A circular RNA associated with prostate cancer and its applications

Abstract

This invention belongs to the field of biomedical technology and discloses a circular RNA (circRNA) associated with prostate cancer and its applications. The circular RNA is named hsa_circ_0003074, and its nucleotide sequence is shown in SEQ ID NO.1. This invention verifies its potential as a molecular marker for prostate cancer diagnosis. Furthermore, this invention constructs a small interfering RNA and a lentiviral vector targeting hsa_circ_0003074. Experiments demonstrate that knocking down the expression of hsa_circ_0003074 significantly inhibits the proliferation and migration of prostate cancer cells. Therefore, hsa_circ_0003074 possesses the potential to serve as a diagnostic marker, therapeutic target, and drug development tool for prostate cancer, providing a new strategy for its diagnosis and treatment.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a circular RNA (circRNA) associated with prostate cancer, and its application as a diagnostic marker and therapeutic target in the diagnosis and treatment of prostate cancer. Background Technology

[0002] Prostate cancer is one of the most common malignant tumors in men worldwide, ranking second in incidence and fifth in mortality among male cancers. In my country, the incidence of prostate cancer is showing a continuous upward trend, particularly in economically developed regions.

[0003] Currently, clinical screening primarily relies on serum prostate-specific antigen (PSA). However, PSA has significant limitations: it exhibits a "gray area" phenomenon and has poor specificity, easily affected by benign diseases such as prostatitis and benign prostatic hyperplasia, leading to numerous false positive results and unnecessary biopsies. Therefore, there is an urgent clinical need to discover novel non-invasive or minimally invasive biomarkers with high sensitivity and specificity to compensate for the shortcomings of existing detection methods.

[0004] Furthermore, the leading cause of death from prostate cancer is its progression to metastatic castration-resistant prostate cancer (mCRPC). Tumor cells in the mCRPC stage develop resistance to conventional endocrine therapy and are highly prone to bone metastasis, resulting in extremely poor patient prognosis. Existing treatments (such as chemotherapy and novel endocrine therapies) can only provide limited prolongation of survival. Therefore, elucidating the key molecular mechanisms driving prostate cancer proliferation and metastasis at the genetic level, and developing novel targeted therapies accordingly, is a pressing technical challenge in this field.

[0005] Circular RNAs (circRNAs) are a class of non-coding RNAs with closed circular structures. They are significantly more stable than linear RNAs in tissues and body fluids, and are therefore considered highly promising biomarkers for liquid biopsies. Although some studies have reported that some circRNAs are involved in tumor progression, the expression patterns, biological functions, and clinical translational value of the vast majority of circRNAs in prostate cancer remain unclear. In particular, there is a lack of systematic technical solutions based on prostate cancer-specific circRNAs that have both diagnostic and therapeutic value. Summary of the Invention

[0006] This invention aims to address the technical problems of insufficient specificity of diagnostic biomarkers and a lack of therapeutic targets in existing prostate cancer technologies. This invention provides a circular RNA (hsa_circ_0003074) closely related to prostate cancer and discloses its application as a diagnostic biomarker and therapeutic target, thereby offering a new strategy for the clinical diagnosis and treatment of prostate cancer.

[0007] The objective of this invention is achieved through the following technical solution: In a first aspect, the present invention provides the application of a reagent for detecting circular RNA in the preparation of a prostate cancer diagnostic kit, wherein the circRNA is hsa_circ_0003074, and the nucleotide sequence of hsa_circ_0003074 is shown in SEQ ID NO.1.

[0008] Furthermore, the diagnostic kit detects the expression level of hsa_circ_0003074 in the sample using real-time quantitative PCR (RT-qPCR).

[0009] Preferably, the prostate cancer diagnostic kit contains a real-time quantitative PCR primer pair that specifically amplifies hsa_circ_0003074. The upstream primer nucleotide sequence of the real-time quantitative PCR primer pair is as follows: CGCTGTCCAATCTCCCACAT (SEQ ID NO.2). The downstream primer nucleotide sequence is as follows: GCAAGGCCATGATCAACAATATC (SEQ ID NO.3).

