A primer and probe set for identifying the gender of a parrot based on multiple RPA amplification and application thereof

Abstract

This invention discloses a primer and probe set for parrot sex identification based on multiplex RPA amplification and its application. The primer and probe set includes primers for the CHD-Z gene and primers for the CHD-W gene. The nucleotide sequences of the CHD-Z gene primers are shown in SEQ ID NO. 1-2; the nucleotide sequences of the CHD-W gene primers are shown in SEQ ID NO. 4-5. This invention designs sex identification primers targeting the conserved CHD-Z and CHD-W genes in the parrot genome. Parrot internal control primers are used in combination with parrot sex identification primers and probes for double amplification, achieving a detection limit as low as 1000 copies / mL. It also includes an RPA lyophilized system kit, which is simple to operate, rapid in reaction, and highly sensitive, enabling rapid, efficient, and specific sex identification in parrots. This provides an efficient technical means for improving the efficiency of parrot breeding, scientific management, and behavioral optimization.

Description

Technical Field

[0001] This invention relates to the field of medical biotechnology, and in particular to a primer and probe set for parrot sex identification based on multiplex RPA amplification and its application. Background Technology

[0002] Parrots, belonging to the order Psittaciformes, are one of the most diverse groups of birds. With their vibrant plumage, intelligent behavior, and companionship, they hold an important place in the bird trade, endangered species conservation, and companion animal keeping. However, parrots generally exhibit high levels of sexual monomorphism, meaning that males and females are highly similar in size, plumage, and other physical characteristics, lacking significant secondary sexual characteristics. This makes traditional methods of sex determination based on morphological observation ineffective. Even for juveniles or subadults, where some species exhibit slight sexual differences in adulthood, early sex determination is extremely difficult. This predicament directly hinders the artificial breeding, pair management, and ex-situ conservation of parrots. Pairing failures due to misjudgment of sex not only reduce reproductive efficiency but also impede the growth of rare populations.

[0003] Early methods of sex determination in birds primarily relied on techniques such as cloacal observation, surgical endoscopy, chromosome karyotype analysis, and steroid hormone assays. Cloacal observation, however, requires a high level of operator experience and has limited accuracy. While endoscopy allows direct observation of the gonads, it is an invasive procedure that can cause severe stress in small parrots, potentially leading to mechanical damage or postoperative infection. Hormone assays are easily affected by individual physiological conditions, sampling time, and environmental stress, resulting in poor repeatability. These methods, due to insufficient accuracy, cumbersome procedures, and significant impacts on animal welfare, have been difficult to widely apply in the large-scale breeding and conservation of parrots. Since the 1990s, molecular sex determination techniques based on the CHD gene (chromodomain-helicase-DNA-binding protein) have gradually become the mainstream method for sex determination in birds. This gene has highly homologous copies on the Z and W sex chromosomes of birds (CHD-Z and CHD-W). Due to differences in the evolutionary rate of intron sequences, the length of the amplified fragments exhibits polymorphism—male individuals (ZZ type) amplify only one CHD-Z fragment, while female individuals (ZW type) can amplify both CHD-Z and CHD-W fragments simultaneously, thus enabling sex determination. Polymerase chain reaction (PCR) combined with gel electrophoresis has been validated in various bird species due to its advantages of high accuracy, good reproducibility, and applicability to non-invasive sampling (such as feathers and oral swabs). However, this method still has inherent limitations in practical applications: First, the PCR process relies on sophisticated thermal cycling instruments and requires multiple temperature switches for denaturation, annealing, and extension, which places high demands on laboratory conditions and makes it difficult to deploy in resource-limited settings such as zoos, farms, and protected areas; Second, electrophoresis detection requires the use of nucleic acid dyes and gel imaging systems, which is a lengthy process, typically taking 3 to 4 hours from sample processing to result interpretation, and cannot meet the needs of rapid on-site testing; In addition, for specific groups such as parrots, the amplification efficiency of some universal primers is poor, and even non-specific amplification or loss of target fragments may occur, requiring repeated optimization before they can be applied.

