A method for species identification of the subfamily Aspergillus niger based on gene barcoding
By using COI gene molecular markers and specific primers, combined with species definition analysis and phylogenetic analysis, the problem of species identification in the subfamily Aspergillus niger was solved, achieving accurate identification and classification of 64 species, simplifying the identification process, and improving the reliability and accuracy of the identification results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUANGXI TEACHERS EDUCATION UNIV
- Filing Date
- 2026-05-13
- Publication Date
- 2026-07-31
AI Technical Summary
Traditional morphological methods for identifying species in the subfamily Aspergillus venustae are hampered by reliance on expert experience, susceptibility to developmental stage and specimen condition, ambiguous species boundaries, and taxonomic disputes, making accurate identification difficult.
Using a partial sequence of the mitochondrial cytochrome C oxidase subunit I (COI) gene as a molecular marker, specific primers were designed for PCR amplification and sequencing. Combined with species definition analysis and phylogenetic analysis, accurate identification was achieved through DNA barcoding.
It enables accurate identification and classification of 64 common species in the subfamily Aspergillus venustae. It is simple, fast, and versatile, and is not limited by specimen morphology or developmental stage, thus improving the reliability and accuracy of identification results.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of insect molecular identification technology, specifically to a method for identifying species of the subfamily Aspergillus niger based on DNA barcoding. Background Technology
[0002] The subfamily Harpactorinae belongs to the phylum Arthropoda, class Insecta, order Hemiptera, suborder Heteroptera, superfamily Reduvioidea, and family Reduviidae. It is a globally distributed group, with the richest diversity and largest populations found in tropical and subtropical regions. Currently, over 300 genera and more than 2,000 species of Harpactorinae are known worldwide, with 54 genera and 200 species recorded in China. As the largest subfamily within the Reduviidae family, Harpactorinae insects inhabit diverse habitats and primarily feed on other insects or arthropods. They play a vital ecological role in controlling agricultural and forestry pest populations and maintaining ecosystem balance, thus possessing significant agro-forestry ecological importance.
[0003] Traditional species identification of the subfamily Aspergillus niger relies mainly on morphological characteristics, such as body shape, body color, markings, and the structure of male external genitalia. However, morphological identification methods have many limitations: (1) the identification results are highly dependent on the experience of taxonomists, and non-professionals find it difficult to operate accurately; (2) due to factors such as the insect's developmental stage (e.g., significant differences in morphology between larvae and adults) and the preservation status of specimens (e.g., fading, damage), morphological characteristics are often difficult to obtain completely, leading to identification difficulties; (3) Aspergillus niger exhibits obvious morphological gradations in body shape, body color, and markings in different geographical regions, blurring the boundaries of species division; (4) complex intraspecific polymorphism often exists in the same distribution location, further increasing the difficulty of species identification based solely on morphological characteristics; (5) the taxonomic status of some groups is still controversial, and there is a lack of objective molecular evidence to verify whether morphological differences are the result of species-level differentiation or intraspecific variation.
[0004] With the development of molecular biology techniques, an increasing number of studies are dedicated to using molecular data to assist in the classification, identification, and phylogenetic analysis of insects. Developing universal and stable molecular markers can provide objective molecular evidence for morphological classification studies, effectively compensating for the shortcomings of traditional morphological methods. Therefore, developing universal molecular markers applicable to insects in the subfamily Aspergillus niger and establishing simple, rapid, accurate, and reliable molecular identification methods has become an urgent priority for the accurate identification of this group of species, and is of great significance for promoting species identification, classification revision, and phylogenetic research in the Aspergillus niger subfamily. Summary of the Invention
[0005] The purpose of this invention is to provide a method for identifying species of the subfamily Aspergillus niger based on DNA barcoding. It utilizes a partial sequence of the mitochondrial cytochrome C oxidase subunit I (COI) gene as a molecular marker (849 bp) (positions 70-918) to accurately identify and classify 64 common species of Aspergillus niger in China, thereby overcoming the shortcomings of existing technologies in the identification of Aspergillus niger species.
[0006] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides specific primers for DNA barcoding in species of the subfamily Aspergillus niger, consisting of a forward primer and a reverse primer, the sequences of which are as follows: Forward primer: 5'-GCAGGAGTAGTGGGGACTTC-3'; Reverse primer: 5'-TGCTGATGTAAAGTATGCTCGT-3'.
[0007] The application of the specific primers in the identification of species in the subfamily Aspergillus niger is also within the scope of protection of this invention.
[0008] The present invention also provides a method for obtaining DNA barcode sequences of species in the subfamily Aspergillus niger, which uses the DNA of the species to be tested as a template, amplifies it using the specific primers, and then sequences the amplified fragment to obtain the DNA barcode sequence of the species.
