sequences are then amplified using PCR and the codes are read using a high-speed sequencer such as the Illumina HiSeq machine. The data block sequences are then arranged in the correct order using address tags, filtering out the address and flanking sequences, and the sequence data is converted into binary code. This method has significant limitations. For example, a 96-bit data block can only encode 12 letters (using a conventional one byte or 8 bits per letter or space). The ratio of useful information stored relative to the "housekeeper" information is low—approximately 40% of the sequence information is occupied by address and flanking DNA. The specification describes encoding books using 54,698 oligonucleotides. The inkjet-printed high-fidelity DNA microchips used to synthesize the oligonucleotides limit the size of the oligonucleotides (the described 159-mer is at the upper limit). Furthermore, reading the oligonucleotides requires amplification and separation, which introduces additional possibilities for error. See also WO 2004 / 088585A2; WO 03 / 025123 A2; C. BANCROFT: "Long-Term Storage of Information in DNA", Science (2001) 293 (5536): 1763c-1765; COX JPL: "Long-term data storage in DNA", Trends in Biotechnology (2001) 19(7): 247-250.
[0009] While the potential information density and stability of DNA make it an attractive tool for data storage, it has been known for over twenty-five years, yet there is still no practical way to write and read large amounts of data in this form. Summary of the Invention
[0010] We have developed a novel nucleic acid storage method that uses a nanofluidic system to synthesize nucleic acid sequences and a nanopore reader to read those sequences. Our method allows for the synthesis, storage, and reading of DNA strands hundreds, thousands, or even millions of base pairs long. Because the sequences are so long, only a relatively small percentage of the sequence is occupied by identification information, resulting in a much higher information density than methods described above. Furthermore, in some embodiments, the synthesized nucleic acids will have specific locations on the nanochip, allowing sequence identification even without identification information. Sequencing in nanocontainers is extremely fast, and reading sequences through nanopores can be very rapid, reaching speeds of up to one million bases per second. Since only two base types are required, sequencing can be faster and more accurate than sequencing procedures that must distinguish four nucleotide base types (adenine, thymine, cytosine, and guanine). In certain embodiments, the two bases do not pair with each other to form secondary structures and also have different sizes. For example, adenine and cytosine will be superior for this purpose to adenine and thymine, which tend to hybridize, or adenine and guanine, which have similar sizes.
[0011] In some embodiments, the system can be used to synthesize long polymers encoding data, which can be amplified and / or released, and then sequenced on different sequencers. In other embodiments, the system can be used to provide customized DNA sequences. In other embodiments, the system can be used to read DNA sequences.
[0012] In one embodiment, a nanochip uses a nanochip comprising at least two independent reaction compartments connected by at least one nanopore. The nanopore prevents mixing of at least some components but allows as few as a single DNA molecule or other charged polymers, such as RNA or peptide nucleic acids (PNAs), to move in a controlled manner from one reaction compartment to another. The transfer of polymers (or at least the ends of added monomers of the polymer) from one compartment to another allows for the sequential manipulation / reaction of the polymer using enzymes, such as adding bases, which cannot pass through the nanopores, for example, because they are too large or because they are bound to the matrix or bulk portions. The nanopore sensor reports the movement or location of the polymer and its state, such as its sequence, and whether the attempted reaction was successful. This allows for the writing, storage, and reading of data, such as base sequences corresponding to machine-readable code, such as binary code, where each base or group of bases corresponds to a 1 or 0.
[0013] Therefore, the present invention particularly includes the following embodiments,
[0014] A nanochip for synthesizing charged polymers (e.g., DNA) comprises at least two distinct monomers. The nanochip includes two or more reaction chambers separated by one or more nanopores, each containing an electrolyte, one or more electrodes drawing the charged polymer into the chamber, and one or more reagents facilitating the incorporation of monomers or oligomers into the polymer. The nanochip may optionally be configured with functional elements to guide, direct, and / or control the DNA. It may optionally be coated or fabricated with a material selected to allow smooth flow or attachment of DNA, and the nanochip may include nanocircuit elements to provide and control the proximity of electrodes to the nanopores. For example, one or more nanopores may optionally be each associated with an electrode that controls the movement of the polymer through the nanopore and / or detects changes in potential, current, resistance, or capacitance at the interface between the nanopore and the polymer, thereby detecting the sequence of the polymer as it passes through one or more nanopores. In certain embodiments, oligomers are synthesized using polymerases or site-specific recombinases. In some embodiments, the polymer is sequenced during synthesis to allow for the detection and, optionally, correction of errors. In some implementations, the polymer thus obtained is stored on a nanochip and can be sequenced when the information encoded in the polymer sequence needs to be accessed.
[0015] • A method for synthesizing polymers (e.g., DNA) using the nanochips described above.
[0016] • Single-stranded DNA molecules, in which the sequence consists essentially of only non-hybridized nucleotides, such as adenine and cytosine nucleotides (As and Cs), arranged in order to correspond to binary code, for example, for data storage methods.
[0017] • Double-stranded DNA, which contains a series of nucleotide sequences corresponding to binary code, and also contains...
[0018] • A method for reading binary code encoded in DNA, including the use of a nanopore sequencer.
[0019] A data storage method and apparatus thereof, comprising preparing a charged polymer, such as DNA, containing at least two different monomers using the aforementioned nanochip, wherein the monomers are arranged in sequence to correspond to binary code.
[0020] Other aspects and applicable fields of the invention will become apparent from the detailed description provided below. It should be understood that while the detailed description and specific examples illustrate preferred embodiments of the invention, they are for illustrative purposes only and are not intended to limit the scope of the invention. Attached Figure Description
[0021] The invention will be more fully understood from the detailed description and accompanying drawings, in which:
[0022] Figure 1 A simple dual-chamber nanochip design is shown, in which the separating membrane is perforated by nanopores and has electrodes on either side of the membrane.
[0023] Figure 2 and Figure 3 It shows how charged polymers, such as DNA, are attracted to the anode.
[0024] Figure 4 and Figure 5 It was shown that the polymer could move backward by reversing the polarity of the electrode.
[0025] Figure 6 A dual-chamber nanochip design for DNA synthesis is shown, in which a polymerase is located in one chamber and a desmotherase is located in the other chamber, and neither can pass through a nanopore.
[0026] Figure 7 It is shown that when 3'-closed dATP(A) flows through the left chamber, adenine nucleotides are added and the current is set to "forward" to bring DNA into the chamber.
[0027] Figure 8 The deprotection of oligonucleotides is illustrated, thus allowing the addition of additional nucleotides. For example, deprotection occurs after the DNA is moved into the chamber by setting the current to "reverse".
[0028] Figure 9 The diagram shows an added 3'-closed dCTP (C). In some embodiments, a fluid flow is used to exchange the contents of the chamber, for example, as shown, where "A" was previously present in the chamber.
[0029] Figure 10 This demonstrates how to convert a flow chamber into a single lane to provide reagents while simultaneously providing multiple separate storage chambers.
[0030] Figure 11 This illustrates a method for maintaining DNA association with its chambers by attaching to the chamber (the upper DNA fragment in the figure) or by coupling to a large group that cannot pass through nanopores (the lower DNA fragment in the figure). In this system, the end of the DNA can still move into the flow chamber and receive additional nucleotides, but the other end remains in the reserve chamber.
[0031] Figure 12 The structure showing DNA attaching to the chamber wall and being controlled by multiple electrodes is illustrated.
[0032] Figure 13 This demonstrates how DNA can be retained in a chamber simply by controlling the polarity of the electrodes when needed.
[0033] Figure 14An array with free-flowing reagents through both sides is shown, in which DNA binds to the surface of the chamber.
[0034] Figure 15 Another design is shown in which the electrodes are located on the side adjacent to the separator membrane, which allows for cheaper manufacturing.
[0035] Figure 16 A three-compartment arrangement is shown, in which DNA can be moved from compartment to compartment via electrodes. This system does not require significant reagent flow during synthesis.
[0036] Figure 17 An example of how to prepare reagents using a three-compartment arrangement is shown.
[0037] Figure 18 Oligonucleotides are depicted as being confined adjacent to nanopores, wherein the nanopores have electrode elements on either side of the membrane.
[0038] Figure 19 A series of DNA molecules attached to a membrane containing nanopores is depicted, each membrane molecule having a flow lane on either side of the membrane under the control of an electrode adjacent to the nanopore. For example, as shown, the left flow lane provides a continuous flow of buffer wash / 3'-blocked dATP(A) / buffer wash / 3'-blocked dCTP(C) / buffer wash, where DNA molecules are only carried into the flow chamber if the desired nucleotide is present. The right flow lane provides a deprotecting agent to deprotect the 3' end of the nucleotide and allow the addition of another nucleotide. In one embodiment, the deprotecting agent flows when the left flow lane is washed with buffer. In another embodiment, the deprotecting agent is too large to pass through the nanopores into the left flow lane.
[0039] Figure 20-22 The concept experiment evidence is illustrated schematically, in which the bits used to encode the data are short oligomers attached using topoisomerase.
[0040] Figure 23 The form of a nanopore sequencer is described, in which polymer sequences are read using capacitance changes. In this capacitive readout scheme, electrodes form the top and bottom plates of a capacitor, separated by a membrane comprising a nanopore. The capacitor is embedded in a resonant circuit, where a pulsed direct current can attract charged polymers through the nanopore. As the polymer, such as DNA, passes through the nanopore, the capacitance change is measured using high-frequency impedance spectroscopy. The main advantage of this method (especially for DNA) is that the measurement frequency can be very high (effectively measuring each cycle, so 100 MHz corresponds to 100 million measurements per second), and much greater than the transport rate of monomers through the nanopore (e.g., DNA, unless somehow restricted, would respond to current passing through the nanopore at a rate on the order of 1 million nucleotides per second).
[0041] Figure 24 A dual-addition-chamber layout is depicted, suitable for adding two different types of monomers or oligomers, such as for 2-bit or binary encoding. The upper half of the figure shows a top view. The lower half shows a side cross-section. The complete device in this embodiment can be assembled from up to three separately fabricated layers and connected by wafer bonding, or it can be formed by etching a single substrate. The chip includes an electrical control layer (1), a fluid layer (2) containing two addition chambers located on top of a reservoir chamber, with charged polymers (e.g., DNA) anchored between the nanopore inlets of the first and second addition chambers and an electrically grounded layer (3).
[0042] Figure 25 Depicting Figure 24 The operation of the dual-addition chamber layout. It will be observed that at the bottom of each addition chamber, there is a nanopore (4). The nanopores are fabricated, for example, by drilling using FIB, TEM, wet or dry etching or by dielectric breakdown. The membrane (5) containing the nanopores is, for example, 1 atomic layer to tens of nm thick. It is made of, for example, SiN, BN, SiOx, graphene, transition metal dichalcogenides, for example, WS2 or MoS2. Below the nanopore membrane (5) is a reservoir or desealing chamber (6) containing an agent for polymer deprotection after the addition of a monomer or oligomer in one addition chamber (recall the addition of monomers or oligomers in end-protected form so that only a single monomer or oligomer is added at a time). The polymer (7) can be drawn into or drawn out of the addition chamber by changing the polarity of the electrodes in the electro-control layer (1).
[0043] Figure 26 Depicting and Figure 24 and Figure 25 A similar top view, but here there are four addition chambers that share a common reservoir or unsealing chamber, with the polymer system located at a position (9) that has access to each of the four chambers. The cross-section of this layout will be as follows: Figure 24 and Figure 25 As shown, and through the operation of the electrical control layer ( Figure 24 The electrode in 1) can move the charged polymer into each of the four addition chambers.
[0044] Figure 27 A top view of a nanoporous chip with multiple sets of dual addition chambers is depicted, such as... Figure 24 and Figure 25As shown, parallel synthesis of multiple polymers is permitted. Monomers (here, dATP and dGTP nucleotides denoted as A and G) are loaded into each chamber via a continuous flow path. One or more common deblocking agent flow cells allow the polymer to be deprotected after the addition of a monomer or oligomer in one addition chamber. This also allows the polymer to be separated as needed (e.g., using restriction enzymes in the case of DNA, or chemically separated from the surface of adjacent nanopores and collected externally). In this particular embodiment, the deblocking agent flow cell is perpendicular to the fluid loading channel used to fill the addition chamber.
[0045] Figure 28 Further details of the wiring in the dual-addition chamber layout are depicted. The electrical control layer (1) comprises wiring made of metal or polysilicon. Wiring density is increased by 3D stacking, and electrical isolation is provided by dielectric deposition (e.g., via PECVD, sputtering, ALD, etc.). In one embodiment, the contacts (11) through the top electrodes in the addition chambers are fabricated using through-silicon vias (TSVs) via deep reactive ion etching (DRIE) (low temperature or BOSCH process). Individual voltage control (12) allows each addition chamber to be addressed individually, allowing precise parallel control of the sequence of multiple polymers. The right side of the figure depicts a top view illustrating the wiring to the multiple addition cells. The electrical ground layer (3) may be shared (as shown) or separate to reduce cross-coupling between cells.
[0046] Figure 29 Another configuration is depicted in which the control electrode (13) for adding the chamber can be deposited on the side of the chamber in a circumferential manner instead of on the top of the chamber.
[0047] Figure 30 SDS-PAGE gels were plotted, confirming that the topoisomerase addition protocol described in Example 3 was effective, with bands corresponding to the expected A5 and B5 products clearly visible.
[0048] Figure 31 Agarose gel plots confirmed that the PCR products of Example 5 were of the correct size. Lane 0 is a 25-base-pair sequence ladder; lane 1 is the experimental product, with the line corresponding to the expected molecular weight; lane 2 is negative control #1; lane 3 is negative control #2; lane 4 is negative control #4.
[0049] Figure 32 Agarose gel plots confirmed that the restriction enzyme, as described in Example 5, produced the expected product. The gradient on the left is a 100-base-pair sequence ladder. Lane 1 is undigested NAT1 / NAT9c, lane 2 is digested NAT1 / NAT9c, lane 3 is undigested NAT1 / NAT9cI, and lane 4 is digested NAT1 / NAT9cI.
[0050] Figure 33 The immobilization of DNA near the nanopores is depicted. Inset (1) shows DNA with an origami structure at one end in the left chamber (in actual nanochips, there are initially many such origami structures in the left chamber). Inset (2) shows the system with an anode on the right, which drives the DNA into the nanopores. Although the DNA strands can pass through the nanopores, the origami structures are too large to pass through, thus the DNA is "stuck." The current is turned off ( Figure 3 This allows DNA diffusion. Using appropriate chemical methods, the ends of the DNA strands are able to bind when they come into contact with the surface near the nanopores. In small figure (4), a restriction enzyme is added, which cuts the origami structure from the DNA. A washing chamber is used to remove the enzyme and residual DNA. The end result is a single DNA molecule attached near the nanopores, capable of moving back and forth through the nanopores.
[0051] Figure 34 The basic functional nanopores are depicted. In each small plot, the y-axis represents current (nA) and the x-axis represents time (s). The left plot, “Screening for RF Noise,” illustrates the utility of the Faraday cage. A chip without nanopores is placed in a flow cell and 300 mV is applied. Noise reduction is observed when the lid of the Faraday cage is closed (first arrow). A small spike potential occurs when the latch is closed (second arrow). Note that the current is ~0 nA. After pore fabrication (middle plot), applying 300 mV (arrow) results in a current of ~3.5 nA. When DNA is applied to the ground chamber and +300 mV is applied, DNA migration can be observed (right plot) as a transient decrease in current. (Note that TS buffer is used in this case: 50 mM Tris, pH 8, 1 M NaCl). Lambda DNA was used for this DNA migration experiment.
[0052] Figure 35 A simplified diagram illustrating the main features of the DNA origami structure is shown: a large single-stranded region, a cubic origami structure, and two restriction sites (SwaI and AlwN1) near the origami structure.
[0053] Figure 36 Electron microscopic images of the fabricated DNA origami structure were depicted, showing the expected topological structure. The origami was prepared from 5 mM Tris base, 1 mM EDTA, 5 mM NaCl, and 5 mM MgCl2. To maintain the origami structure, a Mg++ concentration of approximately 5 mM or a Na+ / K+ concentration of approximately 1 M was preferred. The origami structure was stored at 500 nM at 4ºC.
[0054] Figure 37Restriction digestion of DNA origami was depicted to confirm correct assembly and function. The leftmost lane provides the MW standard. Restriction sites were tested by digesting the origami with AlwN1 and Swa1. The four test lanes contain the following reagents (in μL):
[0055]
[0056] Lane (1) was a negative control; lane (2) was digested with Swa1; lane (3) was digested with AlwN1; and lane (4) was double-digested with Swa1 / AlwN1. Digestion was performed at room temperature for 60 minutes, followed by 90 minutes at 37°C. Agarose gels were prepared with 1 / 2x TBE-Mg (1 / 2x TBE, containing 5 mM MgCl2) and stained with ethidium bromide. Digestion with either enzyme alone did not show migration in the gel, but digestion with both enzymes together (lane 4) resulted in two fragments of different lengths, as expected.
[0057] Figure 38 The binding of biotin-labeled oligonucleotides to streptavidin-coated beads was depicted in contrast to the binding of BSA-coated beads as a control. The y-axis represents fluorescence units; 'before binding' is the fluorescence of the oligonucleotides from the test solution before bead binding; the (-) control is the fluorescence observed after binding to two different batches of BSA-conjugated beads; SA-1 and SA-2 are the fluorescence observed after binding to two different batches of streptavidin-conjugated beads. Small apparent amounts of binding were observed with BSA-conjugated beads, but larger amounts of binding were observed with streptavidin-conjugated beads.
[0058] Figure 39 The binding of biotin-labeled oligonucleotides to streptavidin-coated beads in different buffer systems—MPBS and HK buffer—compares the binding of control beads coated with BSA. The left column, “Negative Control,” shows the fluorescence of the oligonucleotides from the test solution before bead binding. Fluorescence of 'BSA beads’ is shown in the middle column and 'SA beads’ in the right column, respectively, after binding to BSA or streptavidin beads. In both buffer systems, streptavidin beads showed reduced fluorescence compared to the control, indicating that the biotin-labeled oligonucleotides bind well to the streptavidin-coated beads in both buffer systems.
[0059] Figure 40 Functionally conjugated SiO2 nanopores were depicted, with the surface coated with streptavidin on one side and BSA on the other. The x-axis represents time and the y-axis represents current. Dots indicate points of current reversal. A brief overshoot occurs when the current reverses, then the current stabilizes at approximately the same absolute value. The nanopores show a current of ~+3nA at 200mV and ~-3nA at -200mV.
[0060] Figure 41 A representation of the origami DNA structure inserted into a nanopore is shown.
[0061] Figure 42 This illustrates the connection between single-stranded DNA and the streptavidin-coated surface of a neighboring nanopore.
[0062] Figure 43 Experimental results for origami DNA attached to the surface near the nanopores are shown. Currents in both directions are + or - ~2.5 nA, less than the original current of + / - ~3 nA, reflecting the partial resistance of the origami structure. The x-axis represents time (s), the y-axis represents current (nA), and circles indicate voltage switching points.
[0063] Figure 44 The insertion of DNA into the origami paper resulted in a slight decrease in current. When the current was released, the origami paper immediately exited the nanopore. The x-axis represents time (s), the y-axis represents current (nA), and the circles indicate the voltage switching points.
[0064] Figure 45 This illustrates a representation of a DNA strand moving back and forth through a nanopore in a controlled manner when an electric current is applied. On the left, the DNA is present in the pore, so the observed current will be lower than if there were no DNA in the pore. When the current is reversed (on the right), there is no DNA in the pore, so the current will remain unchanged.
[0065] Figure 46 Experimental results confirming this representation are shown. When a positive voltage is applied, the current is ~3 nA, comparable to the current typically observed when the pore is open. When the voltage is reversed, the current is ~-2.5 nA. This is lower than the current typically seen when the pore is open and corresponds to the current typically observed when the pore is blocked by the DNA strand. Several sequential voltage switches show consistent results, indicating that the DNA is configured alternately, as... Figure 45 As shown.
[0066] Figure 47 illustrates different conjugation chemistry methods for attaching DNA to surfaces adjacent to nanopores. Figure 48 The image shows a DNA origami molecule. Detailed Implementation Plan
[0067] The following description of preferred embodiments is merely exemplary in nature and is in no way intended to limit the invention, its application, or its uses.
