Use of miR-17 as a marker in preparation of a diagnostic reagent for spinal cord injury

Abstract

This invention discloses the application of miR-17 as a biomarker in the preparation of diagnostic reagents for spinal cord injury, belonging to the field of biomedical technology. In a rat SCI model, the expression of miR-17-3p and miR-17-5p in spinal cord injury tissues significantly increased after 7 and 14 days, while the expression of downstream target genes of miR-17 also changed. Therefore, miR-17-3p and / or miR-17-5p can serve as biomarkers for the diagnosis of spinal cord injury.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of miR-17 as a biomarker in the preparation of diagnostic reagents for spinal cord injury. Background Technology

[0002] Spinal cord injury (SCI) is a severe central nervous system injury that often leads to severe sensory and motor dysfunction in the limbs below the injured segment, causing varying degrees of paralysis. SCI not only causes severe physical and psychological harm to patients but also imposes a huge economic burden on society. To date, neither drug nor surgical treatments for SCI have achieved satisfactory clinical results.

[0003] MicroRNAs (miRNAs) are a class of endogenous non-coding small RNAs, typically composed of 20-25 nucleotides, that primarily regulate gene expression at the post-transcriptional level. Various changes at the cellular and molecular levels are considered closely related to the expression levels of numerous genes, which coordinate with each other to form a regulatory network. miRNAs are the regulators of this entire gene expression pathway. Increasing research indicates that miRNAs play important roles in various cellular physiological and pathological processes, such as proliferation, differentiation, apoptosis, and axonal regeneration. Studies have shown that at least one-third of human protein-coding genes are regulated by miRNAs. Therefore, researching miRNA-based therapeutic strategies holds promise as a new avenue for improving the condition of patients with cerebral infarction (SCI).

[0004] Gene chip analysis revealed abnormal expression of many miRNAs after spontaneous intraepithelial neoplasia (SCI), and these miRNAs are closely related to apoptosis, inflammatory responses, and oxidative stress after SCI; in particular, miR-17 expression was significantly upregulated. Previous studies have found that increased miR-17 can inhibit cell proliferation, migration, and adhesion. miR-17 is a member of the miR-17-92 gene cluster, and studies have shown that miR-17 plays an important role in tumor formation and angiogenesis. Studies of the central nervous system have found that the miR-17-92 gene cluster can regulate myelin production, but research on its specific role in the course of SCI is still limited.

[0005] miRNAs have become a popular technology in gene function and therapeutic research. They can specifically silence the expression of endogenous or exogenous target genes and effectively prevent the expression of related proteins. Currently, various miRNA silencing strategies are maturing in miRNA functional research, primarily using miRNA inhibitors to prevent miRNAs from exerting their regulatory effects. The principle is that siRNA binds to mature miRNA sequences, thereby blocking the miRNA's biological activity. Clinical trials have also achieved significant success in treating hepatitis C caused by HCV infection using targeted silencing miRNA-122 technology, greatly encouraging the development of miRNA-based therapeutics. Since miRNAs play a role after spinal cord injury, it is speculated that the use of RNA interference may provide a target for the treatment of spinal cord injury (SCI). Summary of the Invention

[0006] One objective of this invention is to provide a biomarker for diagnosing spinal cord injury, wherein the biomarker is miR-17-3p and miR-17-5p, and the subject is diagnosed with spinal cord injury when the expression levels of miR-17-3p and / or miR-17-5p in the subject's biological sample are significantly higher than those of healthy individuals.

[0007] Furthermore, the subject's biological sample is selected from one or more of blood, cerebrospinal fluid, and / or spinal cord tissue.

[0008] Furthermore, the biological sample from the subject was spinal cord tissue.

[0009] The second objective of this invention is to improve the application of the above-mentioned biomarkers in the preparation of reagents for diagnosing spinal cord injury, wherein the reagents are reagents for detecting miR-17-3p and / or miR-17-5p; when the expression levels of miR-17-3p and / or miR-17-5p in the biological sample of a subject are significantly higher than those of healthy individuals, the subject is diagnosed with spinal cord injury.

[0010] Furthermore, the subject's biological sample is selected from one or more of blood, cerebrospinal fluid, and / or spinal cord tissue.

[0011] A third objective of this invention is to provide a kit for diagnosing spinal cord injury, the kit containing the reagents described above; when the expression levels of miR-17-3p and / or miR-17-5p in the biological sample of a subject are significantly higher than those of healthy individuals, the subject is diagnosed with spinal cord injury.