[0004] In recent years, the rapid development of isothermal amplification technology has provided a new technical pathway for rapid nucleic acid detection. Among these, recombinase polymerase amplification (RPA) is widely used in point-of-care testing (POCT) of pathogenic microorganisms because it can complete exponential amplification of target nucleic acids within 20 minutes under isothermal conditions of 37-42℃, has lower requirements for sample purity, and is compatible with various detection terminals (such as fluorescent probes, lateral chromatography strips, and microfluidic chips). Compared to loop-mediated isothermal amplification (LAMP), RPA requires only one pair of primers for amplification, making primer design relatively simple and reducing the risk of non-specific amplification. Compared to traditional PCR, RPA eliminates the dependence on thermal cyclers, making it more portable and applicable in the field. However, the application of RPA technology in avian sex identification is still in its early stages, and there are currently few systematic reports on parrot groups in domestic and international research.

[0005] Parrots are diverse, with significant differences in genomic sequences among different groups. Furthermore, the structural variations of the CHD gene on the Z / W chromosomes make it difficult to achieve universal cross-species detection using a single primer-probe combination. Current molecular identification methods primarily rely on singleton PCR, which has significant limitations in multiplex amplification, portable integration, and rapid on-site detection. Therefore, developing a multiplex RPA detection system suitable for parrots, possessing both high specificity and on-site applicability, is of great practical significance in overcoming the current technical bottlenecks in sex identification. A multiplex RPA amplification strategy can simultaneously detect CHD-Z and CHD-W targets in a single tube reaction. This not only allows for the inclusion of a positive internal control to mitigate false negatives but also enables closed-tube visualization and interpretation through differential labeling of amplification products. This significantly reduces detection time and simplifies procedures while ensuring accuracy, providing new technical support for parrot breeding management, species conservation, and trade regulation. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention proposes a primer and probe set for parrot sex identification based on multiplex RPA amplification and its applications. The primers and probes exhibit strong binding affinity to parrot gDNA templates, high sensitivity, and high specificity, providing a new technical means for rapid on-site sex diagnosis in parrots.

[0007] This invention provides a primer and probe set for parrot sex identification based on multiplex RPA amplification, characterized in that it includes CHD-Z gene primers and CHD-W gene primers, wherein the nucleotide sequence of the CHD-Z gene primers is shown in SEQ ID NO. 1~2; and the nucleotide sequence of the CHD-W gene primers is shown in SEQ ID NO. 4~5.

[0008] Preferably, it includes a CHD-Z gene probe and a CHD-W gene probe; the nucleotide sequence of the CHD-Z gene probe is shown in SEQ ID NO.3; the nucleotide sequence of the CHD-W gene probe is shown in SEQ ID NO.6.

[0009] Preferably, the CHD-W gene probe has a fluorescently labeled thymine nucleotide at position 31, a tetrahydrofuran at position 32, and a quencher-labeled thymine nucleotide at position 35. The CHD-Z gene probe has a fluorescently labeled thymine nucleotide at position 30, a tetrahydrofuran at position 31, and a quenching group labeled thymine nucleotide at position 32.

[0010] Preferably, the fluorescent group includes any one or two of the following: FAM, VIC, HEX, ROX, CY5, and TAMRA; The quenching group includes any one of the following: BHQ1 and BHQ2.

[0011] Preferably, the 3' ends of the CHD-W gene probe and the CHD-Z gene probe include a blocking substance, which is any one of C3 Spacer, biotin-TEG, and phosphate.

[0012] The present invention also provides a lyophilized reagent, including the aforementioned parrot sex identification primers and probe set based on multiplex RPA amplification.

[0013] The present invention also provides an RPA detection kit, including the aforementioned parrot sex identification primers and probe set based on multiplex RPA amplification.

[0014] Preferably, the molar ratio of the CHD-Z gene primer, CHD-Z gene probe, CHD-W gene primer, and CHD-Z gene probe is (1-3):(0.2~0.8).

[0015] This invention also provides the application of the parrot sex identification primers and probes based on multiplex RPA amplification in the preparation of a fully lyophilized kit for detecting parrot sex.

[0016] This invention also provides a method for sex determination of parrots for purposes other than disease diagnosis and treatment, characterized by comprising the following steps: Genomic DNA was extracted from the sample to be tested; Using the genomic DNA as a template, RPA detection was performed using the lyophilized reagent described in claim 6; If only the CHD-Z gene shows an amplification curve, then the sample to be tested is a male parrot sample. If both the CHD-Z and CHD-W genes show amplification curves, then the sample to be tested is a female parrot sample.