[0009] This invention provides a method for identifying species of the subfamily Aspergillus niger based on DNA barcoding, comprising the following steps: (1) Extract the genome of the sample from the subfamily Aspergillus venustae; (2) Using the DNA extracted in step (1) as a template, PCR amplification was performed using the above-mentioned specific primers to obtain the COI gene barcode fragment; (3) Sequencing the PCR amplification products; (4) Based on the COI gene sequence obtained by sequencing, compare it with the Gen-bank database and / or the sequence of SEQ ID No. 1-130. When the sequence homology is greater than or equal to 98%, the sample of the true assassin bug subfamily to be tested is classified into the species corresponding to the compared sequence.
[0010] In the method described above, the PCR amplification reaction system in step (2) is as follows: the PCR reaction is carried out in a 200 μL PCR tube, and the total reaction volume is 50 μL. The system includes the following reagents: 4 μL DNA template, 2 μL forward primer, 2 μL reverse primer, 25 μL LiX, and 17 μL sterile double deionized water. The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles, and 72℃ extension for another 10 min.
[0011] Furthermore, some studies can also conduct species definition analysis and phylogenetic analysis to confirm the species classification results through dual verification.
[0012] Based on this, the method further includes using species definition analysis and phylogenetic analysis to further verify the identification results, specifically: (1) Phylogenetic analysis: The COI gene barcode fragments of the amplified test samples were combined with the COI gene barcode fragment sequences shown in SEQ ID No.1-130 to form a COI gene barcode dataset or COI data of the genus and closely related genera into a dataset. A phylogenetic tree was constructed using Bayesian method (BI), neighbor-joining method (NJ), or maximum likelihood method (ML). Monophyletic criterion: if the test sample clusters with a known species into a single independent lineage and the posterior support rate is greater than or equal to 98%, it is determined to be the same species as the known species through monophyletic detection. (2) Species delimitation analysis: Species were delimited using three methods: ABGD (Automatic Barcode Gap Discovery), ASAP (Assemble Species by Automatic Partitioning), and genetic distance analysis (p-distance) calculated using the Mega 12 software based on the K2P model. A genetic distance ≤2% was set as an auxiliary threshold for determining same species; a distance less than or equal to 2% was considered the same species, while a distance greater than 2% was considered different species. The ABGD and ASAP methods, when inputting the dataset to be tested, can generate automatic species delimitation results.
[0013] The species described in the subfamily Triplophyinae is *Aspergillus simonii*. Henricohahnia cauta Long-headed assassin bug Henricohahnia vittata Ring Tower Killer Bug Tapirocoris annulatus Brown-legged assassin bug Camptibia dark Orange-red assassin bug Cydnocoris gilvus , light-colored assassin bug Endochiella capitata , colorful assassin bug Evagoras plagiarized Pale yellow water chestnut assassin bug Isyndus the hero Brown water chestnut assassin bug Dark Isyndus Hairy-footed assassin bug Isyndus hairy Round-shouldered rhomboid assassin bug Isyndus plains Short-spined assassin bug Isyndus short-spined , large spear-wielding assassin bug Greater lance Beehive Ridge assassin bug Lingnania braconiformis Frosty-spotted assassin bug Endochus albomaculatus Black-horned assassin bug Black-horned hawkmoth The versatile assassin bug Endochus from Cingal Rotary assassin bug Scipina horrida horned-wheeled assassin bug Scipia subulata 2-toothed assassin bug Sclomina urchinacea Xingren assassin bug Sclomina xingrensis Guangxi hunting bug Scolamine Guangxi , St. Stephen's hunting bug Serendiba staliana Black-spined assassin bug Blackthorn Serendiba Variable-toothed assassin bug Trochanteric rhizome Spotted-bellied assassin bug Serendus geniculate Black-striped assassin bug Villanovanus black-red , spine-borne assassin bug Epidaucus carinatus Thorn-tailed assassin bug Polydid most armed Black-backed assassin bugs Confused Endochopsis Four-spotted assassin bugs Endochopsis quadricolor, Small-lipped assassin bug Apical velinus Red-lipped killer bug Vellum annulata Red-bellied assassin bug Red-bellied velinus Lirui assassin bug Angry Rhinocoris Yellow-margined assassin bug Rhinocorus marginal , Little Rui assassin bug Rhinocoris minutus Spotted-edged assassin bug Siberian Rhinoceros Spotted-edged assassin bug Sphedanolestes subtilis Red-bellied hunting bug Sphedanolestes pubinotus Chinese hunting bug Sphedanolestes sinicus Ringed Sniper Bug Sphedanolestes impressicollis Jilong hunting bug Sphedanolestes jilongensis Red-edged assassin bug Sphedanolestes gularis Double-ringed hunting bug Sphedanolestes anulipes Zheng's hunting bug Sphedanolestes zhengi Xiong's hunting bug Sphedanolestes xiongi Black-tailed assassin bug Coranus spinycutis Sichuan hunting bug Quran Sichuanese Yellow-margined assassin bug The Quran is modest. , visible vein earth assassin bug Coranus hammarstroemii Large Earth Killer Bug Coranus dilatatus Small, robust assassin bug Biasticus flavinotus Yellow-skinned assassin bug Biasticus flavus Vibrant-bellied assassin bug Biasticus confusus Pale-tailed assassin bug Pahabengkakia piliceps Pale-skirted assassin bug Yolinus albopustulatus Ringed skirt assassin bug Yolinus annulicornis , Violent hunting bug Agriosphodrus dohrni Ring-footed assassin bug Maldonadocoris annulipes Yellow-banded rhinoceros killer bug Sycanus bifidus Yellow Rhinoceros Killer Bug Sycanus croceus Red rhinoceros killer bug Sycanus falleni Taiwan rhinoceros killer bug Sycanus taiwanensis One of them.