[0068] As used throughout the text, a range is used as a shorthand to describe each value within that range. Any value within the range may be chosen as the endpoint of the range. Furthermore, all references cited herein are incorporated herein by reference in their entirety. In the event of any conflict between definitions in this disclosure and definitions in cited references, this disclosure shall prevail.
[0069] Unless otherwise stated, all percentages and quantities expressed herein and elsewhere in this specification shall be understood as weight percentages. The quantities given are based on the active weight of the material.
[0070] As used herein, “nanochip” refers to a nanofluidic device comprising multiple chambers containing fluid and optionally channels allowing fluid flow, wherein the critical dimensions of the nanochip, such as the width of the elements separating the chambers from each other, are, for example, a thickness of 1 atom to 10 micrometers, for example, less than 1 micrometer, for example, 0.01–1 micrometer. The flow of material in the nanochip can be modulated by electrodes. For example, when DNA and RNA are negatively charged, they will be attracted to positively charged electrodes. See, for example, Gershow, M et al., Recapsuring and Trapping Single Molecules with a Solid State Nanopore, Nat Nanotechnol. (2007) 2(12): 775–779, incorporated herein by reference. In some cases, fluid flow can also be modulated by gate elements, as well as by flushing, injecting, and / or aspirating fluid into or out of the nanochip. This system enables precise multiplex analysis of nucleic acids (DNA / RNA). In some embodiments, the nanochip may be made of silicon materials, such as silicon dioxide or silicon nitride. Silicon nitride (e.g., Si3N4) is particularly ideal for this purpose because it is chemically relatively inert and provides an effective barrier against water and ion diffusion, even at thicknesses of only a few nanometers. Silica (as used in the examples herein) is also useful because it is a good surface for chemical modification.Alternatively, in some embodiments, the nanochip may be made wholly or partially of a material that can be formed into a sheet as thin as a single molecule (sometimes referred to as a monolayer material), such as graphene, for example, as described in Heerema, SJ, et al., Graphene nanodevices for DNA sequencing, Nature Nanotechnology (2016) 11: 127-136; Garaj S et al., Graphene as subnanometre trans-electrode membrane, Nature (2010) 467(7312), 190-193, the contents of which are incorporated herein by reference, or transition metal dichalcogenides, such as molybdenum disulfide (MoS2), as described in Feng et al., Identification of single nucleotides in MoS2 nanopores, Nat Nanotechnol. (2015) 10(12): 1070-1076, the contents of which are incorporated herein by reference, or boron nitride, as described in Gilbert et al., Fabrication of Atomically Precise Nanopores inHexagonal Boron Nitride, eprint arXiv:1702.01220 (2017).
[0071] In some implementations, the nanochip comprises a monolayer material that is relatively hard and inert, for example, at least as inert and hard as graphene, such as MoS2. The monolayer material can, for example, be used as all or part of a membrane containing nanopores. The nanochip can be partially lined with metal, for example, the walls can be layered (e.g., metal-silicon nitride-metal), and the metal can then be configured to provide controllable electrode pairs near the nanopores, allowing nucleic acids to move back and forth through the nanopores via an electromotive force, and sequencing can also be performed by measuring the potential change as the nucleic acids pass through the nanopores.
[0072] Nanochip nanofluidic devices for sequencing DNA are generally known, for example, as described in Li, J et al., Solid-state nanopore for detecting individual biopolymers, Methods Mol Biol. (2009) 544:81-93; Smeets RM et al., Noise in solid-state nanopores, PNAS (2008) 105(2):417-21; Venta K et al., Differentiation of short, single-stranded DNAhomopolymers in solid-state nanopores, ACS Nano. (2013) 7(5):4629-36; Briggs K et al., Automated fabrication of 2-nm solid-state nanopores for nucleic acid analysis, Small (2014) 10(10):2077-86; and Chen Z., DNA translocation through an array of kinked nanopores, Nat Mater. (2010)9(8):667-75; The full contents of each article are incorporated into this paper by reference, for example, their teachings on the design and fabrication of nanochips containing nanopores.
[0073] As used herein, a “nanopore” is a pore with a diameter less than 1 micrometer, for example, 2-20 nm in diameter, or approximately 2-5 nm. Single-stranded DNA can pass through a 2 nm nanopore; single-stranded or double-stranded DNA can pass through a 4 nm nanopore. Very small nanopores (e.g., 2-5 nm) allow DNA to pass through but not larger proteases, thus allowing for the controlled synthesis of DNA (or other charged polymers). In the case of using larger nanopores (or smaller proteases), the proteases can be conjugated to a matrix that prevents them from passing through the nanopore, for example, conjugated to larger molecules, such as larger proteins, beads, or the surface of the chamber. Different types of nanopores are known. For example, biological nanopores are formed by assembling porins in membranes (e.g., lipid bilayers). For example, α-hemolysin and similar protein pores are naturally present in cell membranes, serving as channels for ions or molecules to enter or exit cells, and these proteins can be reused as nanochannels. Solid-state nanopores are formed from synthetic materials such as silicon nitride or graphene, for example, by configuring pores in synthetic films, such as using feedback-controlled low-energy ion beam engraving (IBS) or high-energy electron beam illumination. Hybrid nanopores can be prepared by embedding pore-forming proteins into synthetic materials. With a metal surface or electrode present at either end or side of the nanopore, a current can be established through the nanopore via an electrolyte medium. The electrodes can be made of any conductive material, such as silver, gold, platinum, copper, titanium dioxide, or silver coated with silver chloride.
[0074] Methods for configuring solid-state nanopores (e.g., silicon nitride films) are known. In one method, a silicon substrate is coated with a film material, such as silicon nitride, and a monolithic structure of the film is produced using photolithography and wet chemical etching to provide a silicon nitride film of the desired size for incorporation into a nanochip, e.g., a nanochip of approximately 25 × 25 micrometers. Holes or cavities with an initial diameter of 0.1 micrometers are punched into the silicon nitride film using a focused ion beam (FIB). Ion beam engraving can configure nanopores by shrinking larger holes, for example, by ion beam-induced lateral mass transfer on the film surface, or by removing film material layer by layer from the flat side of the film containing cavities from opposite sides via ion beam sputtering, resulting in sharp-edged nanopores when finally reaching the cavities. The ion beam exposure is extinguished, and the ion current transported through the pore is adapted to the desired pore size. See, for example, Li, J., et al., Solid-state nanopore for detecting individual biopolymers, Methods MolBiol. (2009) 544:81-93. Alternatively, nanopores can be fabricated using high-energy (200-300 keV) electron beam irradiation in a TEM. Using semiconductor processing techniques, electron beam lithography, reactive ion etching of the SiO2 mask layer, and anisotropic KOH etching of Si, tapered pores of 20 × 20 nm and larger can be fabricated in 40 nm thick films. The electron beam in the TEM is used to shrink the larger 20 nm pores into smaller ones. The TEM allows for real-time observation of the shrinkage process. Using thinner films (e.g., <10 nm thick), nanopores can be drilled in a TEM using a high-energy focused electron beam. Generally, see Storm AJ et al., Fabrication of solid-state nanopores with single-nanometre precision. Nature Materials (2003) 2:537–540; Storm AJ et al., Translocation of double-stranded DNA through a silicon oxide nanopore. Phys. Rev. E (2005)71:051903; Heng JB et al., Sizing DNA Using a Nanometer-Diameter Pore. Biophys. J (2004) 87(4):2905–11; the contents of each are incorporated herein by reference.
[0075] In other embodiments, dielectric breakdown is used to fabricate nanopores using a relatively high voltage potential across the membrane, wherein the voltage is increased until a current is detected, as described, for example, in Kwok et al., “Nanopore Fabrication by Controlled Dielectric Breakdown”, PLOS ONE (2014) 9(3): e92880, the contents of which are incorporated herein by reference.
[0076] Using these techniques, and depending on the exact technique employed, as well as the film thickness and precise composition, the overall shape of nanopores in solid materials (such as silicon nitride) can roughly resemble two funnels, their apexes converging at the narrowest point (i.e., the actual nanopore). This bipyramidal shape facilitates the passage and return of polymers through the nanopore. Imaging techniques, such as atomic force microscopy (AFM) or transmission electron microscopy (TEM), especially TEM, can be used to verify and measure the size, location, and structure of nanofilms, FIB pores or cavities, and ultimately, the nanopores.
[0077] In some implementations, one end of the polymer (e.g., DNA) is bound near the nanopore or to the inner wall of the funnel leading to the nanopore. Since the polymer initially approaches the nanopore by diffusion, and is then driven by gradient, gradient-driven movement is maximized and diffusion movement is minimized, and the speed and efficiency are thus enhanced if one end of the polymer is bound near the nanopore. See, for example, Wanunu M, Electrostatic focusing of unlabeled DNA intonanoscale pores using a salt gradient, Nat Nanotechnol. (2010) 5(2):160-5; Gershow M., Recapturing and trapping single molecules with a solid-state nanopore. Nat Nanotechnol. (2007) 2(12):775-9; Gershow, M., Recapturing and Trapping Single Molecules with a Solid State Nanopore. Nat Nanotechnol.(2007) 2(12): 775–779.
[0078] In one embodiment, one end of a polymer (e.g., DNA) is attached to a bead, and the polymer is driven through a pore. The attachment to the bead prevents the polymer from continuously moving through the nanopores on opposite sides of the separator membrane in adjacent chambers. The current is then turned off, and the polymer (e.g., DNA) attaches to the surface adjacent to the nanopore in the upper chamber on the other side of the separator membrane. For example, in one embodiment, one end of ssDNA is covalently attached to a 50 nm bead, and the other end is biotinylated. Streptavidin binds to the region at the desired connection point in the chamber on the other side of the separator membrane. The DNA is pulled through the nanopore by a potential, and biotin attaches to the streptavidin. Attachment to the bead and / or the surface adjacent to the nanopore can be covalent or a strong non-covalent bond (such as a biotin-streptavidin bond). The bead is then cleaved with an enzyme and washed away. In some embodiments, the single-stranded DNA is cleaved with a restriction enzyme, such as that described in, for example, K. Nishigaki, Type II restriction endonucleases cleave single-stranded DNAs in general. NucleicAcids Res. (1985) 13(16): 5747–5760, which is incorporated herein by reference. In other embodiments, complementary oligonucleotides are provided to generate double-stranded restriction sites, which can then be cleaved with the appropriate restriction enzyme.
[0079] When a polymer passes through a nanopore, the change in potential or current through the nanopore caused by partial blockage of the nanopore can be detected and used to identify the monomer sequence in the polymer, since different monomers can be distinguished by their different sizes and electrostatic potentials.
[0080] As described herein, the use of nanochips containing nanopores in DNA manufacturing methods is not disclosed in the art, but such chips are well known and commercially available for rapid DNA sequencing. For example, the MinION (Oxford Nanopore Technologies, Oxford, UK) is small and can be connected to a laptop computer. The MinION measures the current as single-stranded DNA passes through a protein nanopore at 30 bases per second. The DNA strands in the pore disrupt the ion flow, resulting in a change in current corresponding to nucleotides in the sequence. (Mikheyev, AS, et al. A first look at the Oxford Nanopore MinION sequencer, Mol. Ecol. Resour. (2014) 14, 1097–1102). Although the accuracy of the MinION is poor and requires repeated resequencing, the speed and accuracy of sequencing using the nanochips of this invention can be greatly improved if the DNA being read contains only two easily distinguishable bases, such as A and C.
[0081] In some embodiments, the membrane containing nanopores may have a three-layer structure, with a metal surface on either side of an insulating core material (e.g., a silicon nitride film). In this embodiment, the metal surfaces are configured, for example, by a photolithography apparatus, to provide microcircuits with paired electrodes, one at each end of each nanopore, such that a current can be established between the electrodes to flow through the nanopores and through an electrolyte medium. This current can absorb polymers through the nanopores and, by reversing polarity, can be drawn back. As the polymer passes through the nanopores, the electrodes can measure the potential change across the nanopores to identify the sequence of monomers in the polymer.
[0082] In some embodiments, the polymer sequence is designed to store data. In some embodiments, the data is stored in binary codes (1s and 0s). In some embodiments, each base corresponds to either 1 or 0. In other embodiments, an easily identifiable sequence of two or more bases corresponds to 1, and another easily identifiable sequence of two or more bases corresponds to 0. In other embodiments, the data may be stored in ternary, quaternary, or other codes. In one specific embodiment, the polymer is DNA, such as single-stranded DNA, wherein the DNA contains only two base types and does not contain any bases capable of self-hybridization, for example, wherein the DNA contains adenine and guanine, adenine and cytosine, thymine and guanine, or thymidine and cytosine. In some embodiments, the two bases may be interspersed with one or more additional bases, for example, A and C may contain T to “punctuate” the sequence, for example by indicating breaks in the coding sequence at a frequency that does not cause significant self-hybridization. In other embodiments, for example, where the nucleic acid is double-stranded, some or all of the available bases may be used.
[0083] Nucleotide bases may be natural, or in some embodiments may consist of or include non-natural bases, as described by Malyshev, D et al., “A semi-synthetic organism with an expanded genetic alphabet”, Nature (2014) 509: 385–388, which is incorporated herein by reference.
[0084] In one embodiment, data is stored by adding a single monomer (e.g., a single nucleotide in the case of DNA) to a polymer. In one embodiment, the polymer is DNA and the monomers are adenine (A) and cytosine (C) residues. A and C residues are advantageous because (i) A and C have a large size difference, thus promoting differentiation through the nanopore; (ii) A and C do not pair with each other, thus not forming significant secondary structures that would complicate the interpretation of the nanopore signal; and (iii) G' residues are less preferred for the same reason, as they are known to form guanine tetraduplexes. Nucleotides are added via a terminal transferase (or polynucleotide phosphorylase), but the nucleotides are 3'-blocked, so that only a single nucleotide is added at a time. This block is removed before adding the next nucleotide.
[0085] In some embodiments, the DNA remains within the nanochip. In other embodiments, it is removed and optionally converted to double-stranded DNA and / or optionally converted to a crystalline form, for example, to improve long-term stability. In yet another embodiment, the DNA can be amplified and the amplified DNA removed for long-term storage, while the original template DNA, such as DNA bound to the chamber walls of the nanochip, can remain within the nanochip, where it can be read and / or used as a template to create additional DNA.
[0086] In some embodiments, DNA or other polymers are anchored to a surface near the nanopore during synthesis. For example, in one embodiment, each single-stranded DNA molecule is attached at its 5' end to a surface near the nanopore, wherein the current at each nanopore can be independently adjusted via an electrode of that nanopore, allowing the 3' end of the DNA molecule to be pulled forward from a reservoir chamber through the nanopore into a flow chamber containing a stream of 3'-protected dNTPs and polymerase or terminal transferase to add 3'-protected dNTPs, or to remain in the reservoir chamber where the nanopore excludes the enzyme, thus preventing the addition of dNTPs. See, for example, Figure 12-16 as well as Figure 18 and Figure 19 The description is as follows. In other embodiments, topoisomerases are used to construct single-stranded DNA by adding to the 5' end (attaching the 3' end), as described more fully below. By controlling whether each DNA molecule participates in each cycle, the sequence of each DNA molecule can be precisely controlled, for example, as follows:
[0087]
[0088]
[0089] dATP protected by flow A=3'
[0090] dCTP protected by C=3'
[0091] In this schematic diagram, nanopores 1 and 2 are associated with different DNA strands, and their positions (within or outside the flow chamber) are individually controllable. DNA can be deprotected by a specific enzyme in the reservoir or by altering the flow in the flow chamber to provide deprotection via enzymatic, chemical, photocatalytic, or other means. In one embodiment, the deprotecting agent flows between cycles of flow A and flow C, for example, when the flow chamber is washed with buffer, such that the deprotecting agent does not deprotect the nucleotide building blocks. In other embodiments, the deprotecting agent is too large to pass through the nanopores into the flow chamber.
[0092] The final result of the above embodiments is that A and C are added to the DNA at nanopore 1, and C and C are added to the DNA at nanopore 2.
[0093] In another embodiment, the chamber configuration is similar, but the double-stranded DNA is anchored on the surface near the nanopore, and two or more types of oligonucleotide fragments (each corresponding to a binary code) are added sequentially, for example, using site-specific recombinases, i.e., enzymes that spontaneously recognize and cleave at least one strand of the double-stranded nucleic acid within a sequence segment called a site-specific recombinant sequence, such as oligonucleotides loaded with topoisomerase as described below.
[0094] In some implementations, it may be necessary to keep the charged polymer (e.g., DNA) in a condensed state after synthesis. There are several reasons for this:
[0095] • Polymers should be more stable in this form.
[0096] • Condensed polymers can reduce crowding, allowing the use of longer polymers in smaller volumes.
[0097] • Ordered condensation can reduce the likelihood of polymers forming knots or entanglements.
[0098] • If any chambers are interconnected, it will help prevent the polymer from becoming too long to pass through a hole that is different from what was assumed when an electric current was applied.
[0099] • Condensation helps the polymer move away from the electrode, and electrochemistry can damage the polymer.
[0100] Human cells are approximately 10 micrometers in size but contain 8 billion base pairs of DNA. Stretching it out would result in a length exceeding one meter. The DNA is contained within the cell because it is wrapped around histones. In some embodiments, histones or similar proteins provide similar functionality in the nanochips of this invention. In some embodiments, the inner surface of the nanochip is slightly positively charged, causing charged polymers (e.g., DNA) to tend to weakly adhere to them.
[0101] In some implementations, charged polymers, such as single-stranded or double-stranded DNA, are bound to the surface near the nanopore. This can be achieved in various ways. Typically, the polymer is positioned in the nanopore by attaching it to a relatively large volumetric structure (e.g., beads, protein or DNA origami structures (described below) that are too large in diameter to pass through the nanopore, e.g., >10 nm, e.g., about 20-50 nm), by using an electric current to pull the charged polymer through the nanopore, by anchoring the polymer end away from the large volumetric structure to the surface adjacent to the nanopore, and by cleaving the large volumetric structure.
[0102] The step of anchoring the polymer ends away from the bulk structure to the surface adjacent to the nanopores can be accomplished in various ways. In one embodiment, the polymer is single-stranded DNA, and a pre-linked DNA strand (approximately 50 bp) is present, which is complementary to a portion of the single-stranded DNA, such that the single-stranded DNA and the pre-linked DNA strand can be linked by base pairing. If the pairing is strong enough, it is sufficient to maintain DNA anchoring even during operation. An advantage of this ligation method is that it allows the DNA to be removed from the nanopore chip if long-term storage of DNA is required. Alternatively, conjugation chemistry, such as streptavidin-biotin conjugation as described in Example 1 below, or “click” chemistry, can be used to covalently link the strands to the surface (see Kolb et al., Angew. Chem. Int. Ed. (2001) 40: 2004-2021, incorporated herein by reference), and / or enzymatic attachment can be used, for example, by pre-linking oligonucleotides covalently to the distal surface and then linking them using a DNA ligase.
[0103] Once the distal end of the chain attaches to the surface of a nearby nanopore, the bulk structure can be cleaved, for example, using an endonuclease that cleaves at a restriction enzyme site near the bulk structure.
[0104] Large-volume structures can be beads, large-volume molecules such as proteins that reversibly bind to DNA strands, or DNA origami structures. DNA origami involves using base pairing to create three-dimensional DNA structures. DNA origami techniques are generally described in Bell et al., Nano Lett. (2012) 12: 512-517, which are incorporated herein by reference. For example, in this invention, DNA origami can be used to attach a single DNA molecule to a surface adjacent to a nanopore. In one embodiment, the structure is a “honeycomb cube,” for example, about 20 nm on each side. This prevents this portion of DNA from passing through the nanopore (as in the attached paper). A long chain of DNA (single-stranded or double-stranded) is present on the origami structure. The DNA strand passes through the nanopore until the origami cube encounters the nanopore and prevents further progress. The current is then turned off, and the strand is attached to the surface adjacent to the nanopore.