[0017] Preferably, the parrot is a sun conure (Aratinga solstitialis), a macaw (Ara macao), a monk parakeet (Myiopsitta monachus), a lorikeet (Trichoglossus haematodus), a lovebird (Agapornis roseicollis), a budgerigar (Melopsittacus undulatus), a cockatiel (Nymphicus hollandicus), or an Amazon parrot (Amazona).

[0018] Preferably, the reaction procedure for the RPA detection is a reaction at 41°C for 20-30 minutes.

[0019] In summary, compared with the prior art, the present invention achieves the following technical effects: 1. The primer and probe set provided by this invention is used to detect the sex of parrots. Through fluorescence recognition, the double-stranded DNA can be unstranded under isothermal conditions and cyclic amplification can be performed. The amplification of positive samples can be completed within 20-30 minutes, and the amplification results can be interpreted by a common fluorescence detector.

[0020] 2. In actual sample testing, the lyophilized reagent of this invention exhibits no cross-amplification, no non-specific signals, and no false positives or false negatives. It achieves a 100% accuracy rate in detecting eight mainstream parrot species, and the sex determination results are reliable.

[0021] 3. The primer and probe set of this invention has high amplification efficiency, strong signal amplification capability, and a detection limit as low as 1000 copies / mL. It can still obtain effective amplification in trace samples (such as a small number of feather follicles, oral swabs, and trace blood samples), reducing the requirements for sample quantity and quality, and is suitable for young birds, weak birds, and non-invasive sampling scenarios.

[0022] 4. The freeze-dried reagent of this invention is convenient to use and easy to store. Stored in freeze-dried granule form, it avoids refrigeration and cold chain transportation; it can be applied to portable gene amplification devices, and is suitable for field, on-site, and home testing. It is of great significance for the detection of parrot sex, providing new technical support for parrot breeding management, species protection, and trade supervision. Attached Figure Description

[0023] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 For the multiplex RPA primer amplification test of this invention: (A) amplifying the CHDW-S2 template alone; (B) amplifying the CHDZ-S2 template alone; (C) amplifying the CHDW-S2 and CHDZ-S2 templates simultaneously.

[0025] Figure 2 For this invention, a multiple RPA detection limit test was performed with a template concentration of 200 copies / mL and 3 replicates per reaction.

[0026] Figure 3 For the multiple RPA negative test of this invention, the template is mixed with enzyme-free water, and each reaction is repeated 8 times.

[0027] Figure 4 These are representative images of the results of sex detection in parrots using the SLAN qPCR instrument from Hongshi. Only the FAM channel shows a peak, indicating female; both FAM and ROX channels show peaks simultaneously, indicating female.

[0028] Figure 5 This is a representative result image of the operation performed using the Mini4 isothermal nucleic acid amplification instrument in this invention. Green (-) indicates female and red (+) indicates female. Detailed Implementation

[0029] The embodiments of the present invention will be described in detail below with reference to the examples. However, those skilled in the art will understand that the following examples are only for illustrating the present invention and should not be regarded as limiting the scope of the present invention. Specific conditions not specified in the examples shall be carried out according to conventional conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0030] In this invention, all raw materials and corresponding nucleic acid releasing agents of the multiple RPA reaction reagent are produced by Changqi Biotechnology Co., Ltd., and the freeze-drying process is optimized by Changqi Biotechnology Co., Ltd.

[0031] Main instruments: The real-time PCR instrument is the SLAN-96S instrument from Shanghai Hongshi Medical Technology Co., Ltd.; the Mini4 isothermal nucleic acid amplification instrument is from Changqi Biotechnology Co., Ltd.

[0032] Example 1: Gene Recombinant Plasmid Template Generation and Genomic DNA Extraction

[0033] To generate molecular standards that can be used as positive controls and calibration templates with known copy numbers, this embodiment commercially synthesized the parrot CHD-Z gene fragment (GenBank accession number: KJ995972.1) and CHD-W gene fragment (GenBank accession number: OQ451134.1) at Shanghai Sangon Biotech and cloned them into the pUC57 vector. The plasmids were then replicated in *E. coli* DH5α cells, and extracted and purified using an endotoxin-free plasmid kit. The concentration of the synthesized plasmids was measured using a UV spectrophotometer, and the copy number was calculated based on the plasmid concentration: (plasmid concentration × 6.02 × 10²³ / (vector base number + target fragment base number) × 660 × 10⁹). The target concentrations of the plasmids (CHD-Z and CHD-W) were diluted to 100,000,000 copies / μL using TE buffer as stock solutions, named CHDZ-S1 and CHDW-S1 stock solutions, respectively.