[0012] A fourth objective of this invention is to provide miR-17-3p and / or miR-17-5p as targets for the preparation of drugs for treating spinal cord injury.

[0013] Differentially expressed miRNAs after spinal cord injury (SCI) participate in a series of biological processes, such as inflammatory response, cell proliferation, apoptosis, axonal regeneration, and myelination; they have a profound impact on the recovery of spinal cord motor and sensory functions after SCI. To investigate the biological functions of miR-17 in regulating SCI, we first screened candidate target genes for miR-17 using a target gene database, and then validated these candidate target genes. Understanding the signaling pathways and regulatory mechanisms related to miRNAs can provide a reliable theoretical basis for miR-17's involvement in regulating SCI repair. Attached Figure Description

[0014] Figure 1 The results show the expression changes of miR-17 at different time points after SCI. In the figure, A represents the expression change of miR-17-5p after SCI analyzed by RT-PCR, and B represents the expression change of miR-17-3p after SCI analyzed by RT-PCR. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001.

[0015] Figure 2 This image shows the cellular localization results of miR-17 in spinal cord tissue. In the image, A shows the co-labeling of miR-17-5p and oligodendrocytes, B shows the co-labeling of miR-17-3p and oligodendrocytes, and C shows the co-labeling of miR-17 and oligodendrocytes. CNPase labels oligodendrocytes (green); miR-17-5p (red); and DAPI labels cell nuclei (blue). Scale bar: 50 μm.

[0016] Figure 3 To analyze the expression changes of fibronectin, FNDC3A, EphA5, and Dclk1 in spinal cord tissue after spinal cord injury (SCI) using RT-PCR. In the figures, A represents decreased fibronectin expression, B represents increased FNDC3A expression, C represents increased EphA5 expression, and D represents increased Dclk1 expression. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. Detailed Implementation

[0017] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0018] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0019] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Example 1

[0020] I. Experimental Methods 1. SCI Model Construction Twenty-five female Sprague Dawley rats weighing 200–220 g were randomly divided into a SCI group (n=20) and a sham-operated group (n=7). Under anesthesia, a dorsal laminectomy was performed to expose the dorsal tissue between the T8 and T10 thoracic vertebrae. At the T9 region, a 2.0 mm tip was lowered with a force of 1.5 kDaydine. The sham-operated animals were only anesthetized and underwent laminectomy, without contrast damage.

[0021] 2. RT-PCR experiment and primers Total RNA was extracted from spinal cord tissue according to the instructions (QIAGEN, Chatsworth, CA, USA). RNA was reverse transcribed into cDNA for RT-PCR (ThermoFisherScience, Waltham, MA, USA). miRNA-specific reverse transcription primers and PCR primers were purchased from Applied Biosystems, and primers for the miRNA-17 candidate target gene were synthesized by Invitrogen.

[0022]

[0023] 3. In situ hybridization and probes Spinal cord slides were removed from -80℃ and incubated overnight at 37℃. Slides were fixed with 4% PA for 10 min, washed three times with PBS, and placed in a humidified chamber. 200 µl of proteinase K working solution was added to each slide, and incubation was performed at 37℃ for 10 min. After washing three times with PBS, slides were dehydrated sequentially with 70% ethanol, 96% ethanol, and 99.9% ethanol, and allowed to air dry. 40 µl of hybridization probe working solution was added to each slide, covered with a sterile, RNase-free paraffin membrane, and incubated in a humidified chamber for 2 h. The paraffin membrane was removed, and SSC hybridization was performed, washing five times at room temperature, washing three times with PBS, adding 1× blockbuster, and blocking in a humidified chamber at room temperature for 15 min. Goat anti-DIG-AP was added and incubated at room temperature for 2 h. The slides were washed three times with PBS, washed once with 1× detection buffer A, and incubated with NBT / BCIP at 30℃ in the dark for 2 h. The reaction was terminated, and the slides were washed three times sequentially with KTBT and RNase-ddH2O. Alcohol 1 dehydrated, neutral resin mounting.

[0024] All probes used for in situ hybridization were 5' digoxigenin-labeled oligonucleotides (DIG-LNA) probes, purchased from EXIQON. Probe sequences: Scramble-miR: 5'-3' / 5'DigN / GTGTAACACGTCTATACGCCCA; has-miR-17:5'-3' / 5'DigN / TACCTGCACTGTAAGCACTTTG; has-miR-17-3p: 5'-3' / 5'DigN / CCACAAGTGCCTTCACTGCAGT.