[0105] In another embodiment, a charged polymer (e.g., DNA) with an origami structure is located in the middle chamber of a three-chamber configuration. The origami prevents the DNA from completely entering the other two chambers (or one of the other chambers in a two-chamber example). Therefore, in this example, the polymer does not need to be anchored to the surface. This reduces the risk of polymer tangling and avoids the need for the step of binding one end of the polymer to the surface and cutting off a large volume of the other end. The volume of the chamber with the origami should be kept as small as possible so that the polymer remains relatively close to the pore, which will help ensure its rapid displacement when an electric current is applied. It should be noted that while the middle chamber containing the origami portion of the polymer cannot be interconnected with other middle chambers (or different polymers will mix), the other chambers (or the chamber group in a three-chamber example) can be interconnected. These other chambers can have a larger volume if desired, because when DNA moves into that chamber, the polymer will necessarily be close to the pore (some of which will actually be in the pore).
[0106] In some implementations, the device includes three inline chambers, wherein the addition chambers are adjacent to each other to allow flow and have a common electrode, while the "deprotected" chambers are fluidly isolated except for the flow through the nanopores and have a unique electrode.
[0107] In other embodiments, DNA or other charged polymers are not anchored but can move between the synthesis chamber and the deprotection chamber under the control of the chamber electrodes, while the polymerase and deprotectant are restricted to movement between the chambers. This is because they are too large to pass through nanopores connecting the chambers and / or fixed to the surfaces within the chambers. See, for example, Figure 1-9 and Figure 16-17 .
[0108] The current required to move a charged polymer through a nanopore depends on factors such as the properties of the polymer, the size of the nanopore, the material of the membrane containing the nanopore, and the salt concentration, and will therefore be optimized for the specific system as needed. In the case of DNA used in the embodiments herein, examples of voltage and current may be, for example, 50-500 mV, typically 100-200 mV and 1-10 nA, for example, about 4 nA, with a salt concentration in the range of about 100 mM to 1 M.
[0109] The movement of charged polymers (e.g., DNA) through nanopores is typically very rapid, for example, 1 to 5 μs per base, and thus approximately one million bases per second (1 MHz if frequency-based nomenclature is used), which presents a challenge in obtaining accurate readings distinct from the noise in the system. Using current methods, (i) nucleotides repeated in the sequence, for example, approximately 100 consecutive times, are needed to produce measurable characteristic changes, or (ii) protein pores, such as α-hemolysin (αHL) or Mycobacterium smegmatis porin (MspA), are used, which provide relatively long pores that allow for multiple reads as bases move through the polymer and, in some cases, can be adapted to provide controlled DNA feed one base at a time, while in others, exonucleases are used to cleave the DNA as each base passes through. Various methods are possible, for example,
[0110] • Slow down the polymer speed, from about 1 MHz to about 100-200 Hz, for example by using a medium containing an electrorheological fluid, which becomes more viscous when a voltage is applied, thereby slowing down the polymer speed through nanopores or plasma fluid systems, where the viscosity of the medium can be light-controlled; or molecular motors or ratchet systems.
[0111] • Providing sequences in polymers, for example in single-stranded DNA, will form large secondary structures, such as “hairpin,” “hammer,” or “dumbbell” configurations, which must be linearized to fit through nanopores, thereby reducing information density and providing signals with longer durations;
[0112] • Provides multiple reads of the same sequence, for example, by using fast alternating current to allow multiple reads of the same sequence frame and combining short bursts of DC to pull the molecule to the next sequence frame, by reading the entire sequence multiple times, or by reading multiple identical sequences in parallel, in each case calibrating the reads to provide a common read of the amplified signal;
[0113] • Measure the impedance change in a high-frequency signal caused by capacitance changes as monomers (e.g., nucleotides) pass through a nanopore, rather than directly measuring changes in current or resistance;
[0114] • Enhance the difference in current, resistance, or capacitance between different bases, for example, by using non-natural bases with large size differences or otherwise modifying them to produce different signals, or by forming larger secondary structures within DNA, such as “hairpin,” “hammer,” or “dumbbell” configurations, which can provide enhanced signals due to their larger size;
[0115] • Optical readout systems are used, such as integrated optical antennas adjacent to the nanopores, which serve as optical transducers (or optical signal enhancers) to supplement or replace standard ion current measurements, for example, as described in Nam et al., “Graphene Nanopore with a Self-Integrated Optical Antenna”, Nano Lett. (2014) 14: 5584-5589, the contents of which are incorporated herein by reference. In some embodiments, monomers, such as DNA nucleotides, are labeled with fluorescent dyes such that each different monomer fluoresces at the label intensity as it passes through the nanopore and its optical antenna junction. In some embodiments, when the polymer passes through the nanopore at high speed, the solid nanopore strips the fluorescent label, resulting in a series of detectable bursts of photons. As described in McNally et al., “Optical recognition of converted DNA nucleotides for single molecule DNA sequencing using nanopore arrays”, Nano Lett. (2010) 10(6): 2237-2244, and Meller A., “Towards Optical DNA Sequencing Using Nanopore Arrays”, J Biomol Tech (2011) 22(Suppl): S8–S9, the contents of which are incorporated herein by reference.
[0116] In one embodiment, the charged polymer is a nucleic acid, such as single-stranded DNA, where the sequence provides secondary structure. Bell et al., Nat Nanotechnol. (2016) 11(7): 645-51 (incorporated herein by reference), describe the use of relatively short dumbbell-shaped sequences detectable in the form of solid nanopores to label antigens in immunoassays. The nanopores used by Bell et al. are relatively large, so the entire dumbbell structure can pass through the pore, but with nanopores smaller than the diameter of the dumbbell construction, the DNA will be “decompressed” and become linearized. More complex constructions can be used, for example, where each bit corresponds to a sequence similar to tRNA (see, for example, Henley et al., Nano Lett. (2016) 16: 138-144, incorporated herein by reference). Thus, the present invention provides a charged polymer, such as single-stranded DNA, having at least two types of secondary structures, where the secondary structures encode data (e.g., binary data, where one secondary structure type is 1 and the second is 0). In other embodiments, the secondary structures are used to slow the DNA through the nanopore or to provide breaks in the sequence to facilitate sequence reading.
[0117] In another embodiment, the invention utilizes a DNA molecule comprising a series of at least two different DNA motifs, wherein each motif specifically binds to a particular ligand, such as a gene regulatory protein of double-stranded DNA or tRNA of single-stranded DNA, wherein at least two different DNA motifs encode information, for example in binary code, wherein one motif is 1 and the second is 0, for example, wherein the ligand enhances the signal differences (e.g., changes in current or capacitance) as the DNA passes through a nanopore.
[0118] As mentioned above, when different monomers pass through a nanopore, they primarily affect the current passing through the nanopore by physically sealing it and altering the conductivity across it. In existing nanopore systems, this change in current is measured directly. The problem with current readout systems is the presence of considerable noise within the system, and in the case of DNA, for example, when measuring current fluctuations as different nucleotide units pass through the nanopore, relatively long integration times, on the order of hundredths of a second, are required to accurately detect differences between monomers, such as between different bases. Recently, it has been shown that changes in impedance and capacitance can be used to study cellular and biological systems, although complex interactions with salts and biomolecules may occur. For example, Laborde et al., Nat Nano. (2015) 10(9):791-5 (incorporated hereby by reference), demonstrated that high-frequency impedance spectroscopy can be used to detect minute changes in capacitance under physiological saline conditions and to image microparticles and living cells beyond the Debye limit.
[0119] Therefore, in one embodiment of the invention, we measure capacitance changes rather than directly measuring current changes, for example, wherein the sequence of charged polymers is identified by measuring the phase transition of a radio frequency signal triggered by capacitance changes as monomers (e.g., nucleotides) pass through nanopores.
[0120] Simply put, capacitance exists in any circuit where there is a gap between two electrical conductors. While the current changes directly with the capacitance, it does not change simultaneously with the capacitance. For example, if we plot the current and voltage over time in a capacitive circuit with alternating current, we will see that although both the current and voltage form sinusoidal waves, the waves are out of phase. As the current changes, the capacitance changes, which is reflected in the change in the signal phase. Radio frequency alternating current provides a signal with a fixed frequency and amplitude, while the phase of the signal will change with the capacitance of the circuit. In this system, we use pulsed direct current instead of alternating current (i.e., the voltage alternates between two values, but the voltage does not cross the "zero" line, thus maintaining polarity and one electrode holding a positive voltage while the other holds a negative voltage), allowing charged polymers to be attracted through nanopores (in the case of DNA, towards the positive electrode). When there is nothing in the nanopore, the capacitance has a value that changes as different monomers of the polymer pass through the nanopore. Suitable frequency ranges are in the radio frequency range, for example, 1 MHz to 1 GHz, such as 50-200 MHz, or approximately 100 MHz, and are lower than higher microwave frequencies that may cause significant dielectric heating of the medium. To reduce the possibility of interference, different frequencies can be applied to different nanopores so that multiple nanopores can be measured simultaneously using a single RF input line.
[0121] Measuring impedance changes at high frequencies (due to, for example, changes in capacitance) increases the signal-to-noise ratio (SNR) available over a given time span because it reduces the effects of 1 / f noise, or the "pink" noise inherent in electronic measurement circuits. Using a high-frequency signal enhances the SNR because numerous measurements are performed over a given time span, providing a more stable signal that can be easily distinguished from impedance changes caused by environmental or device variations and fluctuations.
[0122] Applying these principles to the present invention, in one embodiment, the present invention provides a method for measuring impedance changes in a high-frequency signal caused by capacitance changes as monomers (e.g., nucleotides) pass through a nanopore, for example, a method for reading the monomer sequence of a charged polymer containing at least two different types of monomers (e.g., DNA molecules), comprising applying a pulsed direct current radio frequency across the nanopore, for example, at a frequency of, for example, 1 MHz to 1 GHz, such as 50-200 MHz, such as about 100 MHz, wherein the pulsed direct current attracts the charged polymer through the nanopore, and the monomer sequence is read by measuring the capacitance change across the nanopore as the charged polymer passes through the nanopore.
[0123] In some embodiments, the present invention provides a nanochip for sequencing charged polymers (e.g., DNA) comprising at least two different monomers. The nanochip includes at least first and second reaction chambers, each containing an electrolyte, and is separated by a membrane comprising one or more nanopores. A pair of electrodes connected in a circuit (e.g., in the form of opposing plates) are disposed on either side of the membrane comprising the one or more nanopores, the electrodes spaced 1-30 micrometers apart, for example, about 10 micrometers, such that when, for example, a 1 MHz to 1 GHz radio frequency pulsed DC current is applied to the electrodes, the gap between the electrodes has capacitance to attract the charged polymer through the nanopores, for example, from one chamber to the next, and such that the phase of the pulsed direct radio frequency current changes with the capacitance of the charged polymer passing through the nanopores, thereby allowing the detection of the monomer sequence of the charged polymer. In some embodiments, the nanochip includes multiple sets of reaction chambers, wherein reaction chambers within a set are separated by a membrane having one or more nanopores, and this set of reaction chambers is separated by a shielding layer to minimize electrical interference between sets of reaction chambers and / or separate multiple linear polymers and allow them to be sequenced in parallel.
[0124] For example, in one embodiment, electrodes form the top and bottom plates of a capacitor embedded in a resonant circuit, and the change in capacitance is measured as DNA passes through a hole between the plates.
[0125] In some embodiments, the nanochip also contains reagents for synthesizing polymers such as DNA, for example, according to any of the following Nanochip 1, etc.
[0126] Therefore, in one embodiment, the present invention provides a method (method 1) for synthesizing charged polymers [e.g., nucleic acids (e.g., DNA or RNA)], said polymer comprising at least two different monomers in a nanochip, said nanochip comprising
[0127] One or more addition chambers containing reagents for adding one or more monomers (e.g., nucleotides) or oligomers (e.g., oligonucleotides) to a charged polymer in a buffer solution in an end-protected form, such that only a single monomer or oligomer can be added in a single reaction cycle; and
[0128] One or more storage chambers containing buffer solutions but not all the reagents required for the addition of one or more monomers or oligomers.
[0129] The chambers are separated by one or more membranes containing one or more nanopores, and
[0130] Charged polymers can pass through nanopores, but at least one reagent used to add one or more monomers or oligomers cannot.
[0131] The method includes
[0132] a) A charged polymer having a first end and a second end is moved into the addition chamber by electroattraction, thereby adding a monomer or oligomer to the first end in a closed form.
[0133] b) The first end of the charged polymer is moved into the reservoir in a closed manner using the added monomer or oligomer.
[0134] c) Deblocking the added monomer or oligomer, and
[0135] d) Repeat step ac until the desired polymer sequence is obtained, wherein the monomers or oligomers added in step a) are the same or different.
[0136] For example, the present invention provides
[0137] 1.1. Method 1, wherein the polymer is a nucleic acid, for example, wherein the polymer is DNA or RNA, for example, wherein it is DNA, such as dsDNA or ssDNA.
[0138] 1.2. Any of the foregoing methods, wherein the second end of the polymer, for example, a nucleic acid, is protected or bound to a matrix adjacent to the nanopore.
[0139] 1.3. Any of the foregoing methods, wherein electroattraction is provided by applying a potential between electrodes in each chamber, wherein the polarity and current flow between the electrodes can be controlled, for example, such that nucleic acids are attracted to the positive electrode.
[0140] 1.4. Any of the foregoing methods, wherein the polymer is a nucleic acid and
[0141] (i) The first end of the nucleic acid is a 3' end, the nucleotide is added in the 5' to 3' direction and catalyzed by a polymerase, for example, wherein the polymerase is prevented (e.g., due to its size or due to the matrix bound in the first chamber) from passing through a nanopore, the nucleotide is 3' protected upon addition, and after the 3'-protected nucleotide is added to the 3' end of the nucleic acid, for example, the 3'-protecting group on the nucleic acid is removed in a storage chamber; or
[0142] (ii) The first end of the nucleic acid is the 5' end, the nucleotide is added in the 3' to 5' direction, the nucleotide is 5' protected during addition, and after the 5' protected nucleotide is added to the 5' end of the nucleic acid, the 5' protected group is removed, for example, in the second chamber; (for example, where the phosphate ester on the 5' protected nucleotide is coupled to a large group of nucleoside phosphoramidite that cannot pass through the nanopore via the 5'-protecting group, thereby after coupling with the nucleic acid, the unreacted nucleotide is washed away, the large 5'-protecting group is cleaved off the nucleic acid, washed away, and the 5' end of the nucleic acid is moved into the storage chamber;
[0143] The addition of nucleotides to nucleic acids is controlled by moving one or more addition chambers into and out of the first end of the nucleic acid, and the cycle continues until the desired sequence is obtained.
[0144] 1.5. Any of the foregoing methods, wherein the monomer or oligomer sequence in the polymer synthesized thereby [e.g., the nucleotide sequence in a nucleic acid] corresponds to a binary code.
[0145] 1.6. Any of the foregoing methods, wherein the polymer synthesized therefrom is single-stranded DNA.
[0146] 1.7. Any of the foregoing methods in which the sequence of the polymer [e.g., nucleic acid] is checked during or during the process of synthesis by sequencing the monomers or oligomers [e.g., nucleotide bases] as they pass through a nanopore to identify errors in the sequencing.
[0147] 1.8. Any of the foregoing methods, wherein the polymer synthesized therefrom is a single-stranded DNA, wherein at least 95%, for example at least 99%, of the sequence, for example, substantially all bases are selected from two bases that do not hybridize with other bases in the strand, for example, bases selected from adenine and cytosine.
[0148] 1.9. Any of the foregoing methods in which multiple polymers [e.g., oligonucleotides] are synthesized independently in parallel, such that they are obtained by controlling the presence of polymers [oligonucleotides] with different sequences in one or more addition chambers or one or more reserve chambers, respectively.
[0149] 1.10. Any of the foregoing methods, wherein there are at least two addition chambers containing reagents suitable for adding different monomers or oligomers, such as different nucleotides, for example, wherein there are one or more addition chambers containing reagents suitable for adding a first monomer or oligomer, and one or more addition chambers containing reagents suitable for adding a second different monomer or oligomer, for example, wherein there are one or more addition chambers containing reagents suitable for adding adenine nucleotides and one or more addition chambers containing reagents suitable for adding cytosine nucleotides.
[0150] 1.11. Any of the foregoing methods, wherein at least one feeding chamber is a flow chamber providing a flow cycle comprising (i) supplying the flow chamber with a reagent suitable for adding a first monomer or oligomer, (ii) rinsing, (iii) supplying the flow chamber with a reagent suitable for adding a second different monomer or oligomer, and (iv) rinsing, and repeating the cycle until the synthesis is complete, wherein the sequence of monomers or oligomers in the polymer is controlled by introducing or removing a first end of the polymer from the flow chamber during step (i) or (iii) in each cycle;
[0151] 1.12. Any of the foregoing methods, wherein the polymer is DNA and at least one addition chamber is a flow chamber, provides a flow cycle comprising (i) providing the flow chamber with a reagent suitable for adding a first type of nucleotide, (ii) rinsing, (iii) providing the flow chamber with a reagent suitable for adding a second type of nucleotide, and (iv) rinsing, and repeating the cycle until synthesis is complete, wherein the sequence is controlled by controlling the presence or absence of a first end (e.g., the 3' end) of the DNA in the flow chamber.
[0152] 1.13. Any of the foregoing methods, wherein the polymer is DNA and at least one addition chamber is a flow chamber, provides a flow cycle comprising (i) providing the flow chamber with a reagent suitable for adding a first type of nucleotide, (ii) rinsing, (iii) providing the flow chamber with a reagent suitable for adding a second type of nucleotide, and (iv) rinsing, (i) providing the flow chamber with a reagent suitable for adding a third type of nucleotide, (ii) rinsing, (iii) providing the flow chamber with a reagent suitable for adding a fourth type of nucleotide, and (iv) rinsing, and repeating the cycle until synthesis is complete, wherein when a reagent suitable for adding a different type of nucleotide is present, the sequence is controlled by controlling the presence or absence of the first end (e.g., the 3' end) of the DNA in the flow chamber.
[0153] 1.14. Any of the foregoing methods, wherein the polymer is DNA and the nanochip comprises two addition chambers as flow chambers, (a) a first flow chamber providing flow cycles comprising (i) providing the first flow chamber with a reagent suitable for adding a first type of nucleotide, (ii) rinsing, (iii) providing the first flow chamber with a reagent suitable for adding a second different type of nucleotide, and (iv) rinsing, and repeating the cycle until synthesis is complete, and (b) a second flow chamber providing flow cycles comprising (i) providing the second flow chamber with a reagent suitable for adding a third type of nucleotide, (ii) rinsing, (iii) providing the second flow chamber with a reagent suitable for adding a fourth different type of nucleotide, and (iv) rinsing, and repeating the cycle until synthesis is complete, wherein the nucleotides are selected from dATP, dTTP, dCTP and dGTP, and wherein the sequence is controlled by directing the first end (e.g., the 3' end) of the DNA to provide the next desired nucleotide into the flow chamber.
[0154] 1.15. Any of the foregoing methods, wherein the polymer is DNA, and the nanopore chip includes one or more addition chambers for adding dATP, one or more addition chambers for adding dTTP, one or more addition chambers for adding dCTP, and one or more addition chambers for adding dGTP.
[0155] 1.16. Any of the foregoing methods, wherein the synthesized polymers [e.g., nucleic acids] are each bound to the surface near the nanopore via their second ends.
[0156] 1.17. Any of the foregoing methods, wherein the sequence of the polymer [e.g., nucleic acid] is determined after each cycle by detecting changes in potential, current, resistance, capacitance and / or impedance as the polymer passes through a nanopore.
[0157] 1.18. Any of the foregoing methods wherein the polymer is a nucleic acid, and the synthesis of the nucleic acid is carried out in a buffer solution, such as a solution containing a buffer solution of pH 7-8.5, for example, a buffer solution containing tris(hydroxymethyl)aminomethane (Tris), a suitable acid and optional chelating agent, such as ethylenediaminetetraacetic acid (EDTA), for example, a TAE buffer containing a mixture of Tris base, acetic acid and EDTA, or a TBE buffer containing a mixture of Tris base, boric acid and EDTA; for example, a solution containing 10 mM Tris pH 8, 1 mM EDTA, 150 mM KCl, or for example, 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, pH 7.9 @ 25°C.