[0014] The application of the above methods in the identification, classification, or phylogenetic studies of insect species in the subfamily Aspergillus niger is also within the scope of protection of this invention.
[0015] Compared with the prior art, the present invention has the following advantages and beneficial effects: This invention provides a method for species identification of the subfamily Aspergillus niger based on the COI gene, which can accurately identify and classify 64 common species of the subfamily Aspergillus niger, and the identification results are reliable.
[0016] The specific primers designed in this invention can efficiently and accurately amplify the COI gene barcode fragment of the subfamily Aspergillus niger, laying the foundation for molecular identification and phylogenetic studies of Aspergillus niger insects.
[0017] This invention employs a dual verification strategy of species definition analysis and phylogenetic monophyletic testing. The two pieces of evidence work together to verify consistency, significantly improving the accuracy of species identification.
[0018] The method of this invention has the advantages of being simple, fast, versatile, and not limited by the morphology and developmental stage of the specimen, effectively making up for the shortcomings of traditional morphological identification and existing molecular markers in the identification and classification of true assassin bugs.
[0019] This invention verifies the applicability of the COI gene as a DNA barcode for the subfamily Aspergillus eugenolinae in species identification, classification, and phylogenetic studies, providing technical support for molecular research on this group. Attached Figure Description
[0020] Figure 1 This is an electrophoretic detection result of the PCR amplification products of sample 17 from the subfamily Aspergillus niger in Example 1 of the present invention.
[0021] Figure 2 This is a phylogenetic tree (NJ neighbor-joining tree) of some species in the subfamily Aspergillus niger based on the COI gene constructed in Example 2 of the present invention.
[0022] Figure 3 Neighbor-joint tree (NJ) and species delimitation results (ASAP, ABGD, p-Distance) for 6 samples of 3 species in the tribe Cordiidae of the subgroup of true assassin bugs in China.
[0023] Figure 4Neighbor-joint tree (NJ) and species delimitation results (ASAP, ABGD, p-Distance) for 57 specimens of 28 species in the tribe Kolya of the subfamily Aspergillus in China.
[0024] Figure 5 Neighbor-joint tree (NJ) and species delimitation (ASAP, ABGD, p-Distance) results for 54 specimens of 25 species in the tribe Coreiae of the subgroup of true assassin bugs in China.
[0025] Figure 6 Neighbor-joint tree (NJ) and species delimitation (ASAP, ABGD, p-Distance) results for 13 specimens of 8 species in the tribe Rhinocerotopis of the subfamily Aspergillus in China. Detailed Implementation
[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. However, it should be understood that the embodiments of this invention are for illustrative purposes only and are not intended to limit the scope of the invention.
[0027] Example 1: Obtaining and applying universal primers for detecting samples from the subfamily Aspergillus venustae. 1. DNA extraction Sample collection and DNA extraction Samples of *Aspergillus niger* (true assassin bugs) were collected from different regions and preserved in anhydrous ethanol. Genomic DNA was extracted from the samples using an animal tissue DNA extraction kit, following the kit's instructions. The extracted DNA was stored at -20°C for later use.
[0028] 2. Primer design and validation This invention uses the frost-spotted assassin bug from NCBI. Epidaus famulus Based on the mitochondrial gene (NC085748.1<1472-3005>), universal forward and reverse primers were designed in conserved regions using Primer 3.0 software. On the NCBI homepage, the Primer BLAST tool page was accessed, and the sequences of the forward and reverse primers were entered. The assassin bug database was selected, and after comparing the primer sequence amplification results, a single primer pair was selected from multiple pairs. Both predicted amplified fragments of 849 bp in length, belonging to the COI gene and covering the vast majority of known *Aspergillus niger* subfamily species in China.
[0029] Primer sequences: Forward primer: 5'-GCAGGAGTAGTGGGGACTTC -3' Reverse primer: 5'-TGCTGATGTAAAGTATGCTCGT -3' Validation of PCR primer amplification Using extracted DNA from samples of the subfamily Assassininae (Table 1) as templates, PCR amplification was performed using the specific primers designed in this invention. Figure 1 ).