[0034] Example 2: Design and Synthesis of Real-Time Multiplex RPA Primers and Probes

[0035] This embodiment designs specific primers and probes for CHD-Z and CHD-W genes. The primer and probe design principles are as follows: (1) The length of the forward / reverse primer is 30~35bp; (2) The 3-5 bases at the 5' end of the primer should avoid G bases, and the 3 bases at the 3' end should preferably be G and C bases; (3) The GC content of the primer should be between 30~70%; (4) The length of the amplification product should be between 100~300 bp; (5) The probe length should be between 46~52bp; (6) A tetrahydrofuran (dSpacer, THF) is labeled after the probe is ≥30bp from the 5' end, a fluorescent group is labeled upstream of THF, and a quenching group is labeled downstream of THF; (7) The THF is ≥15bp from the 3' end, and a C3-spacer modification group is labeled at the 3' end; (8) The probe should avoid palindromic sequences and pay attention to secondary structures.

[0036] The primer and probe sequence information obtained from the design is shown in Table 1. All primers and probes were synthesized by Shanghai Sangon Biotech.

[0037] Table 1 Primer and probe sequence information

[0038] In the CHD-W probe, position 31 is FAM-labeled thymine nucleotide, position 32 is tetrahydrofuran, and position 35 is BHQ1-labeled thymine nucleotide; in the CHD-Z probe, position 30 is ROX-labeled thymine nucleotide, position 31 is tetrahydrofuran, and position 32 is BHQ1-labeled thymine nucleotide.

[0039] Example 3 Real-time Multiple RPA Response Test

[0040] (1) Preparation of real-time multiple RPA reaction lyophilization reagent After synthesizing the CHD-W and CHD-Z primers and probes, a premix was prepared according to the primer and probe addition amounts in Table 2, along with 5 ng UvsX, 5 ng UvsY, 10 ng GP32, 10 ng Bsu enzyme preparation; 50 μM dNTPs; 10 mM creatine phosphate / creatine kinase, 10 mM Tris-HCl, 14 mM MgOAc; and 5% PEG35000 buffer. The mixture was then added to liquid nitrogen to form microspheres, which were subsequently lyophilized to prepare a fully lyophilized reagent.

[0041] Table 2 Primer and probe addition amounts

[0042] (2) Real-time multi-RPA testing Multiplex real-time fluorescence RPA reactions were performed using the above-mentioned lyophilized reagents. The specific procedures were as follows: CHDZ-S1 and CHDW-S1 stock templates were diluted with TE buffer to 10000 copies / mL (CHDZ-S2, CHDW-S2), respectively. Three sets of experiments were conducted: In the first set, 50 μL of CHDZ-S2 template was added to the lyophilized microspheres; in the second set, 50 μL of CHDW-S2 template was added to the lyophilized microspheres; and in the third set, 25 μL of both CHDZ-S2 and CHDW-S2 templates were added to the lyophilized microspheres. The RPA reaction was performed using a SLAN scanner at 41℃ for 30 s / cycle, with fluorescence collected for a total of 60 cycles. The amplification results are shown below. Figure 1 The amplification of the CHDZ-S2 template alone resulted in a normal peak, as did the amplification of the CHDW-S2 template alone. Simultaneous amplification of both CHDZ-S2 and CHDW-S2 templates also showed a normal positive peak, indicating good compatibility among the primers in the group and the absence of non-specific amplification.

[0043] Example 4: Real-time Multiple RPA Detection Limit Test

[0044] Multiplex real-time fluorescence RPA reactions were performed using the fully lyophilized reagent prepared in Example 3. The specific procedures were as follows: CHDZ-S1 and CHDW-S1 stock templates were diluted with TE buffer to 400 copies / mL (CHDZ-S3, CHDW-S3), and 25 μL of CHDZ-S2 template and 25 μL of CHDW-S2 template were added to lyophilized microspheres, respectively. Three replicates were performed using a macro-SLAN instrument. The RPA reaction conditions were 41℃, 30 s / cycle, and fluorescence was collected for a total of 60 cycles. The amplification results are shown below. Figure 2A positive normal peak can be observed in the multiplex real-time fluorescent RPA primer-probe combination. It is detectable at a template concentration of 1000 copies / mL.