[0158] 1.19. Any of the foregoing methods, wherein the polymer is single-stranded DNA, further includes converting the synthesized single-stranded DNA into double-stranded DNA.
[0159] 1.20. Any of the foregoing methods also includes removing the polymer (e.g., nucleic acid) from the nanochip after the polymer synthesis is complete.
[0160] 1.21. Any of the foregoing methods, wherein the polymer is a nucleic acid, further includes the amplification and recovery of copies of the synthesized nucleic acid using suitable primers and polymerases (e.g., Phi29).
[0161] 1.22. Any of the foregoing methods, wherein the polymer is a nucleic acid, further includes cleaving the synthesized nucleic acid with a restriction enzyme and removing the nucleic acid from the nanochip.
[0162] 1.23. Any of the foregoing methods, wherein the polymer is a nucleic acid, also includes the amplification of the nucleic acid synthesized therefrom.
[0163] 1.24. Any of the foregoing methods also includes removing the polymer [e.g., nucleic acid] from the nanochip and crystallizing the polymer.
[0164] 1.25. Any of the foregoing methods, wherein the polymer is a nucleic acid, further includes stabilizing the nucleic acid, for example by drying the solution containing the nucleic acid together with one or more buffers (e.g., borate buffer), an antioxidant, a humectant, such as a polyol, and optionally a chelating agent, such as the chelating agent described in US 8283165 B2 (which is incorporated herein by reference); or by forming a matrix between the nucleic acid and a polymer, such as a poly(ethylene glycol)-poly(1-lysine) (PEG-PLL) AB block copolymer; or by adding a complementary nucleic acid strand or a protein that binds to DNA.
[0165] 1.26. Any of the above methods, including:
[0166] (i) In the presence of a polymerase, a nucleic acid is reacted with a 3' protected nucleotide in an addition chamber, the polymerase catalyzing the addition of the 3' protected nucleotide to the 3' end of the nucleic acid;
[0167] (ii) The at least 3' end of the 3' protected nucleic acid thus obtained is drawn from the addition chamber through at least one nanopore into the storage chamber, wherein the polymerase is blocked (e.g., due to its size or due to being bound to the matrix in the first chamber) and cannot pass through the nanopore;
[0168] (iii) Deprotecting 3'-protected nucleic acids, for example, chemically or enzymatically; and
[0169] (iv) If additional 3'-protected dNTPs are required to be added to the oligonucleotide, then the 3' end of the oligonucleotide is aspirated into the same or a different addition chamber to repeat steps (i)-(iii), or if not, the 3' end of the nucleic acid is allowed to remain in the reserve chamber until further cycles in which the desired 3'-protected dNTPs are provided to the addition chamber; and
[0170] (v) Repeat steps (i)-(iv) until the desired nucleic acid sequence is obtained.
[0171] 1.27. Any of the foregoing methods, wherein the polymer is a single-stranded DNA nucleic acid (ssDNA), and one or more nanopores have a diameter that allows ssDNA to pass through but not double-stranded DNA (dsDNA), for example, a diameter of about 2 nm.
[0172] 1.28. Any of the foregoing methods, wherein the monomer is a 3'-protected nucleotide, such as a deoxyribonucleotide triphosphate (dNTP), selected from deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), deoxythymidine triphosphate (dTTP), such as dATP or dCTP.
[0173] 1.29. Any of the foregoing methods in which the polymer is a nucleic acid and the addition of a nucleotide to the nucleic acid is catalyzed by a polymerase, such as a template-independent polymerase, such as a terminal deoxynucleotidyl transferase (TdT), or a polynucleotide phosphorylase, such as in which the polymerase catalyzes the incorporation of a deoxynucleotide at the 3'-hydroxy end of DNA.
[0174] 1.30. Any of the foregoing methods, wherein the membrane contains a plurality of nanopores and a plurality of polymers, each polymer being bound to a surface near the nanopores, such as a plurality of nucleic acids, each nucleic acid being bound to a surface near the nanopores via its 5' end.
[0175] 1.31. Any of the foregoing methods, wherein the plurality of polymers, each bound to the surface near the nanopore, such as the plurality of nucleic acids, each bound to the surface near the nanopore at the 5' end, are synthesized independently, wherein each nanopore has an associated pair of electrodes, wherein one electrode of the pair is located near one end of the nanopore and the other electrode is located near the other end of the nanopore, such that each polymer can move independently between the first and second chambers by means of a current provided by the pair of electrodes.
[0176] 1.32. Any of the foregoing methods, wherein the polymer is a 3' protected nucleic acid that is bound at its 5' end to a surface near the nanopore, and the 3' end of the 3' protected nucleic acid is attracted through the nanopore by using electricity, for example, by using electricity applied from an electrode in an adjacent chamber.
[0177] 1.33. Method 1.20, wherein the new 3'-protected dNTP is the same as or different from the first 3'-protected dNTP.
[0178] 1.34. Method 1.20, wherein the 3'-protected dNTP used in step (i) of the cycle alternates with 3'-protected dATP and 3'-protected dCTP in each cycle.
[0179] 1.35. Any of the foregoing methods, wherein the polymer is a nucleic acid and the deprotection of the nucleic acid is carried out by an enzyme that removes the 3'-protecting group from the ssDNA rather than from the 3'-protected dNTP.
[0180] For example, the present invention provides a method for synthesizing nucleic acids in a nanochip, comprising at least a first chamber and a second chamber separated by a membrane containing at least one nanopore, the synthesis being carried out in a buffer solution by cycling a nucleotide to the first end of a nucleic acid having a first end and a second end, wherein the first end of the nucleic acid is moved by electro-attraction between one or more addition chambers (containing reagents capable of adding nucleotides) and one or more reserve chambers (not containing reagents necessary for adding nucleotides), the chambers being separated by one or more membranes, each membrane containing one or more nanopores, wherein the nanopores are large enough to allow the nucleic acid to pass through but are also too small to allow the passage of at least one reagent necessary for adding nucleotides, for example, wherein the method corresponds to any of Method 1, etc.
[0181] In some implementations, the sequence of the polymer corresponds to binary code, for example, where the polymer is a nucleic acid and the sequence corresponds to binary code, where each bit (0 or 1) is represented by a base, such as A or C.
[0182] In some implementations, the polymer is DNA.
[0183] In some other embodiments, each bit is represented by a short sequence monomer instead of a single monomer. For example, in one such embodiment, DNA blocks are synthesized, where each block generates a unique signal through a nanopore and corresponds to either 0 or 1. This embodiment has certain advantages because single nucleotides are more difficult to detect in nanopores, especially solid nanopores, so using blocks is less prone to read errors, although the information density in the polymer is correspondingly reduced.
[0184] For example, site-specific recombinases, which are enzymes that spontaneously recognize and cleave at least one strand of a double-stranded nucleic acid within a sequence segment called a site-specific recombinant sequence, can be used to add a block of (double-stranded) nucleotides. In one such embodiment, the site-specific recombinase is a topoisomerase used to ligate topologically conjugated dsDNA oligonucleotide blocks to the sequence. These oligonucleotides do not themselves possess a structure compatible with further ligation before being cleaved by a restriction enzyme. Vaccine virus topoisomerase I specifically recognizes the DNA sequence 5'-(C / T)CCTT-3'. The topoisomerase binds to the double-stranded DNA and cleaves it at the 5'-(C / T)CCTT-3' cleavage site. It should be noted that the cleavage is incomplete because the topoisomerase only cleaves the DNA on one strand (although a nearby cleavage on the other strand does result in a double-strand break), and when it cleaves, the topoisomerase is covalently attached to the 3' phosphate of the 3' nucleotide. The enzyme then remains covalently bound to the 3' end of the DNA and can re-link the covalently bound strand at the same bond as the initially cut (as occurs during DNA relaxation), or it can re-link into a heterologous recipient DNA with a compatible overhang, creating a recombinant molecule. In this embodiment, we generate dsDNA donor oligonucleotides (e.g., containing one of at least two different sequences, one for '0' and another for '1'), flanked by a topoisomerase recombination site and a restriction site that generates a topoisomerase linker site. The cassettes are topologically topotropic; that is, they are covalently bound to the topoisomerase, which binds them to the topoisomerase linker site on the recipient oligonucleotide. When the growing DNA strand of the recipient is cut with a restriction enzyme, it becomes capable of linking to the topologically topotropic cassette. Therefore, it is only necessary to continuously cycle the growing DNA from the restriction enzyme to the topologically topotropic cassette, adding another donor oligonucleotide with each cycle. The relevant methods for cloning have been described, see, for example, Shuman S., Novel approach to molecular cloning and polynucleotide synthesis using vaccinia DNA topoisomerase. J Biol Chem. (1994); 269(51):32678-84, the contents of which are incorporated herein by reference.
[0185] A similar strategy can be used to add a single base. In the presence of suitable single-stranded, “deprotected” “recipient” DNA, topologically bound DNA is enzymatically and covalently linked (“added”) to the receptor via a topoisomerase, which removes the DNA during this process. An IIS-type restriction enzyme can then cleave all the added DNA except for the single base (the base being “added”). This deprotection-addition process can be repeated to add additional bases (positions). As demonstrated in the examples herein, it is feasible to add a single nucleotide to the 5’ end of a target single-stranded DNA using a combination of Topo / TypeIIS restriction enzymes. Using a TypeIIS restriction enzyme allows for cleavage at a location different from the recognition sequence (other TypeIIS restriction enzymes are available at https: / / www.neb.com / tools-and-resources / selectioncharts / type-iis-restriction-enzymes). The use of inosine in this system (which acts as a “universal base” and pairs with any other base) allows the reaction to occur without any specific sequence requirements in the target DNA. The nucleotide added to the single-stranded target DNA is identified as a 3' nucleotide conjugated by vaccinia topoisomerase via a 3' phosphate group. Since the recognition sequence for vaccinia topoisomerase is (C / T)CCTT, we use this system to add a 'T' to the target DNA. An associated topoisomerase SVF exists, which can use the recognition sequence CCCTG (https: / / www.ncbi.nlm.nih.gov / pubmed / 8661446). Therefore, SVF can be used to add a 'G' instead of a 'T'. Paired with vaccinia topoisomerase, binary data can be encoded using both T and G.
[0186] In another method of single-base addition, 5'-phosphate provides a blocking group to provide single-base addition in the 3' to 5' direction. The loading reaction loads a topoisomerase with a single T (or G, or other desired nucleotide) having a 5' phosphate group. When the loaded topoisomerase "sees" a free, unblocked (unphosphorylated) single-stranded DNA strand, it adds a T to that strand, thus providing the DNA with a T' added to the 5'. This addition is facilitated by the presence of an adapter DNA with a sequence that both the topoisomerase and the single-stranded acceptor DNA can bind to. (It should be noted that the adapter DNA is catalytic—it can be reused as a template in repeated reactions.) The added nucleotide has a 5' phosphate, so it will not become a substrate for further addition until it is exposed to a phosphatase, which removes the 5' phosphate. Repeating this process, adding a single "T" to the 5' end of the target single-stranded DNA using vaccinia topoisomerase and adding a single "G" using SVF topoisomerase, allows the construction of sequences encoding binary information with T and G. Other topoisomerases can be used to add A or C, although this reaction is less efficient.
[0187] One advantage of using a topoisomerase-mediated strategy is that the monomers are covalently linked to the topoisomerase and therefore cannot “escape” to interfere with other reactions. When using polymerases, monomers can diffuse, so the polymerase and / or unblocking agent should be specific (e.g., selective for A versus C), or the monomers are supplied by a flow so they have no chance to mix.
[0188] In one aspect, the present invention provides a topoisomerase loaded with a single nucleotide, i.e., a topoisomerase conjugated to a single nucleotide, for example, wherein the topoisomerase is conjugated by a 3'-phosphate of the nucleotide and the nucleotide is protected, for example, by phosphorylation at the 5' position.
[0189] On the other hand, the present invention provides a method for synthesizing DNA molecules (method A) using topoisomerase-mediated ligation, achieved by adding single nucleotides or oligomers to a DNA strand in the 3' to 5' direction. The method comprises (i) reacting the DNA molecule with a topoisomerase carrying the desired nucleotide or oligomer, wherein the nucleotide or oligomer is blocked at the 5' end without further addition, and then (ii) unblocking the 5' end of the thus formed DNA, and repeating steps (i) and (ii) until the desired nucleotide sequence is obtained, for example,
[0190] A1.1. Method A, which is a method for synthesizing a DNA molecule by adding a single nucleotide in the 3' to 5' direction, comprising (i) reacting the DNA molecule with a topoisomerase of the desired nucleotide in a 5' protected form (e.g., a 5' phosphorylated form), such that the desired nucleotide in the 5' protected form is added to the 5' end of the DNA, and then (ii) deprotecting the 5' end of the thus formed DNA by using a phosphatase, and repeating steps (i) and (ii) until the desired nucleotide sequence is obtained; or
[0191] A1.2. Method A, which is a method for synthesizing DNA molecules by adding oligomers in the 3' to 5' direction, comprising (i) reacting the DNA molecule with a topoisomerase carrying the desired oligomer to link the oligomer to the DNA molecule, and then (ii) using a restriction enzyme to provide a 5' site for the linking of another oligomer mediated by the topoisomerase, and repeating steps (i) and (ii) until the desired oligomer sequence is obtained.
[0192] A1.3. Any of the foregoing methods, including providing ligase and ATP to seal the cut in the DNA [NB: Topoisomerase ligation only ligates one strand].
[0193] A1.4. Any of the foregoing methods, wherein the donor oligonucleotide carrying the topoisomerase is contained at a 5' overhang on a strand complementary to the strand carrying the topoisomerase, containing the polyinosine sequence [NB: inosine acts as a 'universal base' and pairs with any other base].
[0194] A1.5. Any of the foregoing methods in which the restriction enzyme is an IIS-type restriction enzyme that can cut all the added DNA except for a single base (the base being "added").
[0195] A1.6. Any of the foregoing methods, wherein the topoisomerase is selected from vaccinia topoisomerase and SVF topoisomerase I.
[0196] A1.7. Any of the foregoing methods, wherein a vaccinia topoisomerase (which recognizes (C / T)CCTT) is used to add dTTP nucleotides and an SVF topoisomerase I (which recognizes CCCTG) is used to add dGTP nucleotides, for example, to provide binary code.
[0197] A1.8. Any of the foregoing methods, wherein the DNA is double-stranded and the reservoir also contains a ligase and ATP to repair DNA strands not ligated by a topoisomerase.
[0198] A1.9. Any of the foregoing methods, including the use of topoisomerase inhibitors to inhibit the binding and activity of free topoisomerase to DNA oligomers, for example, wherein the inhibitor is selected from neomycin and coumarin.
[0199] A1.10. Any of the foregoing methods, wherein the DNA strand thus provided has a sequence comprising thymidine (T) nucleotide and deoxyguanosine (G) nucleotide.
[0200] A1.11. Any of the foregoing methods, wherein the topoisomerase adds a single base, but the restriction enzyme cleaves at a position of one nucleotide in the 5' direction from the base added by the topoisomerase.
[0201] A1.12. Any of the foregoing methods, wherein the DNA strand thus provided has a sequence comprising 'TT' and 'TG' dinucleotide sequences.
[0202] A1.13. Any of the foregoing methods, wherein the DNA is single-stranded,
[0203] A1.14. Any of the foregoing methods in which the DNA is double-stranded.
[0204] A1.15. Any of the foregoing methods, wherein the DNA is on a matrix or magnetic beads, wherein the DNA may be selectively exposed to or removed from the reagent as needed to provide the desired sequence.
[0205] A1.16. Any of the foregoing methods in which some or all of the reagents used to add or unblock DNA are provided by flow and removed by rinsing.
[0206] A1.17. Any of the foregoing methods, wherein the linking of a single nucleotide or oligomer to a single-stranded DNA is facilitated by the presence of an adapter DNA having a sequence that can bind to both a topoisomerase and a single-stranded acceptor DNA.
[0207] A1.18. Any of the aforementioned methods performed in the system, wherein the nanopore separates the chamber containing the topoisomerase from the chamber containing the phosphatase or restriction enzyme, wherein the nanopore allows the movement of DNA by electroattraction but does not allow the movement of the enzyme, such as that described in any of Method 2, etc.
[0208] One potential issue is that poly-G sequences can form G quadruplets in secondary structures. By moving the restriction enzyme back one base (to the 5' of the topological sequence) and following a similar Topo / IIS strategy, 'TT' or 'TG' can be added, each representing a different position. While this requires two bases to encode one position, it has the advantage of avoiding poly-G sequences. In other implementations, the topological recognition sequence uses other bases at the 3' end—although less efficient than (C / T)CCTT—which allows for conjugation with (C / T)CCTA, (C / T)CCTC, and (C / T)CCTG using poxvirus topoisomerases (https: / / www.ncbi.nlm.nih.gov / pubmed / 17462694). Protein engineering / selection techniques can also be used to improve the efficiency of these reactions, and similar methods can be used to add non-classical bases.
[0209] In some embodiments, the method of synthesizing DNA involves treating the DNA with a ligase and ATP. The topoisomerase ligates only one side of the DNA (the other side is essentially nicked). The ligase repairs the nick and ensures that the topoisomerase itself does not reopen the reaction product and cut it.
[0210] In some implementations, the method includes using a topoisomerase inhibitor to inhibit the binding and activity of free topoisomerase to DNA oligomers. Suitable inhibitors include neomycin and coumarin. It should be noted that complete inhibition is undesirable because low levels of topoisomerase activity can help “relax” coiled DNA, which is particularly useful in the synthesis of long DNA chains.
[0211] Therefore, in another embodiment, this disclosure provides a method (method 2) for synthesizing DNA in a nanochip, the nanochip comprising one or more addition chambers containing oligonucleotides loaded with topoisomerases (i.e., oligonucleotides bound to the 3' end of the topoisomerase) and one or more reserve chambers containing restriction enzymes or unblocking agents (e.g., phosphatases), the chambers also containing compatible buffer solutions and separated by a membrane comprising at least one nanopore, wherein the topoisomerase and restriction enzyme are prevented from passing through the nanopore (e.g., because they are too large and / or because they are respectively connected to the matrix in the first and second chambers), the synthesis is carried out by a cycle of adding single nucleotides or short oligonucleotides to the first end of a nucleic acid having a first end and a second end, wherein the first end of the nucleic acid is moved by electroattraction between the addition chamber and the reserve chamber, for example, as follows in one embodiment:
[0212] (i) Using electricity, the 5' end of the receptor DNA (e.g., double-stranded DNA) is moved into the first addition chamber.
[0213] (ii) A donor oligonucleotide loaded with topoisomerase is provided in the first addition chamber, wherein the donor oligonucleotide contains a topoisomerase binding site, an information sequence (e.g., selected from at least two different nucleotides or sequences, such as one sequence corresponding to '0' in binary code and another corresponding to '1'), and a restriction site that will generate a topoisomerase linker site upon restriction enzyme cleavage.
[0214] (iii) Allow sufficient time for donor oligonucleotides to ligate and thus extend the acceptor DNA;
[0215] (iv) Moving the 5' end of the receiver DNA into a reservoir via electrical means, for example, causing a restriction enzyme to cleave the receiver DNA to provide a topoisomerase ligation site, or, in the case of single nucleotide addition, using a deblocking agent, such as a phosphatase, to produce an unblocked 5' nucleotide on the single-stranded DNA; and
[0216] (v) Repeat steps (i)-(iv) in a loop, adding oligonucleotides with the same or different informational sequences until the desired DNA sequence is obtained.
[0217] For example, the present invention provides
[0218] 2.1. Method 2, wherein the 3' end of the receiver DNA is attached near the nanopore, and the 5' end of the receiver oligonucleotide contains a topoisomerase linker site, and includes the step of adding an additional oligonucleotide to the 5' end of the receiver DNA after step (iv) by rinsing the first addition chamber and providing the first addition chamber with a new donor oligonucleotide loaded with topoisomerase, wherein the new donor oligonucleotide has an informational sequence different from the previous donor oligonucleotide; if necessary, the new donor oligonucleotide is added to the receiver DNA, the 5' end of the receiver nucleic acid is pulled back to the first chamber, and steps (i)-(iii) are repeated, or if not necessary, the receiver DNA is allowed to remain in the second chamber until the desired donor oligonucleotide is provided to the first chamber.