[0030] Primer sequences: Forward primer: 5'-GCAGGAGTAGTGGGGACTTC-3' Reverse primer: 5'-TGCTGATGTAAAGTATGCTCGT-3' PCR reaction system (50 μL): Specific components include 2-4 μL template DNA, 1 μL forward primer, 1 μL reverse primer, 25 μL 2×Taq PCR Master Mix, and ddH2O to make up to 50 μL. PCR reaction procedure: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles; final extension at 72℃ for 10 min to obtain amplification products; store at 4℃. Electrophoresis detection and sequencing ( Figure 1 ) Take 5 μL of PCR amplification product and perform 1% agarose gel electrophoresis. Observe and photograph the product using a gel imaging system. Figure 1 The successfully amplified PCR products were sent to a sequencing company for bidirectional sequencing. The results showed that all fragments were amplified to approximately 800 bp, and all were COI genes.
[0031] Table 1 shows the information of 17 samples from the subfamily Eurypterinae in Example 1 of this invention. 1 JFLLC2 Horváth, 1879 China: Guangxi, Huaping, Cujiang 20-XI-2023 2 HJELC4 Black-horned assassin bug (Endochus nigricornis) Stål, 1859 China: Guizhou, Leishan, Fangxiang 21-VII-2016 3 LCLC5 Scipinia subula Hsiao&Ren, 1981 China: Guangxi, Ningming, Huashan 2019 4 XMT-NM2 Reuter, 1891 China: Inner Mongolia, Xinganmeng, Xinubulun 24-VI-2014 5 WJLC Brown-legged assassin bug (Camptibia obscura, Cai & Tomokuni, 2003) China: Hainan 2024 6 DM-HN1 The Great Spear Killer Bug (Lanca major Hsiao), 1979 China: Haikou, Huoshankou 6-Aug-2022 7 GHZLC1 *Velinus annulatus* Distant, 1879 China: Guangxi, Jingxi, Napo, Diding 20-V-2020 8 MZL-ML2 Hairy-footed assassin bug (Isyndus pilosipes Reuter1881) China: Guizhou, Maolan 25-VII-2013 9 CWLC3 The Painted Attacker Beetle (Euagoras plagiatus, Burmeister, 1834) China: Guangxi, Longzhou, Nonggang 15-VIII-2017 10 HWLC1 Hsiao, 1979 China: Hainan, Wuzhushan 28-IV-2 11 HBMLCGX2 The species Sphedanolestesimpressicollis (Stål, 1861) China: Guangxi, Baise, Jinzhongshan 2-VII-2 12 HYMLC5 Synthesis of Sphedanolestes gularisHsiao , 1979 China: Guangxi, Jingxi, Napo, Wall 20-V-2020 13 PAHA2 New York City Miller, 1941 China: Yunnan, Puerto Rico, Xiaomi, Nanping, Beijing, and Wanmuchayuan VI-2022 14 HZ1 Entertainment (Matsumura, 1913) China: Guangxi, Hezhou, Guapishan 7-IV-2 15 HJELC1 Endochus nigricornis Stål, China: Hubei, Dabieshan, Taohuachong / 16 B2 Recipe Agriosphodrus dohrni (Signed, 1862) China: Guizhou, Kaili 10-IV-2 17 HX6 Entertainment Hsiao, 1979 China: Huizhou, Rongjiang 1-VI-2 Example 2: A method for species identification of the subfamily Aspergillus venusta based on gene barcoding Following the method in Example 1, 300 samples (which had been identified as species by conventional methods) were identified (including 130 samples of the subfamily Aspergillus niger as described in Table 2, involving 64 species) and their genes were amplified by barcoding. The amplified fragments were then sequenced. The sequences of the 130 samples of the subfamily Aspergillus niger as described in Table 2 are shown in SEQ ID No. 1-130.
[0032] Table 2. COI gene barcodes and specimen information for species in the subfamily Triplophysa. ; ; ; ; ; ;
[0033] The obtained sequences were compared with the GenBank database using BLAST or with sequences of known species. If the sequence homology between species was greater than or equal to 98%, they could be preliminarily identified as belonging to the same species. The results showed that all 300 samples were identified to species through sequence alignment, with an accuracy rate exceeding 95%.