[0010] Furthermore, the method for detecting the expression level of hsa_circ_0003074 in tissues by real-time quantitative PCR includes the following steps: (1) Sample processing: Obtain clinical tissue samples (such as prostate cancer and adjacent tissues) or cell lines from the subjects and extract total RNA; (2) Reverse transcription reaction: cDNA is synthesized using the extracted RNA as a template; the preferred reaction system is: each 10 μL system contains 2 μL of reverse transcriptase and 500 ng of RNA; the preferred reaction conditions are: 37℃ for 15 min, 85℃ for 5 min.

[0011] (3) Real-time quantitative PCR amplification: cDNA is amplified using the specific primers described above; the preferred reaction system is: each 10 μL system contains 5 μL SYBR Green premix (Master Mix), 0.1 μL upstream primer, 0.1 μL downstream primer, and 1 μL cDNA template; the preferred reaction program is: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 60℃ annealing / extension for 30 s, for a total of 40-45 cycles.

[0012] (4) Analyze the corresponding CT values, perform relative quantification using the internal reference gene, and standardize using the mean of the control group. Using 2 -ΔΔCt The expression level of hsa_circ_0003074 was calculated and expressed as a multiple.

[0013] Secondly, the present invention provides the application of a reagent capable of inhibiting the expression of hsa_circ_0003074 in the preparation of a drug for treating prostate cancer, wherein the reagent is a siRNA containing hsa_circ_0003074 or a recombinant vector containing shRNA capable of expressing hsa_circ_0003074.

[0014] As a preferred embodiment, the siRNA sequence is shown in SEQ ID NO.4 or SEQ ID NO.5.

[0015] As another preferred embodiment, the recombinant expression vector is a viral vector expressing short hairpin RNA (shRNA), the shRNA containing a sequence capable of specifically binding to and mediating the degradation of hsa_circ_0003074; the encoding DNA sequence of the shRNA is shown in SEQ ID NO.6.

[0016] Preferably, the viral vector is a lentiviral vector.

[0017] Thirdly, the present invention provides a pharmaceutical composition for treating prostate cancer, the pharmaceutical composition comprising the above-mentioned effective amount of the reagent, and a pharmaceutically acceptable carrier, excipient or delivery system.

[0018] Furthermore, the dosage form of the pharmaceutical composition includes, but is not limited to, tablets, capsules, granules, aerosols, or injections. The routes of administration of the pharmaceutical composition include, but are not limited to, oral, intravenous, intratumoral, nasal, subcutaneous, or intramuscular injection.

[0019] The beneficial effects of this invention are as follows: 1. This invention reveals for the first time the application value of hsa_circ_0003074 as a specific diagnostic biomarker for prostate cancer. This invention found that hsa_circ_0003074 is significantly highly expressed in both clinical prostate cancer tissues and prostate cancer cell lines, exhibiting good diagnostic accuracy for prostate cancer, suggesting that this circular RNA can serve as a biomarker for the auxiliary clinical diagnosis of prostate cancer.

[0020] 2. This invention is the first to reveal and verify the crucial role of hsa_circ_0003074 in the development and progression of prostate cancer. Through systematic in vivo and in vitro functional experiments, this invention demonstrates that hsa_circ_0003074 is closely related to tumor proliferation and migration, providing a novel molecular therapeutic target for the precision diagnosis and treatment of prostate cancer.

[0021] 3. This invention provides substances that specifically target hsa_circ_0003074 and effectively reduce its activity or expression level. This invention designs and screens highly efficient siRNA and shRNA interference sequences targeting the reverse splicing site of hsa_circ_0003074, which can accurately and effectively knock down the expression of hsa_circ_0003074, thereby inhibiting prostate cancer progression and possessing excellent clinical translational value. Attached Figure Description

[0022] The present invention will be further described below with reference to the accompanying drawings; Figure 1 This is a schematic diagram of the genomic location and circularization mechanism of the circular RNA hsa_circ_0003074.

[0023] Figure 2 The results show the stability comparison of hsa_circ_0003074 and linear DHTKD1 mRNA after treatment with RNase R. In Figure (A), the stability comparison results are shown in human prostate cancer PC3 cells, and in Figure (B), the stability comparison results are shown in human prostate cancer DU145 cells.

[0024] Figure 3 The relative expression levels of hsa_circ_0003074 in clinical tissues of prostate cancer and paired adjacent normal tissues.