[0219] 2.2. Any of the foregoing methods in which multiple receptor DNA molecules are synthesized independently in parallel, such that DNA molecules with different sequences are obtained by controlling their presence in the first chamber respectively.
[0220] 2.3. Any of the foregoing methods, wherein multiple receptor DNA molecules, each bound at the 3' end to a surface near the nanopore, are independently synthesized, wherein each nanopore has an associated pair of electrodes, wherein one electrode of the pair is located near one end of the nanopore and the other electrode is located near the other end of the nanopore, such that each receptor DNA molecule can move independently between the first and second chambers by means of an electric current provided by the pair of electrodes.
[0221] 2.4. Any of the foregoing methods, wherein the donor oligonucleotide used in step (i) of the cycle alternates between donor oligonucleotides containing a first information sequence and donor oligonucleotides containing a second information sequence in each cycle.
[0222] 2.5. Method 2, comprising the steps of adding an additional oligonucleotide to the 5' end of the receiver DNA by returning the 5' end of the receiver DNA to a first addition chamber to add an oligonucleotide having the same informational sequence, or by moving the 5' end of the receiver DNA to a second addition chamber to allow the donor oligonucleotide to bind to a topoisomerase at the 3' end, wherein the donor oligonucleotide in the second addition chamber has a different informational sequence than the donor oligonucleotide in the first addition chamber.
[0223] 2.6. Any of the aforementioned methods, wherein the donor oligonucleotide comprises the following structure:
[0224]
[0225] Where N refers to any nucleotide, and the restriction enzyme is Acc1, which can cut DNA (e.g., GTCGAC in the above sequence) to provide suitable protrusions.
[0226] 2.7. Any of the foregoing methods in which the donor oligonucleotide has a hairpin structure, such as 2.6, wherein the NNNNN groups on the top and bottom chains are linked together.
[0227] 2.8. In any of the foregoing methods, at least one oligonucleotide loaded with a topoisomerase has the following structure:
[0228]
[0229] (* = topoisomerase)
[0230] 2.9. In any of the foregoing methods, at least one oligonucleotide loaded with a topoisomerase has the following structure:
[0231] 5'pCACGTCAGGCGTATCCATCCCTT *
[0232] 3'GTGCAGTCCGCATAGGTAGGGAAGCGC
[0233] 2.10. The aforementioned method, wherein the oligonucleotide loaded with topoisomerase
[0234] 2.11. Any of the foregoing methods, wherein the sequence of the synthesized DNA is determined after each cycle by detecting changes in potential, current, resistance, capacitance and / or impedance as the oligonucleotide passes through a nanopore.
[0235] 2.12. Any of the foregoing methods in which DNA synthesis is carried out in a buffer solution, such as a solution containing a buffer at pH 7-8.5, for example about pH 8, such as a buffer containing tris(hydroxymethyl)aminomethane (Tris), a suitable acid and optional chelating agent (e.g. ethylenediaminetetraacetic acid (EDTA), such as a TAE buffer containing a mixture of Tris base, acetic acid and EDTA, or a TBE buffer containing a mixture of Tris base, boric acid and EDTA; for example, a solution containing 10 mM Tris pH 8, 1 mM EDTA, 150 mM KCl, or for example 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, pH 7.9 @ 25°C.
[0236] 2.13. Any of the foregoing methods also includes removing DNA from the nanochip.
[0237] 2.14. Any of the foregoing methods also includes amplifying the DNA synthesized therefrom.
[0238] 2.15. Any of the foregoing methods also includes removing DNA from the nanochip and crystallizing the DNA.
[0239] 2.16. Any of the foregoing methods further includes stabilizing DNA, for example by drying the DNA-containing solution together with one or more buffers (e.g., borate buffer), antioxidants, humectants, such as polyols, and optional chelating agents (e.g., as described in US8283165 B2, which is incorporated herein by reference), or by forming a matrix between the nucleic acid and a polymer, such as a poly(ethylene glycol)-poly(1-lysine) (PEG-PLL) AB block copolymer.
[0240] 2.17. Any of the foregoing methods, including providing ligase and ATP to seal nicks in DNA [NB: topoisomerase ligation connects only one strand].
[0241] 2.18. Any of the foregoing methods, wherein the donor oligonucleotide carrying the topoisomerase has a 5' overhang on a chain complementary to the chain carrying the topoisomerase (containing the polyinosine sequence [NB: inosine acts as a 'universal base' and pairs with any other base]).
[0242] 2.19. Any of the foregoing methods in which the restriction enzyme is an IIS type restriction enzyme that can cleave all added DNA except for a single base (the base being "added").
[0243] 2.20. In any of the aforementioned methods, the topoisomerase is selected from vaccinia topoisomerase and SVF topoisomerase I.
[0244] 2.21. Any of the foregoing methods, wherein a vaccinia topoisomerase (which recognizes (C / T)CCTT) is used to add dTTP nucleotides and an SVF topoisomerase I (which recognizes CCCTG) is used to add dGTP nucleotides, for example to provide binary code information.
[0245] 2.22. Any of the foregoing methods, wherein the reservoir further contains a ligase and ATP to repair DNA strands that have not been ligated by a topoisomerase.
[0246] 2.23. Any of the foregoing methods, including the use of topoisomerase inhibitors to inhibit the binding and activity of free topoisomerase to DNA oligomers, for example, wherein the inhibitor is selected from neomycin and coumarin.
[0247] 2.24. Any of the foregoing methods, wherein the DNA strand thus provided has a sequence comprising thymidine (T) nucleotide and deoxyguanine (G) nucleotide.
[0248] 2.25. Any of the foregoing methods in which the topoisomerase adds a single base, but the restriction enzyme cleaves at a position of one nucleotide in the 5' direction from the base added by the topoisomerase.
[0249] 2.26. Any of the foregoing methods, wherein the DNA strand thereby provided has a sequence comprising 'TT' and 'TG' dinucleotide sequences.
[0250] 2.27. Any of the foregoing methods that synthesize a DNA molecule by adding a single nucleotide in the 3' to 5' direction comprises (i) reacting the DNA molecule with a topoisomerase of the desired nucleotide in a 5' protected form (e.g., a 5' phosphorylated form) such that the desired nucleotide in the 5' protected form is added to the 5' end of the DNA, and then (ii) deprotecting the 5' end of the thus formed DNA by using a phosphatase, and repeating steps (i) and (ii) until the desired nucleotide sequence is obtained.
[0251] 2.28. Any of the foregoing methods that synthesize DNA molecules by adding oligomers in the 3' to 5' direction comprises (i) reacting the DNA molecule with a topoisomerase carrying the desired oligomer to link the oligomer to the DNA molecule, and then (ii) using a restriction enzyme to provide a 5' site for the topoisomerase-mediated linking of another oligomer, and repeating steps (i) and (ii) until the desired nucleotide sequence is obtained.
[0252] 2.29. Any of the aforementioned methods is a method based on any one of method A, etc.
[0253] For quality control purposes, the products of the synthesis reaction can be detected and examined, and the data encoded on the polymer can be read to extract it. For example, DNA can be amplified and sequenced using conventional methods to confirm that nanopore sequencing is robust.
[0254] In another embodiment, the present invention provides an oligonucleotide comprising a topoisomerase binding site, an information sequence (e.g., selected from at least two different sequences, such as one sequence corresponding to '0' in binary code and another sequence corresponding to '1'), and a restriction site that, when cleaved by a restriction enzyme, will produce a topoisomerase linkage site, for example comprising the following sequences:
[0255]
[0256] The information sequence A or B is a sequence of 3-12, for example, about 8 nucleotides.
[0257] In another embodiment, the present invention provides an oligonucleotide loaded with a topoisomerase, wherein the oligonucleotide comprises a topoisomerase binding site, an information sequence (e.g., selected from at least two different sequences, e.g., one sequence corresponding to '0' in binary code and another sequence corresponding to '1'), and a restriction site that, when cleaved by a restriction enzyme, will produce a topoisomerase linkage site; for example, an oligonucleotide loaded with a topoisomerase having the following structure:
[0258]
[0259] The information sequence A or B is a sequence of 3-12, for example, about 8 nucleotides, and * is a topoisomerase covalently bound to an oligonucleotide; for example, the topoisomerase is vaccinia virus topoisomerase I.
[0260] In another embodiment, the present invention provides single-stranded or double-stranded DNA molecules as described above, wherein the single-stranded or coding sequence consists substantially of non-hybridized bases, such as adenine and cytosine (A and C), arranged in sequence to correspond to binary code, for example, for data storage methods. For example, the present invention provides DNA (DNA 1) wherein the DNA is single-stranded or double-stranded, at least 1000 nucleotides long, for example 1000-1000000 nucleotides long, or for example 5000 to 20000 nucleotides long, wherein the sequence of nucleotides corresponds to binary code; for example,
[0261] 1.1. DNA 1, wherein the DNA is single-stranded.
[0262] 1.2. DNA 1, wherein the DNA is double-stranded.
[0263] 1.3. Any of the aforementioned DNA, wherein the nucleotides in the single strand or coding strand are selected from adenine, thymine, and cytosine nucleotides, for example, selected from adenine and cytosine nucleotides or thymine and cytosine nucleotides.
[0264] 1.4. Any of the aforementioned DNA is primarily composed of non-hybridized nucleotides, and therefore does not form significant secondary structures when in single-stranded form.
[0265] 1.5. Any of the aforementioned DNA, wherein the nucleotides are at least 95%, for example, 99%, such as 100% adenine and cytosine nucleotides.
[0266] 1.6. Any of the aforementioned DNA, containing nucleotides or nucleotide sequences added to separate or label nucleotides containing binary codes, for example, to separate groups of 1 and 0 or 1 and 0, so that consecutive 1s or 0s can be read more easily.
[0267] 1.7. Any of the aforementioned DNA, wherein (a) each bit in the binary code corresponds to a single nucleotide, for example, each of 1 and 0 corresponds to A or C; or (b) each bit in the binary code corresponds to a series of more than one nucleotide, for example, 2, 3 or 4 nucleotides, such as AAA or CCC.
[0268] 1.8. Any of the aforementioned DNA is crystalline.
[0269] 1.9. Any of the aforementioned DNA, provided in dry form with one or more buffer salts (e.g., borate buffer), antioxidants, humectants, such as polyols, and optional chelating agents (e.g., as described in US 8283165 B2, which is incorporated herein by reference); and / or in a matrix between the nucleic acid and the polymer, such as poly(ethylene glycol)-poly(1-lysine) (PEG-PLL) AB block copolymer; and / or with complementary nucleic acid strands or proteins that bind DNA.
[0270] 1.10. Any of the aforementioned DNA is prepared by any one of method 1, method 2, or method A.
[0271] Nanochips can be manufactured, for example... Figure 23-29As shown. For example, in one form, each polymer chain is associated with two or four addition chambers, where two addition chambers can be used to encode binary code in the polymer, and four addition chambers are particularly useful for preparing custom DNA sequences. Each addition chamber contains an individually controllable electrode. The addition chamber contains a reagent for adding monomers to the polymer in a buffer solution. The addition chambers are separated by a membrane containing one or more nanopores from a reserve chamber, which may be shared by multiple addition chambers and contains a deprotection reagent and buffer solution to deprotect the protected monomers or oligomers added in the addition chamber. The nanochip includes multiple sets of addition chambers to allow for the parallel synthesis of many polymers.
[0272] High-bandwidth and low-noise nanopore sensors and detection electronics are important for achieving single DNA base resolution. In some implementations, the nanochip is electrically connected to a complementary metal-oxide-semiconductor (CMOS) chip. Solid-state nanopores can be integrated within a CMOS platform, adjacent to bias electrodes and custom-designed amplifier electronics, as described, for example, in Uddin et al., “Integration of solid-state nanopores in a 0.5 μm CMOS foundry process”, Nanotechnology (2013) 24(15): 155501, the contents of which are incorporated herein by reference.
[0273] In another embodiment, this disclosure provides a nanochip (nanochip 1) for synthesizing and / or sequencing charged polymers (e.g., DNA), comprising at least two different monomers, the nanochip comprising at least first and second reaction chambers separated by a membrane comprising one or more nanopores, wherein each reaction chamber includes one or more electrodes for drawing charged polymers into the chamber, and further comprising an electrolytic medium and optionally reagents for adding monomers to the polymer, such as…
[0274] 1.1. Nanochip 1, wherein the diameter of the nanopore is 2-20 nm, for example 2-10 nm, for example 2-5 nm.
[0275] 1.2. Any of the aforementioned nanochips, wherein some or all of the walls of the reaction chamber of the nanochip contain silicon material, such as silicon, silicon dioxide, silicon nitride, or combinations thereof, such as silicon nitride.
[0276] 1.3. Any of the aforementioned nanochips, wherein some or all of the walls of the reaction chamber of the nanochip contain silicon material, such as silicon, silicon dioxide, silicon nitride, or combinations thereof, such as silicon nitride, and some or all of the nanopores are made by ion bombardment.
[0277] 1.4. Any of the aforementioned nanochips, some or all of which contain the pore-forming protein α-hemolysin in a membrane, such as a lipid bilayer.
[0278] 1.5. Any of the aforementioned nanochips in which some or all of the walls of the reaction chamber are coated to minimize interaction with reagents, for example, coated with polymers such as polyethylene glycol, or coated with proteins such as bovine serum albumin.
[0279] 1.6. Any of the aforementioned nanochips contains an electrolyte medium.
[0280] 1.7. Any of the aforementioned nanochips contains an electrolyte medium comprising a buffer, such as a buffer at pH 7-8.5, for example, a buffer at about pH 8, such as a buffer containing tris(hydroxymethyl)aminomethane (Tris), a suitable acid and optional chelating agent (e.g., ethylenediaminetetraacetic acid (EDTA)), such as a TAE buffer containing a mixture of Tris base, acetic acid and EDTA, or a TBE buffer containing a mixture of Tris base, boric acid and EDTA; for example, a solution containing 10 mM Tris pH 8, 1 mM EDTA, 150 mM KCl, or for example, 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, pH 7.9 @ 25°C.
[0281] 1.8. Any of the aforementioned nanochips contains reagents for adding monomers to polymers.
[0282] 1.9. Any of the aforementioned nanochips is capable of synthesizing (“writing,” e.g., by sequentially adding monomers or groups of monomers to a polymer) and sequencing (“reading,” e.g., by measuring changes in current and / or inductance as monomers pass through nanopores) polymers.
[0283] 1.10. Any of the aforementioned nanochips, wherein the membrane comprising one or more nanopores includes metal surfaces on both sides, the metal surfaces being separated by an insulator, such as a silicon nitride film, the metal surfaces being configured, for example by a photolithography apparatus, to provide an electrode at either end of each nanopore, for example, such that a current can be established through the nanopore via an electrolyte medium, for example, such that a polymer can be drawn through the nanopore and, as the polymer passes through the nanopore, the potential change through the nanopore can be measured and used to identify the sequence of monomers in the polymer.
[0284] 1.11. Any of the aforementioned nanochips contains a charged polymer, said charged polymer being DNA.
[0285] 1.12. Any of the aforementioned nanochips comprises a charged polymer, said charged polymer being single-stranded DNA (ssDNA).
[0286] 1.13. Any of the aforementioned nanochips comprises a charged polymer, said charged polymer being DNA containing predetermined restriction sites.
[0287] 1.14. Any of the aforementioned nanochips comprises a charged polymer, said charged polymer being DNA, wherein said DNA is the DNA described in any of the above DNA 1, etc.
[0288] 1.15. Any of the aforementioned nanochips comprises a charged polymer, said polymer being DNA, wherein the DNA contains at least 95%, for example 99%, for example 100% adenine and cytosine.
[0289] 1.16. Any of the aforementioned nanochips comprises a charged polymer, said polymer being DNA, wherein the DNA contains only adenine and cytosine.
[0290] 1.17. Any of the aforementioned nanochips includes one or more ports to allow the introduction and rinsing out of buffer solutions and reagents.
[0291] 1.18. Any of the aforementioned nanochips contains a buffer solution, such as a buffer solution containing pH 7-8.5, for example, about pH 8, such as a buffer solution containing tris(hydroxymethyl)aminomethane (Tris), a suitable acid and optional chelating agent (e.g., ethylenediaminetetraacetic acid (EDTA), such as a TAE buffer containing a mixture of Tris base, acetic acid and EDTA, or a TBE buffer containing a mixture of Tris base, boric acid and EDTA; for example, a solution containing 10 mM Tris pH 8, 1 mM EDTA, 150 mM KCl, or for example 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, pH 7.9 @ 25°C.
[0292] 1.19. Any of the aforementioned nanochips, which are or can be freeze-dried for storage and subsequently rehydrated, for example, wherein the structure of the nanochip comprises a hydrated or water-permeable polymer.
[0293] 1.20. Any of the aforementioned nanochips, synthesized in a dry form, for example, wherein the structure of the nanochip comprises a hydrated or water-permeable polymer, which is then hydrated before use and optionally freeze-dried once the writing process is complete for long-term storage.
[0294] 1.21. Any of the aforementioned nanochips in which charged polymers, such as DNA, are stabilized with histones.
[0295] 1.22. Any of the aforementioned nanochips, wherein the inner surface carries a positive charge.
[0296] 1.23. Any of the aforementioned nanochips, wherein electrodes are operatively connected to a capacitive circuit capable of providing radio frequency pulsed DC current through a nanopore, for example, at a frequency of 1 MHz to 1 GHz, for example, 50-200 MHz, for example, about 100 MHz, wherein the pulsed DC current can attract charged polymers through the nanopore, and when the charged polymers pass through the nanopore, the capacitance change through the nanopore can be measured to determine the monomer sequence.
[0297] 1.24. Any of the aforementioned nanochips, including a reservoir or desealing chamber, contains an agent for polymer deprotection following the addition of a monomer or oligomer in one of the addition chambers.
[0298] 1.25. Any of the aforementioned nanochips, including multiple pairs of addition chambers.
[0299] 1.26. Any of the aforementioned nanochips, including the electrically controlled layer, fluid layer, and electrically grounded layer connected by wafer bonding, for example, such as Figure 24 As shown.
[0300] 1.27. Any of the aforementioned nanochips, wherein the nanopores are fabricated by drilling using FIB, TEM, wet or dry etching.
[0301] 1.28. Any of the aforementioned nanochips, wherein the membrane containing nanopores is 1 atomic layer to 30 nm thick.
[0302] 1.29. Any of the aforementioned nanochips, wherein the membrane containing nanopores is made of SiN, BN, SiOx, graphene, transition metal dichalcogenides, such as WS2 or MoS2.
[0303] 1.30. Any of the aforementioned nanochips, including wiring made of metal or polysilicon.
[0304] 1.31. Any of the aforementioned nanochips in which wiring density is increased by 3D stacking and electrical isolation is provided by dielectric deposition (e.g., by PECVD, sputtering, ALD, etc.).
[0305] 1.32. Any of the aforementioned nanochips in which the contact points with the electrodes in the feeding chamber are fabricated using through-silicon vias (TSVs) via deep reactive ion etching (DRIE), for example, using a low-temperature or BOSCH process, or via wet silicon etching.
[0306] 1.33. Any of the aforementioned nanochips, wherein individual voltage control of the electrodes in each addition chamber allows the electrodes in each addition chamber to be individually controlled and monitored.
[0307] 1.34. Any of the aforementioned nanochips, wherein each polymer is associated with a first addition chamber, a second addition chamber, and a desealing chamber.
[0308] 1.35. Any of the aforementioned nanochips, wherein one or more chambers have fluid flow.
[0309] 1.36. Any of the aforementioned nanochips, wherein one or more chambers are fluidly isolated.
[0310] 1.37. Any of the aforementioned nanochips, wherein the unsealed chamber has fluid flow.
[0311] 1.38. Any of the aforementioned nanochips in which the addition chambers have a common fluid flow.
[0312] 1.39. Any of the aforementioned nanochips in which the wiring between chambers is common between chambers of similar type (e.g., between first added chambers, between second added chambers, and between desealed chambers).
[0313] 1.40. Any of the aforementioned nanochips, wherein the addition chamber has individual voltage control and the de-enclosure chamber has a common electrical ground.