[0034] Using this method, the 300 samples were identified as follows: The Di hunter bug tribe (3 species): *Euphorbia tirucalli* Henricohahnia caution Miller, 1954, Long-headed Assassin Bug Henricohahnia vittata Miller, 1954, Ring Tower Attack Bug Tapyrocoris annulatus Hsiao & Ren, 1981; The tribe of assassin bugs (28 species): Brown-legged assassin bug Camptibia obscura Cai&Tomokuni, 2003, orange bug Cydnocoris gilvus (Burmeister, 1838), the small assassin bug. Endochiella capitata Hsiao, 1979, Painted Assassin Bug Euagoras plagiarism (Burmeister, 1834), Pale Yellow Water Chestnut Assassin Bug Isyndus heroes (Fabricius, 1803), Brown Water Bug Isyndus obscurus Dallas, 1850, Hairy-footed assassin bug Isyndus pilosipes Reuter, 1881, Round-shouldered assassin bug Isyndus planicollis Lindberg, 1934, Short-spined water bug Isyndus brevispinus Breddin, 1900, the Great Spear Killer Bug Major spear Hsiao, 1979, *Assassin Bugs of Conduit Ridge* Lingnania braconiformis China, 1940, Frost-spotted assassin bug Endochus albomaculatus Stål, 1859, Black-horned assassin bug Endochus nigricornis Stål, 1959, The Versatile Huntsman Bug Endochus cingalensis Stål, 1861, the Wheel-Stinging Assassin Bug Horrible Scipinia (Stål, 1859), horned horned bug Scipinia subula Hsiao & Ren, 1981, *Aspidistra tussocki* Sclomina hennacea Stål, Xingren spiny bug (Sclominaxingrensis), Guangxi spiny bug Sclomina guangxiensis Ren, 2001, *Strombus schlegelii* Serendiba staliana (Horváth, 1879), Black-spined assassin bug Serendiba blackspine Hsiao, 1979, *Assassinia multidentata* Trochanteric rhizome Stål, 1861, Spotted-bellied Killer Bug Serendus geniculate Hsiao, 1979, Black-faced Killer Bug Villanovanus black-red Hsiao, 1979, *Assassin bug* Epidaucus carinatus Hsiao, 1979, Thorny assassin bug The most armed Polydidus Stål, 1859, Black-backed assassin bug Endochopsis confused Hsiao 1979, Four-spotted assassin bug Endochopsis quadrimaculatus Hsiao, 1979; Tribe of assassin bugs (25 species): Small-lipped assassin bug Apical velinus Hsiao, 1979, *Echinochloa crus-galli* Vellum annulata Distant, 1879, Red-bellied Assassin Bug Red-bellied velinus Hsiao, 1979, Li Rui assassin bug Angry Rhinocoris (Poda, 1761), Yellow-margined assassin bug Rhynocoris marginellus (Fabricius, 1803), Lesser Killer Bug Rhinocoris minutus Liu, Zhao & Cai, 2025, *Sterculia scabra* Siberian Rhinoceros (Jakovlev, 1893), Spotted-edged Sniffer Bug Sphedanolestes subtilis (Jakovlev, 1893), Red-bellied Sniper Bug Sphedanolestes pubinotus Reuter, 1881, Chinese assassin bug Sphedanolestes sinicus Cai & Yang, 2002, *Scytherium ringae* Sphedanolestes impressicollis (Stål, 1861), Girona bug Sphedanolestes jilongensis Liu, Zhao & Cai, 2025, Red-edged Slayer Bug Sphedanolestes gularis Hsiao, 1979, Double-ringed Killing Bug Sphedanolestes ring-footed Distant, 1903, Zheng's Killing Bug Sphedanolestes zhengi Zhao, Ren & Cai, 2015, *Ursus hupehensis* Sphedanolestes xiongi Cai, 2004, Black-tailed Assassin Bug Coranus spinycutis Reuter1881, Sichuan killer bug Coranus sichunensis Hsiao & Ren 1981, Yellow-margined assassin bug Quran modest Kiritschenko 1931, Visible Veined Assassin Bug Coranus hammarstroemii Reuter, 1892, Giant Killer Bug The expanded Quran (Matsumura, 1913), Small Strong Attacker Bug Yellow-billed Biasticus(Matsumura, 1913), Yellow-skinned assassin bug Yellow-tailed eagle (Distant, 1903), the beautiful-bellied assassin bug Biasticus is confused. Hsiao, 1979, Pale-tailed Bee-eating Assassin Bug Pahabengkakia piliceps Miller, 1941; Tribe of Rhinoceros Killer Bugs (8 species): Pale-skirted Killer Bug Yolinus albopustulatus China, 1940, Ringed Skirt Killer Bug Ring-horned hawkmoth Hsiao, 1979, Vicious Hunting Bug Agriosphodrus dohrni (Signoret, 1862), Ring-footed Assassin Bug Maldonadocoris annulipes Zhao, Yuan & Cai, 2006, Yellow-banded Rhinoceros Killer Bug Sycanus bifid (Fabricius, 1787) 、 Yellow Rhinoceros Killer Bug Yellow-bellied woodpecker Hsiao, 1979, Great Red Rhinoceros Killer Bug Sycanus fallini Stål, 1863, Taiwan rhinoceros killer bug Taiwan's Sycanus Zhao & Cai, 2024.