[0025] Figure 4 The receiver operating characteristic (ROC) curve for diagnosing prostate cancer based on the expression level of hsa_circ_0003074.

[0026] Figure 5 The expression differences of hsa_circ_0003074 in normal prostate epithelial cells and different prostate cancer cell lines were investigated.

[0027] Figure 6 The results show the interference efficiency verification of specific siRNA on the expression of hsa_circ_0003074 and its host gene DHTKD1. In Figure (A), the interference efficiency verification results are shown in human prostate cancer PC3 cells, and in Figure (B), the interference efficiency verification results are shown in human prostate cancer DU145 cells.

[0028] Figure 7 To investigate the effect of knocking down hsa_circ_0003074 expression on the in vitro proliferation ability of prostate cancer cells, Figure (A) shows the effect in human prostate cancer cell PC3 cells, and Figure (B) shows the effect in human prostate cancer cell DU145 cells.

[0029] Figure 8To investigate the effect of knocking down hsa_circ_0003074 expression on the in vitro migration ability of prostate cancer cells.

[0030] Figure 9 To investigate the inhibitory effect of knocking down hsa_circ_0003074 expression on the growth of prostate cancer xenografts in vivo. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0032] Unless otherwise specified, all test materials and reagents used in the following examples are commercially available.

[0033] Unless otherwise specified, all techniques or conditions described in the embodiments can be performed in accordance with the techniques or conditions described in the literature in this field or in the product manual. Unless otherwise specified, the quantitative experiments in the following embodiments are all repeated three times or more, and the results are averaged.

[0034] Example 1: Sequence and circular structure characteristics of hsa_circ_0003074 1. hsa_circ_0003074 sequence Based on the circBase and circbank databases, the hsa_circ_0003074 described in this invention consists of 1005 bases, and its genomic location is chr10:12123470-12133683. This circular RNA is formed by back-cleaving circularization of exons 2, 3, 5, and 6 of the host gene DHTKD1. The circular structure of hsa_circ_0003074 is as follows: Figure 1 As shown, the complete nucleotide sequence of hsa_circ_0003074 is shown in SEQ ID NO.1:

[0035] 2. Ring structure characteristics To verify the circularization characteristics of hsa_circ_0003074, this invention designed specific real-time quantitative PCR primers targeting the reverse splicing site of hsa_circ_0003074. The upstream primer nucleotide sequence of the real-time quantitative PCR primer is shown below: CGCTGTCCAATCTCCCACAT (SEQ ID NO.2), and the downstream primer nucleotide sequence is shown below: GCAAGGCCATGATCAACAATATC (SEQ ID NO.3).

[0036] RNA was extracted from human prostate cancer cells PC3 and DU145. Using their cDNA as templates, RT-PCR amplification was performed on the reverse splicing junctions. The specific steps are as follows: (1) RNA extraction and reverse transcription: Prostate cancer cell lines PC3 and DU145 in logarithmic growth phase were collected, and total RNA was extracted from the cells using TRIzol reagent. After determining the RNA concentration and purity, 500 ng of total RNA was used for reverse transcription to synthesize cDNA.

[0037] (2) Real-time quantitative PCR (RT-qPCR) amplification: PCR reaction system (10 μL): SYBR Green 5 μL, upstream primer (10 μM) 0.1 μL, downstream primer (10 μM) 0.1 μL, cDNA template 1 μL, and nuclease-free water to a final volume of 10 μL. The PCR reaction procedure is as follows: Step 1: Pre-denaturation 95℃ 30s, 1 cycle; Step 2: PCR amplification 95℃ 10s, 60℃ 30s, 40 cycles; Step 3: Melting curve analysis 95℃ 15s, 60℃ 60s, 95℃ 15s. Finally, the corresponding CT values ​​were obtained for analysis, relative quantification was performed using the internal reference gene, and standardization was performed using the mean of the control group. 2 -ΔΔCt The expression level of hsa_circ_0003074 was calculated and expressed as a multiple.