[0025] 4. In situ hybridization and immunofluorescence double labeling In situ hybridization was performed as above. After blocking with sheep serum for 20 minutes, the primary immunofluorescence antibody was added and incubated overnight at 4°C. The slides were washed three times with PBS, then the secondary antibody (FITC, diluted 1:100) was added and incubated at room temperature for 2 hours. After washing three times with PBS, Fast Red TR / HNPP was added and incubated at room temperature for 30 minutes. After washing three times with PBS, the slides were mounted with DAPI-based anti-fluorescence quenching mounting medium.

[0026] II. Experimental Results 1. Detecting changes in miR-17 expression at different time points in SCI studies. After spinal cord injury surgery, RNA was extracted from the spinal cord injury tissue, and changes in miR-17 expression at different time points were detected. For example... Figure 1 As shown, the expression of miR-17-5p did not change significantly within 1d and 3d after SCI; however, the expression level of miR-17-5p increased significantly after 7d and 14d, and the expression level of miR-17-3p also increased at 7d and 14d.

[0027] 2. Detection of miR-17 cellular localization in the spinal cord In situ hybridization and immunofluorescence techniques were used to detect the cellular localization of miR-17 in spinal cord tissue. Related literature reports that miR-17 is highly expressed in oligodendrocytes; therefore, astrocyte antibody GFAP, oligodendrocyte antibody CNPase, neuronal antibody NF-200, and microglia antibody CD11b were used to perform in situ hybridization and immunofluorescence experiments with miR-17, respectively. Figure 2 As shown in Figure AB, miR-17 is co-localized and expressed only in oligodendrocytes, primarily within the cytoplasm. To further validate this, oligodendrocytes were isolated and purified in vitro, and miR-17 in situ hybridization and immunofluorescence experiments were performed again. Figure 2 As shown in Figure C, miR-17 is expressed in the cytoplasm of oligodendrocytes.

[0028] 3. Detect changes in the expression of downstream target genes of miR-17. miRNAs exert negative regulatory effects on downstream target genes. This study examined the expression changes of candidate target genes fibronectin, FNDC3A, EphA5, and Dclk1 after spinal cord injury (SCI) to further investigate the role of miRNAs in SCI. The expression trends of FNDC3A, EphA5, and Dclk1 were consistent, but not directly correlated with the expression trend of miR-17. Fibronectin can promote glial scar formation by binding to integrins and mediating cell adhesion, proliferation, and tissue development. The decreased expression of fibronectin after SCI injury suggests that miR-17 may participate in glial scar formation in SCI by negatively regulating fibronectin.

[0029] like Figure 3 As shown in Figure A, fibronectin expression levels significantly decreased on days 7 and 14 after SCI; Figure 3 As shown in the BD image, the expression levels of FNDC3A, EphA5, and Dclk1 gradually increased after injury. The expression of fibronectin not only validates the role of miRNAs in negatively regulating target genes but also establishes its potential as a downstream target gene.

Claims

1. A biomarker for diagnosing spinal cord injury, characterized by, The biomarkers are miR-17-3p and miR-17-5p. When the expression levels of miR-17-3p and / or miR-17-5p in the subject's biological sample are significantly higher than those in healthy individuals, the subject is considered to have spinal cord injury.

2. The biomarker according to claim 1, characterized in that, The subject's biological sample was selected from one or more of blood, cerebrospinal fluid, and / or spinal cord tissue.

3. The biomarker according to claim 2, characterized in that, The biological sample from the subject was spinal cord tissue.

4. The application of the biomarker according to claim 1 in the preparation of reagents for diagnosing spinal cord injury, characterized in that, The reagent is used to detect miR-17-3p and / or miR-17-5p; if the expression levels of miR-17-3p and / or miR-17-5p in the subject's biological sample are significantly higher than those in healthy individuals, then the subject has spinal cord injury.

5. The application according to claim 4, characterized in that, The subject's biological sample was selected from one or more of blood, cerebrospinal fluid, and / or spinal cord tissue.

6. A reagent kit for diagnosing spinal cord injury, characterized in that, The kit contains reagents for detecting the biomarkers of claim 1; when the expression levels of miR-17-3p and / or miR-17-5p in the subject's biological sample are significantly higher than those in healthy individuals, the subject has spinal cord injury.

7. Application of miR-17-3p and / or miR-17-5p as targets in the preparation of drugs for the treatment of spinal cord injury.

Images