[0035] Furthermore, the COI gene barcodes of the species to be identified are combined with the COI gene barcodes of all or all genera and closely related genera to which this invention belongs (SEQ ID No. 1-130 of the COI gene barcode sequences of the 130 samples shown in Table 2) to perform phylogenetic analysis and species delineation, and to comprehensively determine the species affiliation. Phylogenetic analysis uses Mega, RAxML, and MrBayes software to construct NJ, BI, and ML phylogenetic trees respectively, and performs monophyletic testing. Speciation mainly uses Mega software to perform genetic distance analysis, calculating intraspecific and interspecific genetic distances. Interspecific genetic distances less than or equal to 2% are considered to be of the same species. Simultaneously, species delineation also requires combined analysis using methods such as ABGD and ASAP. The dataset is input into the software in FASTA format to automatically obtain species delineation results and observe the species affiliation of the samples to be tested. Among these, species identification only requires constructing an NJ tree to determine monophyleticity (…). Figure 2 Publishing articles requires building a BI or ML tree. The species classification of the tested samples is ultimately determined by combining the results of species definition analysis and phylogenetic analysis.
[0036] In this embodiment, samples of 64 common species of the subfamily Aspergillus were analyzed. The results showed that all samples could be accurately identified, there were obvious barcode gaps in the genetic distance between species, and each species formed a monophyletic group on the phylogenetic tree. This indicates that the method of the present invention can accurately identify common species of the subfamily Aspergillus.
[0037] Meanwhile, some special cases may be encountered in the molecular identification of true assassin bug subfamily species using COI gene barcoding. In the following detailed analysis, we will explain these special cases in detail and propose explanations and solutions.
[0038] Species identification and delineation of the Dicrotelini tribe of the subgroup of true assassin bugs in China ( Figure 3 ) A NJ phylogenetic tree of six individuals from three species of the tribe *D. spp.* was constructed using Mega software, forming three lineages, all exhibiting good monophyletic characteristics. Furthermore, during species delimitation, the genetic distance (p-Distance) among the three species was significantly greater than 2%, indicating clear species boundaries. The species delimitation results from ABGD and ASAP were consistent with the p-Distance results.
[0039] Special case: Huntsman bugs around the tower Tapirocoris annulatus Although the two individuals were not morphologically different, they had a large intraspecific genetic distance (15%). The individual from Jinping, Yunnan (TLC-JP1) may be a cryptic species, indicating that some geographical populations of the killer bug in the Tarim Basin may contain hidden new species. This suggests that we can further explore species diversity. Whether the differences are at the population level or at the species level, further research is needed based on the collection of a large number of specimens.
[0040] Species identification and delineation of Euagorasini tribe, subgroup of true assassin bugs in China ( Figure 4 ) Phylogenetic trees of 57 individuals from 28 species of the tribe *Aeschynanthus* were constructed using Mega software, forming 28 lineages, all exhibiting good monophyletic characteristics. Furthermore, during species delimitation, the genetic distances among the 28 species were significantly greater than 2%, indicating clear interspecific boundaries. The species delimitation results from ABGD and ASAP were consistent with the p-Distance results.
[0041] Special case: Ridgeless assassin bug Epidaucus carinatus The samples from Guangxi and Guangdong (JIILC3, JGJLC) showed a significant intraspecific genetic distance (6%, 10%) from Wuyishan, Fujian (JIILC2), suggesting that the Wuyishan population may be a newly cryptic species; Black-striped assassin bug Villanovanus black-red The intraspecific genetic distance between the sample from Qingyuan, Guangdong (CWLC1) and two samples from Hainan (HWLC1, HWLC2) (10%, 10%) was relatively large; the intraspecific genetic distance between the sample from Liulongzhou, Guangxi (MCSLC1) and two samples from Hainan (FXSLC2, FXSLC3) (4%, 5%) was also relatively large. The species delimitation and genetic distance analysis results of ABGD and ASAP were consistent.
[0042] Therefore, through phylogenetic analysis and species delineation based on COI gene barcoding, we can further explore the species diversity of *Aspergillus simonii* in China, especially distant geographical populations, which are highly likely to have broken away from geographical gradations and become independent species, such as *Aspergillus simonii*. Epidaucus carinatus The Fujian population; island populations are highly likely to have formed new island species due to long-term isolation by straits between mainland islands, such as *Lingnania braconiformis* and *Hemiberlesia braconiformis*. Villanovanus black-red The Hainan Island population. Species identification based on COI gene barcoding provides a verifiable and effective method for further exploring China's biodiversity.
[0043] Species identification and delimitation of the tribe Rhynocorini in the subgroup of true assassin bugs ( Figure 5 ) Phylogenetic trees of 54 individuals from 25 species of the tribe *Assassinia* were constructed using Mega software, forming 25 lineages, all exhibiting good monophyletic characteristics. Furthermore, during the species delimitation process, except for *Assassinia rubrum*, [further details about species delimitation are needed]. Red-bellied velinus With the red-lipped killer bug Vellum annulata The interspecific genetic distance between the two species is very small, while the genetic distance between most other species is significantly greater than 2%, and the species boundaries are clear. The species delineation results of ABGD and ASAP are consistent with the p-Distance results.