[0038] (3) RNase R stability experiment: To further verify the circular structure characteristics of hsa_circ_0003074, RNA samples from PC3 and DU145 cells were treated with RNase R enzyme, respectively. Subsequently, the expression changes of hsa_circ_0003074 and its linear parent gene DHTKD1 mRNA were detected by RT-qPCR. The RT-qPCR reaction system and procedure were as described in step (2). The results are as follows: Figure 2As shown, hsa_circ_0003074 exhibited significant resistance to RNase R digestion in both PC3 and DU145 cells when linear DHTKD1 mRNA was significantly degraded by RNase R, suggesting that it may have a closed circular RNA structure, laying the foundation for its use as a stable biomarker.

[0039] Example 2: Expression level of hsa_circ_0003074 in clinical samples and prostate cancer cell lines. This embodiment collected 24 pairs of prostate cancer tissues and their paired adjacent normal tissue samples. All samples were obtained from the First Affiliated Hospital of Zhejiang University School of Medicine and were approved by the ethics committee. Total RNA was extracted and detected by RT-qPCR according to the method described in Example 1. The results are as follows: Figure 3 As shown, compared with adjacent normal tissues, the expression level of hsa_circ_0003074 was significantly upregulated in prostate cancer tissues (fold change = 2.32, p < 0.001). This result suggests that high expression of hsa_circ_0003074 is closely related to the occurrence of prostate cancer. Furthermore, based on the expression level of hsa_circ_0003074, receiver operating characteristic (ROC) curves of hsa_circ_0003074 in clinical samples of prostate cancer were plotted to evaluate its diagnostic value. The results are as follows... Figure 4 As shown, its area under the curve (AUC) was 0.707 (95% confidence interval CI: 0.559–0.854, p = 0.014), indicating that hsa_circ_0003074 has the potential to serve as a molecular marker for the auxiliary diagnosis of prostate cancer.

[0040] To further verify the expression at the cellular level, this embodiment selected normal human prostate epithelial cell line (RWPE-1 cells) as a control and four human prostate cancer cell lines (PC3 cells, DU145 cells, C42B cells, and 22RV1 cells) as experimental groups. All the above cells were derived from the Institute of Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. Total RNA was extracted from the above cells and detected by RT-qPCR. Figure 5 As shown in the results, compared with normal prostate epithelial cells RWPE-1, hsa_circ_0003074 was significantly overexpressed in four prostate cancer cell lines (PC3 cells, DU145 cells, C42B cells, and 22RV1 cells). The combined results of clinical samples and cell experiments indicate that hsa_circ_0003074 is specifically overexpressed in prostate cancer, revealing for the first time the application potential of hsa_circ_0003074 as a specific molecular marker for prostate cancer.

[0041] Example 3: Knockdown of hsa_circ_0003074 can inhibit the proliferation and migration of prostate cancer cells in vitro. 1. Targeting hsa_circ_0003074 siRNA can effectively knock down the expression of hsa_circ_0003074 in prostate cancer cells. siRNA design and synthesis: This invention designs specific siRNAs targeting the reverse splicing site of hsa_circ_0003074. The nucleic acid sequences of the siRNAs used are shown below: CTGCAGTGATATTGTTGAT (SEQ ID NO.4) and TATTGTTGATCATGGCCTT (SEQ ID NO.5).

[0042] Cell transfection: Prostate cancer cells in logarithmic growth phase (PC3 cells and DU145 cells) were seeded in 6-well plates and cultured in MEM medium containing 10% fetal bovine serum at 37°C with 5% CO2. When cell confluence reached 30%-50%, transfection was performed strictly according to aseptic techniques. The siRNAs were transfected into the cells using Lipofectamine 3000 liposome transfection reagent. Cells were collected 48 hours after transfection, and RNA was extracted for subsequent analysis.

[0043] Following the methods described in Examples 1 and 2, total RNA was extracted and RT-qPCR was used to detect the expression level of hsa_circ_0003074 and to verify the silencing efficiency of hsa_circ_0003074. Figure 6 As shown, the results revealed that, compared to the si-NC blank vector control group, the expression level of hsa_circ_0003074 in the hsa_circ_0003074 knockdown group was significantly reduced in prostate cancer cells PC3 and DU145, while the mRNA of the parent gene DHTKD1 in both groups showed no significant change. This suggests that the hsa_circ_0003074 siRNA can effectively inhibit the expression of hsa_circ_0003074 without affecting the expression level of the parent gene. This demonstrates that the siRNA designed in this invention can effectively reduce the expression level of hsa_circ_0003074 by precisely targeting the reverse splice site of hsa_circ_0003074, providing a reliable tool for precise targeted therapy of prostate cancer.