[0045] Example 5: Real-time Multiplex RPA Negative Test

[0046] Multiplex real-time fluorescence RPA reactions were performed using the fully lyophilized reagent prepared in Example 3. The specific procedures were as follows: 50 μL of ddH₂O was added to lyophilized microspheres as a negative template; each reaction was performed in 8 replicates. The RPA reaction was performed using a Macrostone SLAN instrument at 41°C for 30 s / cycle, with fluorescence collected for a total of 60 cycles. The amplification results are shown below. Figure 3 It can be seen that the negative result of the multiplex real-time fluorescent RPA primer-probe combination does not trigger. A negative result is normal.

[0047] Example 6: Testing of real samples of different species of parrots for sex

[0048] 1. Operating Procedures a. Blood swab sampling: Gently hold and stabilize the parrot, selecting a relatively soft foot. Open the cap of the lancet, press firmly on the foot to puncture it, and squeeze out a small drop of blood. Gently wipe the blood drop with a cotton swab (just enough to see a red blood sample; be careful not to use too much blood). Place the sampled cotton swab into a tube containing nucleic acid release agent.

[0049] b. Parrot Feather Samples: Gently hold and stabilize the parrot. Select feathers that are currently growing from the chest, abdomen, back, or under the wings. Pinch the base of the selected feather firmly with your thumb and forefinger. Quickly and decisively pluck the feather in the direction of growth. Ensure that the plucked feather has a translucent, gel-like, or fleshy follicle (commonly known as a "follicle bulb"). It is recommended to pluck about 3 feathers for each test to ensure sufficient nucleic acid for detection. Trim the base of the feather with the follicle with small scissors and place it in a nucleic acid release agent.

[0050] c. Parrot oral swab sample: Gently hold and stabilize the parrot, insert the sampling swab deep into the parrot's mouth until it reaches the pharynx, swab back and forth 2-3 times and rotate to collect secretions. Place the collected swab into a tube containing nucleic acid release agent.

[0051] d. Extracted nucleic acid: Sampling was performed according to the sampling requirements of the nucleic acid extraction kits from different manufacturers to obtain clean, pure nucleic acid.

[0052] 2. Real-time multiplex RPA amplification a. Hongshi qPCR instrument: Multiplex real-time fluorescence RPA reactions were performed using the fully lyophilized reagents prepared in Example 3. Using the above-mentioned template containing nucleic acid release agent or extracted pure nucleic acid as a template, 50 μL was added to lyophilized microspheres. The Hongshi SLAN instrument was used for the RPA reaction at 41℃ for 30 s / cycle, and fluorescence was collected for a total of 60 cycles. CT values ​​were statistically analyzed. Representative results are shown below. Figure 4 As shown, only the FAM channel peaks and is considered female; both the FAM and ROX channels peaking simultaneously is considered female.

[0053] b. Mini4 isothermal nucleic acid amplification instrument: Multiplex real-time fluorescence RPA reactions were performed using the fully lyophilized reagents prepared in Example 3. Using the above-mentioned template containing nucleic acid release agent or extracted pure nucleic acid as a template, 50 μL was added to lyophilized microspheres, and the reaction was performed using a Mini4 isothermal nucleic acid amplification instrument. Representative results are shown below. Figure 5 As shown, green (-) indicates males and red (+) indicates females.

[0054] c. For this experiment, more than 20 parrots of each species were randomly selected for the experiment, and 20 sets of valid results were obtained, as shown in the table below, using numbers 1-20. All parrots were commercially available.

[0055] 3. Sex determination of Sun Conures (Samples of the Sun) Table 3. Sex Statistics of Sun Conures

[0056] 4. Sex determination of macaws based on actual samples Table 4. Male and Female Statistics of Macaws

[0057] 5. Sex determination of monk parrots (a type of parrot) Table 5. Sex Statistics of Monk Parrots

[0058] 6. Sex determination of actual samples of lorikeets Table 6. Sex Statistics of Lorikeets

[0059] 7. Sex determination of lovebirds based on actual samples Table 7. Sex Statistics of Lovebirds

[0060] 8. Sex determination of budgies (parrots) Table 8. Sex Statistics of Budgerigars