[0044] Special Case: The genetic distance between individuals of *Rhizophora rubra* and *Rhizophora rubra* is 0-1%, far below the 2% threshold for interspecific genetic distance. The results of ABGD and ASAP analyses are consistent with these genetic distance analyses. Therefore, although *Rhizophora rubra* and *Rhizophora rubra* differ in external morphology, this phenomenon may be due to the phenotypic evolution rate exceeding the gene change rate, or it could be that the two closely related species have previously exchanged genetic material. In such cases, further analysis of the divergence between the two species using mitochondrial genome or even nuclear genome data is necessary. Using COI gene barcoding to define species is no longer effective, but this situation is rare and represents a complex issue of species delineation.
[0045] Special case: Young assassin bug Yellow-billed Biasticus With the yellow-margined assassin bug The Quran is modest.The genetic distances between individuals within these two species were significant, but neither ASAP nor ABGD analyses supported differentiation. Considering all three speciation methods, despite the large differences in genetic distance between individuals, these two assassin bug species are still considered the same species. Therefore, for species identification in the subfamily Aspergillus eugenolinae based on COI gene barcoding, consistency between phylogenetic monophyletic and speciation results is crucial for definitive species identification. It is essential to consider not only phylogenetic monophyletic greater than 98% and genetic distance less than or equal to 2%, but also the results of multiple speciation methods (such as ABGD and ASAP). Otherwise, species identification or the identification of new species is not recommended.
[0046] Special Case: Zheng Meng Hunting Bug Sphedanolestes zhengi Among the three individuals (XMLC, XZMLC2C, and ZMLC1), even with a posterior support rate of 99% for phylogenetic monophyletic, there was a high inter-individual genetic difference of up to 10% between the two individuals from Tibet (XZMLC2C and ZMLC1) and the individual from Caohai, Weining, Guizhou (XMLC). The results of ASAP and ABGD analyses both support that the two individuals from Tibet constitute an independent branch, thus indicating that the two individuals from Tibet are a new cryptic species closely related to the Zhengmeng assassin bug.
[0047] Species identification and delineation of the tribe Sycanini in the subfamily Assassininae of China ( Figure 6 ) Phylogenetic trees of 13 individuals from 8 species of the tribe *Assassinia* were constructed using Mega software, forming 8 lineages, all exhibiting good monophyletic characteristics. Furthermore, during species delimitation, the interspecific genetic distance was significantly greater than 2%, and the interspecific boundaries were clear. The species delimitation results from ABGD and ASAP were consistent with the p-Distance results.
[0048] Special case: Great Red Rhinoceros Killer Bug ( Sycanus falleni The inter-individual genetic distance was 3%, significantly lower than the inter-species genetic distance. To address this, a comprehensive assessment was made by combining the species classification results from ABGD and ASAP. ABGD provided only one classification result, dividing the species into 8 species; ASAP also supported this classification. Based on the combined results of these two methods, the classification scheme of 8 species was determined, and the 3% genetic difference among individuals of the Greater Red Rhinoceros Killer Bug was attributed to intraspecific variation.
Claims
1. A specific primer for barcoding the DNA of a species in the subfamily Aspergillus venustae, consisting of a forward primer and a reverse primer, with the following sequence: Forward primer: 5'-GCAGGAGTAGTGGGGACTTC-3'; Reverse primer: 5'-TGCTGATGTAAAGTATGCTCGT-3'.
2. The application of the specific primers described in claim 1 in the identification of species in the subfamily Aspergillus venustae.
3. A method for obtaining the DNA barcode sequence of a species of the subfamily Aspergillus niger, comprising using the DNA of the species to be tested as a template, performing PCR amplification with the specific primers described in claim 1, and sequencing the amplified fragment to obtain the DNA barcode sequence of the species of the subfamily Aspergillus niger.
4. A method for identifying species of the subfamily Aspergillus venusta based on DNA barcoding, characterized in that, Includes the following steps: (1) Extract the genome of the sample from the subfamily Aspergillus venustae; (2) Using the DNA extracted in step (1) as a template, PCR amplification was performed using the specific primers of the present invention to obtain the COI gene barcode fragment; The specific primer sequence is as follows: Forward primer: 5'- [GCAGGAGTAGTGGGGACTTC]-3'; Reverse primer: 5'- [TGCTGATGTAAAGTATGCTCGT] -3'; (3) Sequencing the PCR amplification products; (4) Based on the COI gene sequence obtained by sequencing, compare it with the COI gene barcode fragment sequence shown in the Gen-bank database and / or any one of SEQ ID No. 1-130. When the sequence homology is greater than or equal to 98%, the sequence of the sample of the true assassin bug subfamily to be tested is compared and classified into the corresponding species.
5. The method according to claim 4, characterized in that, The PCR amplification reaction system described in step (2) is as follows: The PCR reaction is carried out in a 200 μL PCR tube, and the total reaction volume is 50 μL. The system includes the following reagents: 4 μL DNA template, 2 μL forward primer, 2 μL reverse primer, 25 μL pcr Mix, and 17 μL sterile double deionized water. The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles, and 72℃ extension for 10 min.