[0044] 2. Knocking down hsa_circ_0003074 expression can inhibit the proliferation of prostate cancer cells. Cell proliferation was assessed using a CCK-8 assay kit. The specific steps were as follows: Prostate cancer cells transfected 24 hours prior were digested and resuspended. Cell density was adjusted, and cells were seeded at 1000 cells / well into 96-well plates, with 6 replicates per group. Cells were cultured in MEM medium containing 10% fetal bovine serum at 37°C in a 5% CO2 incubator. Detection was performed on days 0, 1, 2, 3, and 4 post-seeding. Fresh medium containing CCK-8 reagent was added to each well, and the cells were incubated at 37°C in the dark for 1-2 hours. The absorbance (OD value) at 450 nm was then measured using a microplate reader.

[0045] The results are as follows Figure 7 As shown, in prostate cancer PC3 and DU145 cells, knockdown of hsa_circ_0003074 significantly inhibited the proliferation of PC3 and DU145 cells compared with the control group (P<0.01), indicating that it plays a key role in maintaining the growth of prostate cancer cells.

[0046] 3. Knocking down hsa_circ_0003074 expression can inhibit the migration ability of prostate cancer cells. The Transwell assay was used to detect the migration ability of prostate cancer cells. The specific steps are as follows: Prepare Transwell chambers and place them in 24-well plates. Resuspend the transfected cells in serum-free medium at 4 × 10⁶ ppm. 5 200 μL of cell suspension was seeded into the upper chamber of a Transwell plate at a concentration of 10% fetal bovine serum (FBS). 600 μL of MEM medium containing 10% FBS was added to the lower chamber as a chemokine. The plate was incubated at 37°C with 5% CO2 for 24 hours. The chambers were then removed and gently washed twice with phosphate-buffered saline (PBS). Unmigrated cells in the upper chamber were wiped away with a cotton swab. The chambers were fixed in 4% paraformaldehyde at room temperature for 15 minutes, followed by washing twice with PBS. The chambers were then stained with 0.1% crystal violet at room temperature for 15 minutes, followed by washing with PBS to remove unbound dye. Randomly selected fields of view were photographed and the cells were counted.

[0047] like Figure 8 As shown, in prostate cancer PC3 and DU145 cells, compared with the control group, knockdown of hsa_circ_0003074 significantly reduced the number of PC3 and DU145 cells crossing the Transwell membrane, indicating that its knockdown effectively inhibited the migration ability of prostate cancer cells.

[0048] This embodiment demonstrates through systematic in vitro functional experiments that specific knockdown of hsa_circ_0003074 can effectively inhibit the proliferation and migration of prostate cancer cells. This is the first time that hsa_circ_0003074 has been functionally confirmed as a key factor driving prostate cancer progression, and suggests that it may be a potential therapeutic target for prostate cancer.

[0049] Example 4: Knockdown of hsa_circ_0003074 can inhibit the progression of prostate cancer in vivo. The effect of hsa_circ_0003074 on prostate cancer progression in vivo was detected by a subcutaneous tumorigenesis assay. The specific steps are as follows: (1) Construction of stable prostate cancer cell lines with knockdown of sh-NC and sh-hsa_circ_0003074: Based on the effective siRNA target (SEQ ID NO.5) verified in Example 3, a corresponding short hairpin RNA (shRNA) was designed and synthesized. The shRNA encoding DNA sequence specifically targeting hsa_circ_0003074 is shown below: CCGGTATTGTTGATCATGGCCTTCTCGAGAAGGCCATGATCAACAATATTTTT (SEQ ID NO.6). The shRNA structure formed after transcription of this sequence contains, in sequence: a sense strand sequence homologous to the target gene (TATTGTTGATCATGGCCTT), a loop sequence forming the hairpin structure (Loop, sequence CTCGAG), an antisense strand sequence that can specifically bind to the target gene (AAGGCCATGATCAACAATA), and a transcription termination signal of RNA polymerase III (TTTTT). Simultaneously, a control shRNA (sh-NC) carrying an irrelevant sequence was constructed, with the encoding DNA sequence: CCGGTTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT (SEQ ID NO.7). The shRNA was cloned into a lentiviral expression vector (pLKO.1) to construct the sh-NC and sh-hsa_circ_0003074 recombinant plasmids.