[0314] 1.41. Any of the aforementioned nanochips, wherein the unsealing chamber has individual voltage control, the first addition chamber has a common electrical ground, and the second addition chamber has a common electrical ground.
[0315] 1.42. Any of the aforementioned nanochips, wherein the nanochips are manufactured by wafer bonding and the chambers are pre-filled with the desired reagents prior to bonding.
[0316] 1.43. Any of the aforementioned nanochips, wherein one or more of its inner surfaces are silanized.
[0317] 1.44. Any of the aforementioned nanochips has one or more ports for introducing or removing fluid.
[0318] 1.45. Any of the aforementioned nanochips in which the electrodes in the chamber are confined from direct contact with the charged polymer, for example, in which the electrodes are placed too far from the nanopores to be reached by the charged polymer bonded to the surface adjacent to the nanopores, or in which the electrodes are protected by a material that allows water and monatomic ions (e.g., Na+, K+, and Cl- ions) to pass through but does not allow polymer or monomer or oligomeric reagents to pass through for bonding with the polymer.
[0319] 1.46. Any of the aforementioned nanochips is electrically connected to a complementary metal-oxide-semiconductor (CMOS) chip.
[0320] For example, in one embodiment, the present invention provides a nanochip, such as any of Nanochip 1, for sequencing a charged polymer (e.g., DNA) comprising at least two different monomers, the nanochip comprising at least first and second reaction chambers, the reaction chambers comprising an electrolyte medium and separated by a membrane comprising one or more nanopores, wherein each reaction chamber comprises at least a pair of electrodes disposed on opposite sides of the membrane, wherein the electrodes are operatively connected together in a capacitive circuit capable of providing a radio frequency pulsed direct current through the nanopores, for example, at a frequency of 1 MHz to 1 GHz, for example, 50-200 MHz, for example, about 100 MHz, wherein the pulsed direct current can attract the charged polymer through the nanopores, and the monomer sequence can be determined by measuring the capacitance change through the nanopores as the charged polymer passes through the nanopores.
[0321] In another embodiment, the present invention provides a method for reading the monomer sequence of a charged polymer comprising at least two different types of monomers, such as DNA molecules, the method comprising applying a pulsed direct current of radio frequency, for example, at a frequency of 1 MHz to 1 GHz, such as 50-200 MHz, such as about 100 MHz, in a nanopore, wherein the pulsed direct current attracts the charged polymer through the nanopore, and the monomer sequence is read by measuring the capacitance change on the nanopore as the charged polymer passes through the nanopore.
[0322] In another embodiment, the present invention provides the use of any DNA 1, etc., in a method for storing information.
[0323] In another embodiment, the present invention provides the use of single-stranded DNA in methods for storing information, for example, where the sequence is substantially non-self-hybridized.
[0324] In another embodiment, the present invention provides a method for preparing a data storage and device for a charged polymer, such as DNA, comprising at least two different monomers or oligomers using nanochips, such as any of nanochip 1 et seq, wherein the monomers or oligomers are arranged in sequence to correspond to binary code, for example, according to any of the foregoing methods 1 and / or 2, etc.
[0325] For example, in one embodiment, a nanochip containing such synthesized polymers provides a data storage device because the nanochip can be activated and the polymer's sequence detected at any time by passing it through a non-pore. In other embodiments, the polymer is removed from the nanochip, or amplified and removed from the nanochip, stored until needed, and then read using a conventional sequencer, such as a conventional nanopore sequencing device.
[0326] In another embodiment, the present invention provides a method for storing information, including any of the following: synthesizing DNA 1, for example, according to any of the following methods: method 1 or method 2.
[0327] In another embodiment, the present invention provides a method for reading binary code (e.g., encoded on any of DNA 1, etc.) using a nanopore sequencer, such as Nanochip 1 as described herein.
[0328] Any of the aforementioned methods in which an enzyme that cleaves charged polymers (e.g., deoxyribonuclease (DNase)) is used to hydrolyze DNA to erase the nanochip.
[0329] Example
[0330] Example 1 - Fixing one end of DNA adjacent to a nanopore and controlling the back-and-forth movement of the DNA by electric current
[0331] Experimental procedures were developed to demonstrate that DNA can move back and forth between two chambers separated by nanopores by an electric current, even when the relevant proteins do not move between the chambers.
[0332] The two-chamber nanochip is made of silicon nitride. As described by Briggs K et al., Automated fabrication of 2-nm solid-state nanopores for nucleic acid analysis, Small (2014) 10(10): 2077-86, nanopores of <4nm (for dsDNA or ssDNA) and 2nm (for ssDNA only) are prepared. These two chambers are referred to as the “near” and “far” chambers, with the far chamber being the chamber where the 3' end of the DNA is concatenated.
[0333] The nanopores show ssDNA (2nm pore) and ssDNA + dsDNA (4nm pore), but not proteins, passing through the nanopores. Passage through the nanopores is detected by electrical disruption.
[0334] DNA conjugation to the pore surface: 5' amino-modified DNA was attached to carboxylate-coated polystyrene beads (Fluoresbrite® BB Carboxylate Microspheres 0.05 μm, from Polysciences, Inc.) via carbodiimide-mediated attachment. The 3' end of the DNA was biotin-labeled. The DNA had a predetermined length.
[0335] Streptavidin conjugation: As described in Arafat, A. Covalent Biofunctionalization of SiliconNitride Surfaces Langmuir (2007) 23(11): 6233-6244, the surface conjugation is performed on the “far” side of the silicon nitride nanoporous conjugate streptavidin.
[0336] DNA fixation near the nanopore: Add DNA-conjugated polystyrene beads in buffer to the "near" chamber and buffer to the "far" chamber (standard buffer: 10 mM Tris pH 8, 1 mM EDTA, 150 mM KCl). Apply a voltage (~100 mV) until a current interruption is observed (using an Axon Nanopatch200B patch-clamp amplifier). The 50 nm beads cannot pass through the nanopore, so the current is severely disrupted when the DNA strand passes through and the beads press against the ends of the nanopore. Maintain the current for 1–2 minutes until the DNA is irreversibly bound to the distally fixed streptavidin via biotin binding. To confirm DNA fixation, reverse the current. A different current is observed if the DNA is inside or outside the pore. If it appears the DNA is not fixed, repeat the procedure.
[0337] Bead release via endonucleases: A restriction enzyme in a restriction enzyme buffer is added to the DNA-attached chamber. In one embodiment, the DNA is single-stranded and contains restriction sites that can be cleaved by the enzyme, which will cut the single-stranded DNA. See, for example, Nishigaki, K., Type II restriction endonucleases cleave single-stranded DNAs in general. Nucleic Acids Res. (1985) 13(16): 5747–5760. In an alternative embodiment, complementary oligonucleotides are added to the DNA-attached chamber, allowed to hybridize for 30 minutes to produce dsDNA, and then the restriction enzyme is added. Once the bead is released, it is flushed away. The current is switched between forward and reverse to confirm DNA entry / exit from the well.
[0338] To illustrate the controlled back-and-forth movement: Using a standard buffer, apply a current in the forward direction until a signal interruption is observed, then return to "normal" after the DNA has passed through. Apply a current in the reverse direction until a signal interruption is observed. Observe that the signal does not return to normal because the DNA remains in the pore. Repeat the application of current in both the forward and reverse directions for several cycles to confirm that the DNA moves back and forth through the nanopore.
[0339] Example 1a: Immobilization of DNA strands near nanopores in a silica chip
[0340] The inner wall of the nanochip is made of silicon dioxide. Both sides are silanized, but oligonucleotides are attached to only one side of the chip wall, thus creating nanopores.
[0341] Silanization: The chip wall surface was cleaned at 30°C with Pirannah solution (various commercially available brands, typically including a mixture of sulfuric acid (H2SO4) and hydrogen peroxide (H2O2), which removes organic residues from the surface) and washed with double-distilled water. A stock solution of (3-aminopropyl)triethoxysilane (APTES) was prepared containing 50% methanol (MeOH), 47.5% APTES, and 2.5% nano-pure H2O, and aged at 4°C for >1 hour. The APTES stock solution was then diluted 1:500 in MeOH and applied to the chip wall, incubated together with it at room temperature. The chip wall was then rinsed with MeOH and dried at 110°C for 30 minutes.
[0342] Conjugation: The chip wall was then incubated for 5 hours at room temperature in a 0.5% w / v solution of 1,4-phenylene diisothiocyanate (PDC) in dimethyl sulfoxide (DMSO). It was briefly washed twice with DMSO and twice with double-distilled water. The chip wall was then incubated overnight at 37°C with 100 nM amine-modified single-stranded DNA oligomers (approximately 50 oligomers) in double-distilled water (pH 8). The chip wall was then washed twice with 28% ammonia solution to inactivate any unreacted material and twice with double-distilled water. One or more nanopores were then formed in the wall.
[0343] Once the nanochip is fabricated, the inner walls are coated with DNA oligomers, approximately 50 bp long. This allows single-stranded DNA with end sequences complementary to surface-bound DNA to be localized into nanopores by attaching ssDNA to relatively bulk structures (such as beads, proteins, or DNA origami structures with diameters too large for nanopores). The complementary sequence to the surface-bound DNA is located at the distal end of the bulk structure. Using an electric current, a charged polymer is pulled across the nanopore, causing the ssDNA to bind to the complementary surface-bound DNA oligomers adjacent to the nanopore and cleaving the bulk structure.
[0344] Example 2: DNA Synthesis - Single Nucleotide Addition
[0345] DNA is moved to a "storage" chamber by applying an appropriate current and detecting DNA movement.
[0346] Add reversibly blocked dATP* to the 'Add' chamber with terminal transferase (TdT, New England Biolabs) in a suitable buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, pH 7.9 @ 25 °C). Also add buffer to the 'Reserve' chamber.
[0347] dNTPs with reversible blocks at their 3'-OH sites are used to add nucleotides to DNA. When added to the DNA strand, the next dNTP cannot be added until the blocked dNTP is unblocked.
[0348] Unblocking can be chemical or enzymatic. Different methods were used:
[0349] a. 3'O-Allyl: As described in Ju J, Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators. Proc Natl Acad Sci US A. (2006);103(52):19635-40, the allyl group is removed by Pd-catalyzed deallylation in an aqueous buffer solution, or by the use of iodine (10 mol%) in polyethylene glycol-400, as described in Shankaraiah G. et al., Rapid and selective deallylation of allyl ethers and esters using iodine in polyethylene glycol-400. Green Chem. (2011)13: 2354-2358.
[0350] b. 3'O-NH2: Remove amines in buffered NaNO2 as described in US 8034923.
[0351] c. 3'-Phosphate. The phosphate is hydrolyzed using endonuclease IV (New England Biolabs). Other 3' modifications that may be removed using endonuclease IV include glyceraldehyde-3-phosphate and deoxyribose-5-phosphate.
[0352] d. 3'-O-Ac: As described in Ud-Dean, A theoretical model for template-free synthesis of long DNA sequence. Syst Synth Biol (2008) 2:67–73, acetic acid is removed by enzymatic hydrolysis.
[0353] The DNA was then moved to the "remote" chamber by applying an appropriate current and detecting DNA movement. The DNA was deprotected by switching buffers and adding deblocking buffer / solution, as described above.
[0354] Repeat the process as needed to produce the desired sequence.
[0355] Example 3: DNA Synthesis: Blocking Oligonucleotide Addition
[0356] The 3' end of the double-stranded DNA is attached near a nanopore with a pore size of 4 nm. The 5' end of the DNA has a CG overhang (read from 5' to 3').
[0357] Oligomeric boxes A and B are prepared as follows:
[0358] 5'CGAAGGG <Code A or B> GTCGACNNNNN
[0359] 3'GCTTCCC <complementary> CAGCTGNNNNN
[0360] Codes A and B each represent information sequences. Ns refers to any nucleotide. The 5' sequence contains the topoisomerase recognition site, and the 3' sequence contains the Acc1 restriction site. The oligonucleotide is exposed to the topoisomerase, which binds to 3' thymidine:
[0361] 5'CGAAGGG <Code A or B> GTCGACNNNNN
[0362] 3'* TTCCC <complementary> CAGCTGNNNNN (* = topoisomerase)
[0363] DNA is moved to the "nearby" chamber by applying an appropriate current and detecting DNA movement. The 'code A' oligonucleotide carrying topoisomerase is provided in the 'addition' chamber. DNA is moved into the addition chamber by applying an appropriate current and detecting DNA movement, whereupon the code A oligonucleotide binds to the DNA, adding Acc1 to the "reserve" chamber, where it is cleaved at the restriction site to provide a topoisomerase linker site.
[0364] Repeat this process until the desired sequence is achieved, adding other "code A" or "code B". It should be noted that it is not necessary to continuously add new Acc1 to the "reserve" chamber; when switching from code A or code B, simply clean the code A or code B oligonucleotides in the "add" chamber.
[0365] To sequence wells that allow only ssDNA to pass through, some modifications to the above protocol are required. It is well known that when dsDNA encounters a small well (2 nm), only ssDNA passes through and the complement is "stripped away." Therefore, if this synthesis is performed using 2 nm wells, it is essential to ensure that the appropriate dsDNA can "reform" on the other side. To achieve this, "CGAAGGG <code A or B> GTCGACNNNNN" can be added to the near chamber (to ensure the generation of restriction enzyme sites) and "CGAAGGG <code A or B> GT" can be added to the far chamber (to ensure the generation of topologically compatible sites).
[0366] The aforementioned method demonstrates that the sequential "addition" of DNA-encoded information is performed into an ever-growing DNA strand with ≥2 consecutive additions (representative 2 bits), each including both an 'addition' and 'deprotection' step. Initial experiments for optimization and proof of concept were conducted in microtubes.
[0367] In the method described in this embodiment, the information of one position is encoded in a string of nucleotides. The DNA position to be "added" is a short dsDNA sequence conjugated to vaccinia topoisomerase I (topo). In the presence of suitable "deprotected" 'receptor' DNA, the topo-conjugated DNA 'position' is enzymatically and covalently linked ('added') to the acceptor via topoisomerase, in which it is removed from the DNA. The restriction enzyme can then cleave the added position to "deprotect" it and produce a suitable 'receptor' sequence for adding the next position.
[0368] Topology load: The general load scheme is as follows, in Figure 22 The diagram below is schematically illustrated, where N represents any nucleotide, and A, T, G, and C represent nucleotides having adenine, thymine, guanine, and cytosine bases, respectively. The N above each other is complementary. While this example uses the restriction enzyme HpyCH4III, the basic strategy can also be implemented with other restriction enzymes, for example, as demonstrated in Example 4.
[0369]
[0370] Add to
[0371] General 'Add' reaction:
[0372]
[0373] To protect
[0374] General 'deprotection' reaction:
[0375]
[0376] The following oligonucleotides were sequenced from Integrated DNA Technologies (IDT). (Some oligonucleotides have a "b" at the end to indicate biotin).
[0377] BAB: CGATAGTCTAGGCACTGTTTGCTGCGCCCTTGTCCGTGTCGCCCTTATCTACTTAAGAGATCATACAGCATTGCGAGTACG
[0378] B1:b-CACGTACTCGCAATGCTGTATGATCTCTTAAGTAGATA
[0379] B2:ATCTACTTAAGAGATCATACAGCATTGCGAGTACG
[0380] TA1:b-CACACTCATGCCGCTGTAGTCACTATCGGAAT
[0381] TA2:AGGGCGACACGGACAGTTTGAATCATACCG
[0382] TA3b:AACTTAGTATGACGGTATGATTCAAACTGTCCGTGTCGCCCTTATTCCGATAGTGACTACAGCGGCATGAG
[0383] TB1:b-CACACTCATGCCGCTGTAGTCACTATCGGAAT
[0384] TB2:AGGGGCCAGCAAACAGTGCCTAGACTATCG
[0385] TB3b:
[0386] AACTTAGTATGACGATAGTCTAGGCACTGTTTGCTGCGCCCTTATTCCGATAGTGACTACAGCGGCATGAG
[0387] FP1:CACGTACTCGCAATGCT
[0388] FP2:CGGTATGATTCAAACTGTCCG
[0389] FP3:GCCCTTGTCCGTGTC
[0390] Dissolve the oligonucleotides in TE buffer to 100 μM and store at -20 °C.
[0391] Hybridized oligonucleotides were prepared by mixing oligonucleotides as described below, heating to 95°C for 5 minutes, and then decreasing the temperature by 5°C every 3 minutes until a temperature of 20°C was reached. The hybridized oligonucleotides were stored at 4°C or -20°C. The combination of oligonucleotides is as follows:
[0392] B1 / 2
[0393] 48 uL B1
[0394] 48 uL B2
[0395] 4 μL 5M NaCl
[0396] A5
[0397] 20 uL TA1
[0398] 20 uL TA2
[0399] 5 uL TA3b
[0400] 4 μL 5M NaCl
[0401] 51 uL TE
[0402] B5
[0403] 20 uL TB1
[0404] 20 uL TB2
[0405] 5 uL TB3b
[0406] 4 μL 5M NaCl
[0407] 51 uL TE
[0408] The following buffers and enzymes are used in this embodiment:
[0409] TE: 10M Tris pH 8.0, 1mM EDTA, pH 8.0
[0410] WB: 1M NaCl, 10mM Tris pH8.0, 1mM EDTA pH8.0
[0411] 1x Topo: 20mM Tris pH7.5, 100mM NaCl, 2mM DTT, 5mM MgCl 2
[0412] 1x RE: 50mM potassium acetate, 20mM Tris-acetate, 10mM magnesium acetate, 100ug / ml BSA, pH 7.9, 25℃.
[0413] Vaccinium DNA topoisomerase I (topo) was purchased from Monserate Biotech (10,000 U / mL).
[0414] HypCH4III purchased from NEB
[0415] Streptavidin-coated magnetic beads (s-MagBeads) were purchased from ThermoFisher.
[0416] The receiver was prepared as follows: 5 μL of s-magbeads was washed once in 200 μL of Western blot (WB) (binding time 1 min). 5 μL of B1 / 2 + 195 μL of WB was added to the beads and incubated at room temperature for 15 min, then washed once with 200 μL of WB, then once with 200 μL of 1x Topo, and resuspended in 150 μL of 1x Topo.
[0417] A5 of loaded Topo was prepared as follows (see Figure 20 ): Incubate 4 μL of 10x topo buffer + 23 μL of water + 8 μL of A5 + 5 μL of topo at 37 °C for 30 minutes, add to 5 μL of s-magbeads (wash once with 200 μL of WB, wash once with 200 μL of 1x topo, and resuspend in 150 μL of 1x topo), and bind for 15 minutes at room temperature.
[0418] Adding the A5 load to the acceptor: Remove the s-magbeads from the A5 load of Topo, add them to the acceptor, and incubate at 37°C for 60 minutes. Remove the aliquots, dilute 1 / 200 in TE, and store at -20°C.
[0419] Deprotection: Wash the material once with 200 μL WB and once with 200 μL 1x RE, then resuspend in 15 μL 10x RE and 120 μL water. Add 15 μL HypCH4III. Incubate the mixture at 37°C for 60 minutes, then wash once with 200 μL WB and once with 200 μL 1x topo to produce a product called “receptor-A5”.
[0420] B5 with loaded Topo was prepared as follows (see Figure 21): 4 μL 10x Topo buffer. Combine 23 μL water and 8 μL B5 + 5 μL Topo and incubate at 37 °C for 30 min. Add the product to 5 μL s-magbeads (wash once with 200 μL WB, wash once with 200 μL 1x Topo, and resuspend in 150 μL 1x Topo) and allow to bind at room temperature for 15 min.
[0421] Add the load of B5 to the acceptor-A5: Remove the s-magbeads from the load of B5, add the acceptor-A5 and incubate at 37°C for 60 minutes. Then remove the aliquots, dilute 1 / 200 with TE and store at -20°C.
[0422] Deprotection: Wash the material once with 200 μL WB, then once with 200 μL 1x RE, and resuspend in 15 μL 10x RE and 120 μL water. Add 15 μL HypCH4III and incubate the mixture at 37°C for 60 minutes.