6. The method according to claim 4, characterized in that, The method also includes further validating the identification results using species definition analysis and phylogenetic analysis, specifically: (1) Phylogenetic analysis: The COI gene barcode fragments of the amplified test samples were combined with the COI gene barcode fragment sequences shown in SEQ ID No.1-130 to form a COI gene barcode dataset or COI data of the genus and closely related genera into a dataset. A phylogenetic tree was constructed using Bayesian method (BI), neighbor-joining method (NJ), or maximum likelihood method (ML). Monophyletic criterion: if the test sample clusters with a known species into a single independent lineage and the posterior support rate is greater than or equal to 98%, it is determined to be the same species as the known species through monophyletic detection. (2) Species delimitation analysis: ABGD (Automatic Barcode Gap Discovery) and ASAP (Assemble Species by Automatic Partitioning) methods and genetic distance analysis (p-distance) based on the Mega 12 K2P model were used for species delimitation. Genetic distance ≤2% was set as the auxiliary threshold for determining the same species. If it is less than or equal to 2%, it is determined to be the same species. If it is greater than 2%, it is a different species.
7. The method according to claim 4, characterized in that, The species described in the subfamily Triplophyinae is *Aspergillus simonii*. Henricohahnia cauta Long-headed assassin bug Henricohahnia vittata Ring Tower Killer Bug Tapirocoris annulatus Brown-legged assassin bug Camptibia obscura Orange-red assassin bug Cydnocoris gilvus , light-colored assassin bug Endochiella capitata , colorful assassin bug Euagoras plagiatus Pale yellow water chestnut assassin bug Isyndus heroes Brown water chestnut assassin bug Isyndus obscurus Hairy-footed assassin bug Isyndus pilosipes Round-shouldered rhomboid assassin bug Isyndus planicollis Short-spined assassin bug Isyndus brevispinus , large spear-wielding assassin bug Lanca major Beehive Ridge assassin bug Lingnania braconiformis Frosty-spotted assassin bug Endochus albomaculatus Black-horned assassin bug Endochus nigricornis The versatile assassin bug Endochus cingalensis Rotary assassin bug Scipinia horned-wheel assassin bug Scipinia subula 2-toothed assassin bug Sclomina erinacea Xingren assassin bug Sclomina xingrensis Guangxi hunting bug Sclomina guangxiensis , St. Stephen's assassin bug Serendiba staliana Black-spined assassin bug Serendiba nigrospina Variable-toothed assassin bug Rihirbus trochantericus Spotted-bellied assassin bug Serendus geniculatus Black-striped assassin bug Villanovanus nigrorufus , spine-borne assassin bug Epidaucus carinatus Thorn-tailed assassin bug Polididus armatissimus Black-backed assassin bugs Endochopsis confusus Four-spotted assassin bugs Endochopsis quadrimaculatus, Small-lipped assassin bug Velinus apicalis Red-lipped killer bug Velinus annulatus Red-bellied assassin bug Velinus rufiventris Lirui assassin bug Rhynocoris iracundus Yellow-margined assassin bug Rhynocoris marginellus , Little Rui assassin bug Rhynocoris minutus Spotted-edged assassin bug Rhynocoris sibiricus Spotted-edged assassin bug Sphedanolestes subtilis Red-bellied hunting bug Sphedanolestes pubinotus Chinese hunting bug Sphedanolestes sinicus Ringed Sniper Bug Sphedanolestes impressicollis Jilong hunting bug Sphedanolestes jilongensis Red-edged assassin bug Sphedanolestes gularis Double-ringed hunting bug Sphedanolestes annulipes Zheng's hunting bug Sphedanolestes zhengi Xiong's hunting bug Sphedanolestes xiongi Black-tailed assassin bug Coranus spiniscutis Sichuan hunting bug Coranus sichuensis Yellow-margined assassin bug Coranus emodicus , visible vein earth assassin bug Coranus hammarstroemii Large Earth Killer Bug Coranus dilatatus Small, robust assassin bug Biasticus flavinotus Yellow-skinned assassin bug Biasticus flavus Vibrant-bellied assassin bug Biasticus confusus Pale-tailed assassin bug Pahabengkakia piliceps Pale-skirted assassin bug Yolinus albopustulatus Ringed skirt assassin bug Yolinus annulicornis , Violent hunting bug Agriosphodrus dohrni Ring-footed assassin bug Maldonadocoris annulipes Yellow-banded rhinoceros killer bug Sycanus bifidus, Yellow Rhinoceros Killer Bug Sycanus croceus Red rhinoceros killer bug Sycanus falleni Taiwan rhinoceros killer bug Sycanus taiwanensis One of them.
8. The application of the method according to any one of claims 4-7 in the identification, classification or phylogenetic studies of insect species in the subfamily Aspergillus venustae.