[0050] The recombinant plasmid sh-hsa_circ_0003074 and packaging plasmids (psPAX2, pMD2.G) were packaged at a mass ratio of 4:3:1 and co-transfected into 293T cells using Lipofectamine 3000 transfection reagent. Forty-eight hours after transfection, the viral supernatant was collected and used to infect PC3 prostate cancer cells. Forty-eight hours after infection, puromycin was added to a final concentration of 1.5 μg / mL for selection. After 7 days of selection, a PC3 cell line with stable low expression of hsa_circ_0003074 was obtained.

[0051] (2) Stable transfected cells in the logarithmic growth phase were digested, counted, and resuspended. Four-week-old male nude mice (3 mice per group) were randomly divided into two groups: the control group was sh-NC (PC3 cell line carrying an irrelevant sequence control plasmid), and the treatment group was sh-hsa_circ_0003074. Each nude mouse was subcutaneously inoculated with 1.5 × 10⁻⁶ cells. 6 The corresponding cells were observed and tumor formation was measured regularly in a sterile animal room.

[0052] like Figure 9 As shown in the results, the tumor volume in the sh-hsa_circ_0003074 group was significantly reduced compared with the control group. This result confirms in vivo that knocking down hsa_circ_0003074 can significantly inhibit the tumorigenicity of prostate cancer cells, further supporting the feasibility of hsa_circ_0003074 as a therapeutic target for prostate cancer.

[0053] In summary, this invention identified and confirmed that hsa_circ_0003074 is a highly stable circular circRNA that is specifically and significantly overexpressed in prostate cancer. Both in vitro and in vivo experiments confirmed that specifically knocking down hsa_circ_0003074 expression using siRNA or shRNA technology significantly inhibited the proliferation, migration, and tumorigenicity of prostate cancer cells. This discovery reveals the crucial regulatory role of hsa_circ_0003074 in the development and progression of prostate cancer, establishing its potential as a molecular marker for the auxiliary diagnosis of prostate cancer. Furthermore, hsa_circ_0003074 can also serve as a therapeutic target for the development of anti-prostate cancer drugs, thus providing a novel strategy and scientific basis for the precise clinical diagnosis and treatment of prostate cancer.

[0054] The above embodiments are used to explain and illustrate the present invention, but not to limit the present invention. Any modifications and changes made to the present invention within the spirit and scope of the claims shall fall within the protection scope of the present invention.

Claims

1. The application of a reagent for detecting circular RNA in the preparation of a prostate cancer diagnostic kit, characterized in that, The circular RNA is hsa_circ_0003074, and the nucleotide sequence of hsa_circ_0003074 is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The diagnostic kit contains a PCR primer pair that specifically amplifies the reverse splicing site of hsa_circ_0003074. The primer pair is a reverse transcription quantitative PCR primer pair, including an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.

3.

3. The use of a reagent for inhibiting circular RNA expression in the preparation of a drug for treating prostate cancer, characterized in that, The circular RNA is hsa_circ_0003074, and the nucleotide sequence of hsa_circ_0003074 is shown in SEQ ID NO.

1.

4. The application according to claim 3, characterized in that, The reagent is a siRNA containing hsa_circ_0003074, or a recombinant vector containing shRNA capable of expressing hsa_circ_0003074.

5. The application according to claim 4, characterized in that, The sequence of the siRNA is shown in SEQ ID NO.4 or SEQ ID NO.5; the encoding DNA sequence of the shRNA is shown in SEQ ID NO.

6.

6. The application according to claim 4, characterized in that, The viral vector is a lentiviral vector.

7. A pharmaceutical composition for treating prostate cancer, characterized in that, The pharmaceutical composition comprises an effective amount of the reagent as described in any one of claims 3-5, and a pharmaceutically acceptable carrier, excipient, or delivery system.

8. The pharmaceutical composition according to claim 7, characterized in that, The dosage form of the pharmaceutical composition includes tablets, capsules, granules, aerosols, or injections; the route of administration of the pharmaceutical composition includes oral, intravenous, intratumoral, nasal, subcutaneous, or intramuscular injection.

Images