[0423] The effectiveness of the above reactions was confirmed by PCR amplification of aliquots from A5 (with A5 acceptor added: step iii, 'added to A5' in the schematic) and B5 (with B5 acceptor added to A5: step vi, 'added to B5' in the schematic). 'Template-free' was used as a negative control for A5, A5 as a negative control for B5, and oligo-BAB as a positive control for B5. The expected product size for A5 PCR was 68 bp, and the expected product size for B5 PCR was 57 bp. (B1 / 2 was also run on the gel, with an expected size of ~47 bp, but this is likely approximate due to the presence of overhangs and its biotinylation). PCR reactions (30 cycles at 95 / 55 / 68 (1 min each)) were performed as follows:
[0424]
[0425] SDS-PAGE using a 4-20% Tris-glycine gel was used to confirm the production of oligonucleotides of the expected size. Loading was performed as described above, but after loading (37°C incubation step), the loading buffer was mixed directly and the sample was heated to 70°C and held for 2 minutes, then cooled before running the gel. The gel was stained with Coomassie stain. For the negative control, water was added to the reaction instead of topo. Figure 30 The results were depicted, clearly showing the bands corresponding to the expected product sizes for A5 PCR and B5 PCR.
[0426] Therefore, it is demonstrated that DNA site addition via a DNA cassette loaded with a topoisomerase and deprotection via a restriction enzyme are feasible. In these proof-of-concept experiments, DNA was immobilized by streptavidin-conjugated magnetic beads and sequentially moved into different reaction mixtures; however, in the form of a nanoporous chip, we created separate reaction chambers and used an electric current to move DNA into those different reaction chambers.
[0427] Finally, PCR demonstrated that when the DNA sequence corresponding to the 'bit' information was added sequentially, the expected DNA sequence was produced. These reactions worked as designed, even with very little optimization.
[0428] The DNA prepared as described in Examples 2 and 3 was recovered and sequenced using a commercial nanopore sequencer (MinION from Oxford Nanopore), confirming that the desired sequence was obtained.
[0429] Example 4 - DNA Synthesis: Blocking Oligonucleotide Addition Using Different Restriction Enzymes
[0430] The following synthesis is similar to that in Example 3, but uses the restriction enzyme MluI, which is cleaved at 'ACGCGT' to form:
[0431]
[0432] In this embodiment, TOPO is loaded to form a sequence-complementary complex, which will enable the loaded TOPO to transfer DNA to DNA cleaved with MluI:
[0433]
[0434] Using a method similar to that described in the preceding embodiments, an oligomer is then added to the 5' end of the synthesized chain with a complementary acceptor sequence using a loaded TOPO, thereby releasing the TOPO. The chain is then "deprotected" using MluI, and this cycle is repeated until the desired oligomer sequence is obtained.
[0435] Example 5 - Adding a single base using a topoisomerase strategy
[0436] It has been found that topoisomerase systems can also be designed to add a single base to a single-stranded DNA strand (as described in Example 3, which adds a 'box'). The DNA site to be "added" is contained in a short DNA sequence conjugated to vaccinia topoisomerase I (topo). In the presence of a suitable single-stranded "deprotected" 'acceptor' DNA, the topo-loaded DNA is enzymatically and covalently linked ('added') to the acceptor via topoisomerase enzymatic catalysis, during which the topoisomerase is removed from the DNA. An IIS-type restriction enzyme can then cleave all the added DNA except for the single base being 'added'. This deprotection-addition process is repeated to add additional bases (sites).
[0437] Topo load: The general load scheme is as follows, similar to Example 3:
[0438]
[0439]
[0440] As in Example 3, the N atoms above each other are complementary. I is inosine. Biotin is used to remove unreacted products and byproducts. The addition of monobasic bases is performed as follows.
[0441]
[0442] The deprotection was elucidated using BciVI restriction enzymes (bold site):
[0443]
[0444]
[0445]
[0446] The following oligonucleotides are commercially synthesized (B = biotin, P-phosphate, I = inosine):
[0447]
[0448] Dissolve the oligonucleotides in TE buffer to 100 μM and store at -20 °C.
[0449] Hybridization: The following hybridized oligonucleotides were prepared by mixing oligonucleotides as described above, heating to 95°C for 5 minutes, and then decreasing the temperature by 5°C every 3 minutes until the temperature reached 20°C. The hybridized oligonucleotides were stored at 4°C or -20°C.
[0450] NAT1b / NAT9cI / NAT9x
[0451] 8 μL NAT1B
[0452] 10 μL NAT9cI
[0453] 10 μL NAT9x
[0454] 48 μL TE
[0455] 4 μL 5M NaCl
[0456] NAT1 / NAT9cI
[0457] 10 μL NAT1
[0458] 10 μL NAT9cI
[0459] 80 uL PBS
[0460] NAT1 / NAT9
[0461] 10 μL NAT1
[0462] 10 μL NAT9
[0463] 80 uL PBS
[0464] Buffers and enzymes: Use the following buffers:
[0465] TE: 10M Tris pH 8.0, 1mM EDTA, pH 8.0
[0466] PBS: Phosphate-buffered saline (137mM NaCl, 2.7mM KCl, 10mM Na₂HPO₄, 1.8mM KH₂PO₄) (pH 7.4)
[0467] 10x Cutsmart: 500 mM KAc, 200 mM Tris-Ac, 100 mM Mg-Ac, 1 mg / mL BSApH 7.9
[0468] BciVI was purchased from NEB, and streptavidin-coated magnetic beads (s-MagBeads) were purchased from Thermo Fisher.
[0469] The reaction is carried out as follows.
[0470] 1. Topo loading: Assemble reagents according to the table:
[0471]
[0472] The reagent was then incubated at 37°C for 30 minutes. After 10 minutes at room temperature, byproducts were removed using streptavidin magnetic beads (5 μL) in 1x TOPO topology buffer to allow binding.
[0473] 2. Reaction: Assemble the reagents according to the table:
[0474]
[0475] The reagent was then incubated at 37°C for 30 minutes. The reaction is expected to proceed as follows:
[0476]
[0477] An asterisk (*) indicates a topoisomerase. Note that NAT9cI is phosphorylated, but is not shown for illustrative purposes.
[0478] When the topo of the load has an acceptor sequence, it undergoes the following reaction:
[0479]
[0480] PCR amplification and measurement of the molecular weight of the product on an agarose gel confirmed the production of the expected product. See also Figure 30 The correct-sized bands were depicted in lane 1 (experiment), while no bands were observed in the negative control.
[0481] B. Deprotection reaction: Assemble reagents according to the table:
[0482]
[0483] The reagent was incubated at 37°C for 90 minutes. For the deprotection reaction, a representative product of the addition reaction was generated using commercially available oligonucleotides, and digestion with the BciVI restriction enzyme was tested.
[0484]
[0485] Given that the 3' of the cleavage site is a series of inosine bases instead of "regular" bases, it is unknown whether the restriction enzyme will cleave the DNA as expected. As a positive control, equivalents of NAT1 / NAT9cI with "appropriate" base pairings (NAT1 / NAT9c) were prepared:
[0486]
[0487] The molecular weight of the product was measured on an agarose gel after PCR amplification. Figure 31This indicates that the enzyme is functioning as expected. For the positive control, a larger band was observed in the undigested state (lane 1), but a smaller band was observed in the digested state. The same pattern was observed using NAT1 / NAT9cI, indicating that the presence of inosine does not eliminate or interfere with digestion. NAT1 / NAT9cI appeared to retain a small amount of undigested product, suggesting that cleavage is less efficient than with NAT1 / NAT9c, at least under these conditions. Cleavage efficiency can be improved by changing the buffer conditions and / or adding more inosine to the 5' end of NAT9cI.
[0488] The foregoing examples demonstrate that it is feasible to add a single nucleotide to the 5' end of a target single-stranded DNA using a combination of Topo / TypeIIS restriction enzymes. Using a similar process, the associated topoisomerase SVF, which identifies the sequence CCCTG (https: / / www.ncbi.nlm.nih.gov / pubmed / 8661446), is used to add 'G' instead of 'T', thereby allowing the construction of sequences encoding binary information using T and G.
[0489] As mentioned above, when using a topoisomerase strategy to generate dsDNA, ligases and ATP can be used to repair nicks in the DNA on opposite strands. However, when performing single nucleotide addition, as shown in this example, we are building single-stranded DNA, so there are no nicks to repair and no ligase is needed.
[0490] Example 6 - Adding a single base using a topoisomerase strategy with 5' phosphate coupling
[0491] In another method of single-base addition, we use a 5'-phosphate as a protecting group to provide single-base pair addition in the 3' to 5' direction. The loading reaction loads a topoisomerase with a single T (or G, or other desired nucleotide) having a 5' phosphate group. When the loaded topoisomerase “sees” a free, unclosed (unphosphorylated) single-stranded DNA strand at the 5' end, it adds a T to that strand, thus providing DNA with a T added to the 5'. This addition is facilitated by the presence of a connector DNA with a sequence that can bind to both the topoisomerase and the single-linker DNA. (It should be noted that the connector DNA is catalytic – it can be reused as a template in repeated reactions.) The added nucleotide has a 5' phosphate, so it does not become a substrate for further addition until exposed to a phosphatase that removes the 5' phosphate. The process is repeated, adding a single "T" to the 5' end of the target single-stranded DNA using Topo and adding a single "G" using SVF topoisomerase, thus allowing the construction of sequences encoding binary information with T and G. The process is schematically described below:
[0492]
[0493]
[0494] Example 7 - Using DNA origami helps attach DNA near nanopores
[0495] A DNA strand with a large origami structure at one end is trapped in a nanopore and immobilized to a surface-conjugated streptavidin via the terminal biotin portion of the DNA. After restriction enzymes cleave the origami structure, the immobilized DNA can move back and forth through the pore, as demonstrated by electrical disruption. Immobilization allows for the controlled movement of individual DNA molecules through the pore, which in turn enables the "reading" and "writing" of information into the DNA.
[0496] like Figure 35 As shown, a large double-stranded DNA unit is formed, too large to fit through a nanopore, and has single-stranded regions connected to the large volume portion by two short double-stranded regions. These double-stranded regions serve to anchor the DNA to be added to the synthesis. The single-stranded regions can then be separated and anchored to a surface adjacent to the nanopore, releasing the origami structure. See also Figure 33 .
[0497] Nanopores were formed in a 3mm chip with 20nm SiO2 and 50×50μm windows. The chip was supplied by Nanopore Solutions. The Nanopore box holder and flow cell were supplied by Nanopore Solutions. The amplifier was a TecellaPico 2 amplifier. This is a USB-powered amplifier controlled via a USB-computer interface. Tecella provided (Windows) software to control the amplifier. The multimeter was a FLUKE 17B+ digital multimeter capable of detecting currents as low as 0.1 uA. For RF noise screening, a Concentric Technology Solutions TC-5916A shielded box (Faraday cage) with a USB interface was used. The oligonucleotide was obtained from IDT.com. “PS” is propargyl-n-triethoxysilylpropylcarbamate-90 / .
[0498] The origami structure is based on a single-stranded m13 with a "honeycomb" cubic origami structure, with one side measuring ~20 nm. Double-stranded regions exist near the honeycomb, each containing a unique restriction site. One of these sites is used to attach modified DNA to enable attachment near the nanopores, and the other is used to excise the origami structure after DNA attachment.
[0499] Nanopore formation: Nanopores are formed in the chip using dielectric breakdown, as follows:
[0500] 1. The chip is carefully installed in the box.
[0501] 2. Wetting: Carefully pipette 100% ethanol onto the chip. Air bubbles must be removed. However, avoid drawing the solution directly onto the chip, otherwise the chip may crack (SiO2 is only 20nm).
[0502] 3. Surface treatment: Remove the ethanol and pipette the freshly prepared Piranah solution (75% sulfuric acid, 25% hydrogen peroxide (30%)) onto the chip. (Allow the Piranah solution to reach room temperature). Leave for 30 minutes.
[0503] 4. Rinse 4 times with distilled water.
[0504] 5. Rinse twice with HK buffer (10mM HEPES pH 8, 1M KCl).
[0505] 6. Assemble the boxes into the flow cell.
[0506] 7. Add 700 μL of HK buffer to each chamber of the flow cell.
[0507] 8. Insert the silver electrode connected to the amplifier and close the Faraday cage.
[0508] 9. Test the resistor with 300 mV. No current should be detected. If current is detected, the chip may be broken and the test must be repeated.
[0509] 10. Connect the electrodes to a 6V DC current and test the current with a multimeter.
[0510] The current should be very low and should not change. Increase the voltage by 1.5 V and hold the voltage until the resistance increases. If the resistance does not increase after 5-10 minutes, increase the voltage by another 1.5 V and try again. Repeat until the resistance increases, at which point the applied voltage should be stopped immediately. (With sufficient voltage, dielectric breakdown occurs, creating a "pore" in the SiO2 film. Initially, the pore is small, but its size increases as the voltage is held.)
[0511] 11. Use an amplifier to test the orifice. At 300 mV, you should see a current of several to several nA. The higher the current, the larger the orifice should be.
[0512] Figure 34The basic functional nanopores are depicted. In each small plot, the y-axis represents current (nA) and the x-axis represents time (s). The left plot, “Screening for RF Noise,” illustrates the practicality of the Faraday cage. A chip without nanopores is placed in a flow cell and 300 mV is applied. Noise reduction is observed when the lid of the Faraday cage is closed (first arrow). A small spike potential occurs when the latch is closed (second arrow). Note that the current is ~0 nA. After the pores are fabricated (middle plot), applying 300 mV (arrow) results in a current of ~3.5 nA. When DNA is applied to the ground chamber and +300 mV is applied, DNA translocation and migration observed at the momentary decrease in current can be seen (right plot). (Note that TS buffer was used in this case: 50 mM Tris, pH 8, 1 M NaCl). Lambda DNA was used for this DNA migration experiment.
[0513] Silver chloride electrode:
[0514] 1. Silver wire is soldered onto insulated copper wire.
[0515] 2. Ground the copper wire and immerse the silver in fresh 30% sodium hypochlorite solution for 30 minutes.
[0516] 3. Silver should have a dark gray coating (silver chloride).
[0517] 4. Rinse the silver thread thoroughly in distilled water and dry it.
[0518] 5. It is now available for use.
[0519] Silanization of beads: The silanization method was initially developed / tested on SiO2-coated magnetic beads (GBioscience). The following scheme was employed:
[0520] 1. Pretreat the beads in fresh Pirannah solution for 30 minutes.
[0521] 2. Wash 3 times with distilled water.
[0522] 3. Wash twice in methanol.
[0523] 4. Dilute the APTES stock solution with methanol at a ratio of 1:500.
[0524] 5. Add the diluted APTES to the beads and incubate at room temperature for 45 minutes.
[0525] 6. Rinse with methanol.
[0526] 7. 100°C for 30 minutes.
[0527] 8. Store in a vacuum.
[0528] Silanization of silicon chips
[0529] 1. Mount the chip with nanopores in the box.
[0530] 2. Rinse with methanol, carefully removing any air bubbles.
[0531] 3. Add fresh Pirannah solution (equilibrate to room temperature) and incubate for 30 minutes.
[0532] 4. Wash 4 times with distilled water.
[0533] 5. Wash three times with methanol.
[0534] 6. Dilute APTES stock solution 1:500 with methanol and wash the chip twice. Incubate at RT for 45 minutes.
[0535] 7. Rinse twice with methanol.
[0536] 8. Dry under an airflow.
[0537] 9. Store overnight under vacuum.
[0538] Streptavidin conjugation on beads: Streptavidin conjugation was initially developed / tested on silanized beads prepared above.
[0539] 1. Wash the silanized beads with modified phosphate-buffered saline (MPBS).
[0540] 2. Prepare a fresh solution of 1.25% glutaraldehyde in MPBS (using 50% glutaraldehyde stock solution, refrigerated).
[0541] 3. Add 1.25% glutaraldehyde to the beads, let stand for 60 minutes, and gently pepet up and down every 15 minutes.
[0542] 4. Wash twice with MPBS.
[0543] 5. Rinse twice with water.
[0544] 6. Vacuum drying.
[0545] 7. Add streptavidin (500 μg / mL in MPBS) to the beads and incubate for 60 minutes. (For negative control beads, use bovine serum albumin (BSA) (2 mg / mL in MPBS) instead of streptavidin).
[0546] 8. Remove streptavidin and add BSA (2 mg / mL, in MPBS). Incubate for 60 minutes.
[0547] 9. Wash twice in MPBS.
[0548] 10. Store at 4°C.
[0549] Streptomycin conjugation for silicon chips
[0550] 1. Rinse the silanized chip twice with ethanol.
[0551] 2. Rinse the silanized chip twice with MPBS.
[0552] 3. Prepare a fresh solution of 1.25% glutaraldehyde in MPBS (using 50% glutaraldehyde stock solution, refrigerated).
[0553] 4. Rinse the chip twice with 1.25% glutaraldehyde, let stand for 60 minutes, and gently aspirate up and down every 15 minutes.
[0554] 5. Wash twice with MPBS
[0555] 6. Wash twice with water
[0556] 7. Airflow drying
[0557] 8. Add BSA (2 mg / mL in MPBS) to one half of the chip, and add another streptavidin (500 μg / mL in MPBS). Incubate for 60 minutes. Mark the box to indicate which half of the chip is streptavidin-modified.
[0558] 9. Rinse both halves of the chip with BSA (2 mg / mL in MPBS). Incubate for 60 minutes.
[0559] 10. Wash with MPBS.
[0560] The buffer solution used in this article was prepared as follows:
[0561] MPBS: 8 g / L NaCl, 0.2 g / L KCl, 1.44 g / L disodium phosphate, 0.240 g / L potassium phosphate, 0.2 g / L polysorbate-20 (pH 7.2)
[0562] PBS: 8 g / L NaCl, 0.2 g / L KCl, 1.44 g / L disodium phosphate, 0.240 g / L potassium phosphate
[0563] TS: 50mM Tris, pH 8.0, 1M NaCl
[0564] HK: 10mM HEPES pH 8.0, 1M KCl
[0565] TE: 10mM Tris, 1mM EDTA, pH 8.0
[0566] Pirannah solution: 75% hydrogen peroxide (30%) + 25% sulfuric acid
[0567] APTES stock solution: 50% methanol, 47.5% APTES, 2.5% nano-pure water. Aging at 4ºC for at least 1 hour. Store at 4°C.
[0568] PDC stock solution: 0.5% w / v 1,4-phenylene diisothiocyanate in DMSO
[0569] Ordered oligonucleotides (5' to 3'):
[0570]
[0571] Oligonucleotide pair hybridization is performed as follows:
[0572] 1. Prepare a stock solution of oligomers with a concentration of 100 μM in TE buffer.
[0573] 2. Dilute the oligomer to 10 μM in PBS.
[0574] 3. Heat to 85°C in a thermal cycler and maintain for 5 minutes.
[0575] 4. Reduce the temperature by 5°C every 3 minutes, until it reaches 25°C.
[0576] 5. Store at 4°C or -20°C
[0577] Streptavidin conjugation: The conjugation of streptavidin to SiO2 was developed and tested using SiO2-coated magnetic beads, and the protocol was then adapted to a SiO2 chip. Binding of biotinylated oligonucleotides to streptavidin and BSA-conjugated beads was tested. As expected, negligible binding was observed with BSA-conjugated beads, while strong binding was observed with streptavidin-conjugated beads. See also Figure 38 Since conjugation is more convenient in high salt conditions (DNA movement occurs in high salt), the binding capacity of the beads in HK buffer was also tested. Binding in HK buffer was comparable to binding in MPBS buffer. Figure 39 ).
[0578] As mentioned above Figures 35-37 As described above, the origami construction was prepared and confirmed to be operable. The biotinylation of the origami construction was tested using oligonucleotides. [The text abruptly ends here, likely due to an incomplete sentence or missing information.] Figure 37 The described 'origami' results indicate that the AlwNI site is active.
[0579] The following uses oligonucleotide pairs (o1 / o3) to reconstruct precise sequence segments in origami DNA. Origami molecules, such as... Figure 48 As shown.
[0580] Oligomer pair o1 / o3 is
[0581]
[0582] DNA was digested with AlwNI in the presence of T4 DNA ligase and biotinylated oligonucleotides complementary to the overhangs on the 3' side of the origami sequence (which are themselves attached to the long ssDNA sequence, which is itself attached to the other side of the origami sequence), according to the following reaction:
[0583]
[0584] In this strategy, AlwN1 cleaves the target DNA. When ligase is added, the DNA can be re-ligated, but the restriction enzyme will cleave it again. However, if / when the (right) fragment (o1 / o3) binds to BN1 / N2, no restriction enzyme site is regenerated, and therefore the product is not cleaved. Specific attachment is confirmed by testing with and without restriction enzymes:
[0585]
[0586] Add all reagents except the ligase and incubate the solution at 37°C for 60 minutes. Add the ligase and incubate the solution at 16°C overnight. 10x lig buffer refers to NEB 10x T4 DNA ligase buffer. The ligase is NEB T4 DNA ligase. o1 / o3 and n1 / n2 refer to annealed oligonucleotide pairs, as described above. The unit is μL. Agarose gel analysis confirmed that in the presence of AlwNI, larger products are formed, corresponding to biotinylated oligonucleotides attached to the long ssDNA arms linked to the origami structure. A similar strategy is used for 3' biotinylation when needed.
[0587] Above, we demonstrated the ability to form and use nanopores to detect voltage-induced transport of DNA through the pores, producing origami molecules with long ss regions of biotin attached to their distal ends, and streptavidin conjugated to silica, used to capture biotinylated DNA. These tools are used to attach and control the movement of individual DNA molecules adjacent to nanopores.
[0588] The first step was to conjugate streptavidin to one surface of the SiO2 nanopores (and BSA to the other side). This was accomplished according to the scheme described above. The resulting pores tended to have a lower current than they originally possessed. After a brief 6V pulse, the current recovered to near its original value. The functional nanopores at this point... Figure 40 As shown.
[0589] Next, insert the origami DNA. When the origami DNA is added to the appropriate chamber and the current is turned on, the origami will be inserted into the chamber. Figure 41The diagram illustrates this phenomenon. Experiments when origami was introduced at a final concentration of 50 pM confirmed that the DNA with origami inserted into the pores relatively quickly (typically in seconds), which could be detected by the decrease in the current flowing through the nanopores (e.g., in these experiments, the current was ~3 nA before insertion and ~2.5 nA after insertion). If the current is allowed to run for a longer period, double insertion can be observed. If higher concentrations are used, the insertion occurs too quickly to be observed.
[0590] The insertion of DNA and its binding to the chip. After inserting the origami into the nanopore, 15 minutes are allowed before voltage is applied again. The ends of the ssDNA region of the origami contain biotin, and streptavidin is conjugated to the surface of the nanopore. The affinity constant of streptavidin for binding to avidin is close to that of a covalent bond. The 15-minute time allows the DNA to diffuse and allows the biotinylated ends to find and bind to streptavidin. If the DNA has actually attached to the surface, the observed current should be slightly lower than the current seen before when the voltage is reversed. Furthermore, switching the current back and forth should result in currents in both directions that are lower than the current seen in the free pore. In the embodiment shown here, the free pore exhibits a current of ~3 nA. Figure 42 The diagram shows a representation of connected DNA. Figure 43 Experimental results for voltage switching of connected origami DNA are shown. It is noted that the current observed in both directions is ~+ / - 2.5 nA, which is lower than the ~+ / - 3 nA observed with the free pore. If the DNA is not bound to the surface, the original current will be restored upon voltage switching. Figure 44 ).
[0591] To remove the origami structure, remove the buffer from the flow cell containing the origami structure and replace it with 1x Swa1 buffer containing 1 µL Swa1 / 20°L. Replace the buffer in the other flow cell with 1x Swa1 buffer without Swa1. Incubate at room temperature for 60 minutes, then wash with HK buffer and apply voltage. Figure 45 The DNA shown moves back and forth by Figure 46 Experimental data confirmed that the immobilized DNA moved in a controlled manner through SiO2 nanopores.
[0592] Example 8 - An alternative method for attaching polymers to surfaces adjacent to nanopores
[0593] The foregoing embodiments describe attaching DNA to a surface adjacent to a nanopore by biotinylating DNA and coating the attachment surface with streptavidin. Figure 47 The paper describes some alternative methods for linking polymers.
[0594] a) DNA hybridization: In one method, the DNA extended in the method of the present invention hybridizes with short oligonucleotides attached near the nanopores. Once synthesis is complete, the synthesized DNA can be easily removed without the need for restriction enzymes, or the double strand formed by the bound oligonucleotides and the synthesized DNA can provide a substrate for the restriction enzymes. In this embodiment, the short oligomers are surface-conjugated using biotin-streptavidin, or linked using 1,4-phenylene diisothiocyanate as follows:
[0595] The conjugation of biotinylated DNA with SiO2:
[0596] A. Silanization:
[0597] 1. Pretreatment: NHA solution for 30 minutes, followed by washing with double-distilled water (ddH2O).
[0598] 2. Preparation of APTES stock solution: 50% MeOH, 47.5% APTES, 2.5% nanopure water: Aging > 1 hour at 4°C
[0599] 3. Dilute the Aptex stock solution 1:500 in MeOH.
[0600] 4. Incubate the chip at room temperature
[0601] 5. Rinse with MeOH
[0602] 6. Drying
[0603] 7. Heat at 110°C for 30 minutes.
[0604] Adhesion:
[0605] 1. Treat the chip with PDC stock solution for 5 hours (room temperature) (PDC stock solution: 0.5% w / v 1,4-phenylene diisothiocyanate in DMSO)
[0606] 2. Rinse twice in DMSO (quick!)
[0607] 3. Wash twice in ddH2O (quick!)
[0608] 4. 100 nM amino-modified DNA in ddH2O (pH 8) O / N 37℃
[0609] 5. Wash twice with 28% ammonia solution (to remove activation)
[0610] 6. Wash twice with ddH2O
[0611] As described above, a single-stranded DNA with a terminal sequence complementary to the linked oligonucleotide is introduced and hybridized to the linked oligonucleotide.
[0612] b) Click chemistry: Click chemistry is a general term for simple and thermodynamically efficient reactions that do not produce toxic or highly reactive byproducts and operate in water or biocompatible solvents, and are often used to link selected substrates with specific biomolecules. Click conjugation in this case uses chemicals similar to those used in a), to link oligonucleotides, here only for linking polymers that extend during synthesis in the method of this invention. Although DNA is a polymer in this example, such chemicals can work to attach other polymers functionalized by the addition of compatible azide groups.
[0613] Silanization:
[0614] 1. Pretreatment: Piranha solution 30°C, wash with ddH2O
[0615] 2. Preparation of PS (propargylsilane) stock solution: 50% MeOH, 47.5% PS, 2.5% nanopure water: aging > 1 hour at 4°C
[0616] 3. Dilute the Aptex stock solution 1:500 in MeOH.
[0617] 4. Incubate the chip at room temperature
[0618] 5. Rinse with MeOH
[0619] 6. Drying
[0620] 7. Heat at 110°C for 30 minutes.
[0621] DNA terminated in an azide functional group will covalently bind to this surface (e.g., Figure 47 (As shown). The azide-terminated oligonucleotides are ordered and attached to the longer origami DNA, as previously described for the biotin addition to DNA.
[0622] Some implementation schemes disclosed herein are as follows:
[0623] 1. A method for synthesizing a charged polymer comprising at least two different monomers in a nanochip, said nanochip comprising
[0624] One or more addition chambers containing reagents for adding one or more monomers or oligomers to a charged polymer in a buffer solution in an end-protected manner, such that only a single monomer or oligomer can be added in a reaction cycle; and
[0625] One or more storage chambers containing buffer solutions but not all the reagents required for the addition of one or more monomers or oligomers.
[0626] The chambers are separated by one or more membranes containing one or more nanopores, and
[0627] The charged polymer is able to pass through the nanopores, and at least one reagent used to add one or more monomers or oligomers is not able to pass through the nanopores.
[0628] The method includes
[0629] a) A charged polymer having a first end and a second end is moved into the addition chamber by electroattraction, thereby adding a monomer or oligomer to the first end in a closed form.
[0630] b) Move the first end of the charged polymer having monomers or oligomers added in a closed form into the reservoir.
[0631] c) Deblocking the added monomer or oligomer, and
[0632] d) Repeat step ac until the desired polymer sequence is obtained, wherein the monomers or oligomers added in step a) are the same or different.
[0633] 2. The method of implementation scheme 1, wherein the charged polymer is DNA.
[0634] 3. A method for synthesizing nucleic acids in a nanochip, said nanochip comprising at least a first chamber and a second chamber separated by a membrane comprising at least one nanopore, said synthesis being carried out in a buffer solution by a cycle of adding nucleotides to the first end of a nucleic acid having a first end and a second end, wherein the first end of the nucleic acid is moved by electro-attraction between one or more addition chambers (containing reagents capable of adding nucleotides or oligomers) and one or more reserve chambers (not containing reagents necessary for adding nucleotides or oligomers), said chambers being separated by one or more membranes, each membrane comprising one or more nanopores, wherein the nanopores are large enough to allow nucleic acids to pass through but too small to allow at least one reagent necessary for adding nucleotides to pass through.
[0635] 4. The method of implementation scheme 3, wherein the reagent used to add nucleotides to nucleic acids comprises a polymerase.
[0636] 5. The method of embodiment 3 or 4, wherein the nucleotide is added in a 3'-protected form, and wherein the reservoir contains a reagent capable of deprotecting the added nucleotide.
[0637] 6. A method for synthesizing DNA in a nanochip, comprising one or more addition chambers containing nucleotides or oligonucleotides loaded with a topoisomerase, and one or more reserve chambers containing a restriction enzyme or phosphatase, said chambers further containing a compatible buffer solution and separated by a membrane comprising at least one nanopore, wherein the nanopore is small enough that the topoisomerase and the restriction enzyme or phosphatase cannot pass through the nanopore, the synthesis being carried out by a cycle of adding nucleotides or oligonucleotides to the first end of a nucleic acid having a first end and a second end, wherein the first end of the nucleic acid is moved by electroattraction between the one or more addition chambers and the one or more reserve chambers.
[0638] 7. The method of implementation scheme 6, wherein a single nucleotide is added in each cycle.
[0639] 8. A method for synthesizing DNA molecules using topoisomerase-mediated ligation, by adding a single nucleotide or oligomer to a DNA strand in the 3' to 5' direction, comprising (i) reacting the DNA molecule with a topoisomerase carrying the desired nucleotide or oligomer, wherein the nucleotide or oligomer is prevented from being added further at the 5' end, and then (ii) unblocking the 5' end of the thus formed DNA, and repeating steps (i) and (ii) until the desired nucleotide sequence is obtained.
[0640] 9. The method of embodiment 8, comprising adding a single nucleotide in the 3' to 5' direction, wherein in step i), a topoisomerase is loaded with the desired nucleotide in the 5' phosphorylated form, thereby adding the desired nucleotide in the 5' protected form to the 5' end of the DNA, and in step ii), the 5' end of the DNA is formed by dephosphorylating the added nucleotide.
[0641] 10. An oligonucleotide comprising a topoisomerase binding site, an information sequence, and a restriction site, which, when cleaved by a restriction enzyme, produces a topoisomerase linker site.
[0642] 11. A topoisomerase conjugated to a single nucleotide, wherein the topoisomerase is conjugated by a 3'-phosphate of a nucleotide, and said nucleotide is phosphorylated at the 5' position.
[0643] 12. A single-stranded or double-stranded DNA molecule, wherein the single-stranded or coding sequence is substantially composed of non-hybridized bases.
[0644] 13. A method for storing information, comprising synthesizing a charged polymer comprising at least two different monomers or oligomers (including nucleic acids or DNA) according to any one of embodiments 1-9, wherein the sequences of said monomers correspond to machine-readable code.
[0645] 14. The method of embodiment 13, wherein the charged polymer or a copy of the charged polymer is removed from the nanochip after synthesis is complete.
[0646] 15. The method of embodiment 13, wherein the charged polymer is retained in the nanochip after synthesis.
[0647] 16. A nanochip for synthesizing a charged polymer, such as DNA, comprising at least two different monomers, the nanochip comprising at least a first reaction chamber and a second reaction chamber separated by a membrane comprising one or more nanopores, wherein each reaction chamber comprises one or more electrodes for drawing the charged polymer into the chamber, and wherein the first reaction chamber further comprises an electrolyte medium and a reagent for adding a monomer or oligomer to the polymer, wherein the monomer or oligomer is protected such that only one monomer or oligomer can be added at a time, and wherein the second reaction chamber further comprises an electrolyte medium and a reagent for deprotecting the added monomer or oligomer, wherein the nanopores are large enough to allow the polymer to pass through but too small to allow the passage of at least one reagent for adding the monomer or oligomer to the polymer and at least one reagent for deprotecting the added monomer or oligomer, respectively.
[0648] 17. A nanochip for sequencing a charged polymer, such as DNA, comprising at least two different monomers, the nanochip comprising at least a first reaction chamber and a second reaction chamber, the first and second reaction chambers comprising an electrolyte medium and separated by a membrane comprising one or more nanopores, wherein each reaction chamber comprises at least a pair of electrodes disposed on opposite sides of the membrane, wherein the electrodes are operatively connected to a capacitive circuit capable of providing radio frequency pulsed DC current through the nanopores at a frequency of, for example, 1 MHz to 1 GHz, such as 50-200 MHz, such as about 100 MHz, wherein the pulsed DC current is capable of attracting the charged polymer through the nanopores, and wherein the monomer sequence can be determined by measuring the capacitance change on the nanopores as the charged polymer passes through the nanopores.
[0649] 18. A method for reading monomer sequences of a charged polymer, such as a DNA molecule, comprising at least two different types of monomers, comprising applying a radio frequency pulsed direct current at a frequency of 1 MHz to 1 GHz, such as 50-200 MHz, for example about 100 MHz, through a nanopore, wherein the pulsed direct current attracts the charged polymer through the nanopore, and the monomer sequence is determined by measuring the capacitance change on the nanopore as the charged polymer passes through the nanopore.
[0650] 19. The method of embodiment 18, wherein the capacitance change is measured by measuring the impedance change in the radio frequency signal caused by the capacitance change as the polymer passes through the nanopore.
[0651] 20. The method of embodiment 18 or 19, which is a method for reading binary code encoded in a sequence of charged polymers containing at least two different monomers.
Claims
1. A method for synthesizing DNA molecules using topoisomerase-mediated ligation, by adding a mononucleotide or oligomer to a DNA strand in the 3' to 5' direction, comprising (i) reacting the DNA molecule with a topoisomerase carrying the desired nucleotide or oligomer, wherein the nucleotide or oligomer is blocked at the 5' end to prevent further addition, and then (ii) unblocking the 5' end of the thus formed DNA, and repeating steps (i) and (ii) until the desired nucleotide sequence is obtained.
2. The method of claim 1, wherein a single nucleotide is added.
3. The method of claim 1, wherein an oligomer is added.
4. The method of any one of claims 1-3, wherein the step of unblocking the 5' end of the DNA is performed using a phosphatase.
5. The method of any one of claims 1-4, wherein the DNA is double-stranded and the method further comprises the step of: providing a ligase and ATP to repair DNA strands not ligated by a topoisomerase.
6. The method of any one of claims 1-5, wherein the donor oligonucleotide carrying the topoisomerase comprises a 5' overhang on a strand complementary to the strand carrying the topoisomerase, and comprises a polyinosine sequence.
7. The method of any one of claims 1-6, wherein the topoisomerase is selected from vaccinia topoisomerase and SVF topoisomerase I.
8. The method of claim 7, wherein a vaccinia topoisomerase recognizing (C / T)CCTT is used for adding deoxythymidine triphosphate (dTTP) nucleotides, and an SVF topoisomerase I recognizing CCCTG is used for adding deoxyguanosine triphosphate (dGTP) nucleotides.
9. The method of any one of claims 1-8, wherein the nanopore separates the chamber containing the topoisomerase from the chamber containing the phosphatase, wherein the nanopore is large enough to allow DNA to move through the nanopore by electroattraction, but not large enough to allow the topoisomerase and the phosphatase to move through the nanopore.
10. The method of any one of claims 1-9, wherein the DNA is on a matrix or magnetic beads, whereby the DNA may be selectively exposed to or removed from the reagent as needed to provide the desired sequence.
11. A method for synthesizing DNA molecules using topoisomerase-mediated ligation, comprising adding oligomers to a DNA strand in the 3' to 5' direction, comprising (i) reacting the DNA molecule with a topoisomerase carrying the desired oligomer, then (ii) removing all of the added oligomer except for a single base using an IIS-type restriction enzyme; (iii) dephosphorylating the 5' end of the thus formed DNA using a phosphatase; and repeating steps (i), (ii), and (iii) until the desired nucleotide sequence is obtained.
12. The method of claim 11, wherein the topoisomerase is selected from vaccinia topoisomerase and SVF topoisomerase I.
13. The method of claim 12, wherein a vaccinia topoisomerase recognizing (C / T)CCTT is used for adding deoxythymidine triphosphate (dTTP) nucleotides, and an SVF topoisomerase I recognizing CCCTG is used for adding deoxyguanosine triphosphate (dGTP) nucleotides.
14. The method of any one of claims 11-13, wherein the nanopore separates a chamber containing a topoisomerase from a chamber containing a phosphatase, wherein the DNA is capable of moving through the nanopore by electroattraction, but the topoisomerase and the phosphatase are not capable of passing through the nanopore.
15. The method of any one of claims 11-14, wherein the DNA is on a matrix or magnetic beads, whereby the DNA may be selectively exposed to or removed from the reagent as needed to provide the desired sequence.
16. A method for synthesizing DNA in a nanochip, said nanochip comprising one or more addition chambers containing oligonucleotides with topoisomerases bound at their 3' ends and one or more reserve chambers containing phosphatases and optionally restriction enzymes, said chambers further containing compatible buffer solutions and separated by a membrane comprising at least one nanopore, said enzymes being prevented from passing through said nanopore, said method comprising: (i) The 5' end of the receiver DNA is moved into a first addition chamber by means of electricity, wherein the first addition chamber contains a donor oligonucleotide loaded with a topoisomerase; (ii) Allow sufficient time for donor oligonucleotides to ligate and thereby extend the acceptor DNA; (iii) The 5' end of the thereby extended receiver DNA is moved into a storage chamber by electric current, wherein the 5' end of the receiver DNA is dephosphorylated by the phosphatase; and (v) Repeat steps (i)-(iiii) in a loop, adding oligonucleotides with the same or different informational sequences until the desired DNA sequence is obtained.
17. The method of claim 16, wherein the enzyme is bound to the substrate.
18. The method of claim 16 or 17, wherein the restriction endonuclease is present in the reservoir, and step (iii) further comprises cleaving the oligonucleotide added to the acceptor DNA by means of the restriction enzyme at a position one nucleotide away from the oligonucleotide added by the topoisomerase in the 5' direction, such that each cycle of steps (i)-(iii) adds a single base to the 5' end of the acceptor DNA.
19. The method of any one of claims 16-18, wherein a single nucleotide is added in each cycle.
20. A method for synthesizing a charged polymer comprising at least two different monomers in a nanochip, said nanochip comprising One or more addition chambers containing reagents for adding one or more monomers or oligomers to a charged polymer in a buffer solution in an end-protected manner, such that only a single monomer or oligomer can be added in a reaction cycle; and One or more storage chambers containing a buffer solution but not all reagents required for adding the one or more monomers or oligomers. The chambers are separated by one or more membranes containing one or more nanopores, and The nanopores are large enough to allow the charged polymer to pass through, but too small to allow reagents used to add one or more monomers or oligomers to pass through. Thus, the charged polymer can pass through the nanopores, and at least one reagent used to add one or more monomers or oligomers cannot pass through the nanopores. The method includes a) A charged polymer having a first end and a second end is moved into the addition chamber by electroattraction, thereby adding a monomer or oligomer to the first end in a closed form. b) Move the first end of the charged polymer having monomers or oligomers added in a closed form into the reservoir. c) Deblocking the added monomer or oligomer, and d) Repeat step ac until the desired polymer sequence is obtained, wherein the monomers or oligomers added in step a) may be the same or different. in, The charged polymer is DNA, the monomer is a nucleotide, and the oligomer is an oligonucleotide.