[0061] 9. Sex determination of cockatiels based on actual samples Table 9. Cockatiel Sex Statistics

[0062] 10. Sex determination of Amazon parrots based on actual samples Table 10. Amazon Parrot Sex Statistics

[0063] The results showed that the multiplex RPA detection system of this invention achieved stable amplification in all eight parrot samples, with no obvious non-specific signals or false positives or false negatives. Male parrot samples showed only a specific amplification curve for the CHD-Z gene, with no amplification signal for the CHD-W gene; female parrot samples showed two specific amplification curves for both the CHD-Z and CHD-W genes, and the interpretation results from both instruments were completely consistent. This indicates that the primers, probes, and fully lyophilized RPA detection system described in this invention have high specificity, good repeatability, and a wide range of applicable matrices, enabling rapid and accurate sex identification for eight common parrot species. The detection results are completely consistent with the gold standard method, with an accuracy rate of 100%.

[0064] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0065] sequence list SEQ ID NO.1 ATTACTCTTCTTTGGCTTGTACTTTTGGG SEQ ID NO.2 TTCTTGGTTGTTTTCTGTCTGAGATGGAGT SEQ ID NO.3 ATTTTCACACATGAYACCCCCYACACCTAC(FAM-dT)(THF)CC(BHQ1-dT) CCCTMATTTTTG-C3 space SEQ ID NO.4 CTCGGAAAGGAAACGGCCAAAAAAGCGT SEQ ID NO.5 CATCATTATGTTTTGTCCCTTTAAATATTCG SEQ ID NO.6 GAACTATTCCTCGAGAAAATATTAAAGGA(ROX-dT)(THF)(BHQ1-dT)AGTGATGCAGAGATC-C3space。

Claims

1. A primer and probe set for parrot sex identification based on multiplex RPA amplification, characterized in that, It includes CHD-Z gene primers and CHD-W gene primers, wherein the nucleotide sequences of the CHD-Z gene primers are shown in SEQ ID NO. 1~2; and the nucleotide sequences of the CHD-W gene primers are shown in SEQ ID NO. 4~5.

2. The parrot sex identification primer and probe set based on multiplex RPA amplification according to claim 1, characterized in that, Including CHD-Z gene probes and CHD-W gene probes; The nucleotide sequence of the CHD-Z gene probe is shown in SEQ ID NO.3; the nucleotide sequence of the CHD-W gene probe is shown in SEQ ID NO.

6.

3. The parrot sex identification primer and probe set based on multiplex RPA amplification according to claim 2, characterized in that, The CHD-W gene probe has a fluorescently labeled thymine nucleotide at position 31, a tetrahydrofuran at position 32, and a quencher-labeled thymine nucleotide at position 35. The CHD-Z gene probe has a fluorescently labeled thymine nucleotide at position 30, a tetrahydrofuran at position 31, and a quenching group labeled thymine nucleotide at position 32.

4. The parrot sex identification primer and probe set based on multiplex RPA amplification according to claim 3, characterized in that, The fluorescent group includes any one or two of the following: FAM, VIC, HEX, ROX, CY5, and TAMRA; The quenching group includes any one of the following: BHQ1 and BHQ2.

5. The parrot sex identification primer and probe set based on multiplex RPA amplification according to claim 3, characterized in that, The 3' ends of the CHD-W gene probe and the CHD-Z gene probe include a blocking substance, which is any one of C3 Spacer, biotin-TEG, and phosphate.

6. A lyophilized reagent, characterized in that, Includes the parrot sex identification primers and probe sets based on multiplex RPA amplification as described in any one of claims 1 to 5.

7. An RPA detection kit, characterized in that, Includes the parrot sex identification primers and probe set based on multiplex RPA amplification as described in claim 6.

8. The application of the parrot sex identification primers and probes based on multiplex RPA amplification as described in any one of claims 1 to 5 in the preparation of a lyophilized kit for detecting parrot sex.

9. A method for sex determination in parrots for purposes other than disease diagnosis and treatment, characterized in that, Includes the following steps: Genomic DNA was extracted from the sample to be tested; Using the genomic DNA as a template, RPA detection was performed using the lyophilized reagent described in claim 6; If only the CHD-Z gene shows an amplification curve, then the sample to be tested is a male parrot sample. If both the CHD-Z and CHD-W genes show amplification curves, then the sample to be tested is a female parrot sample.

10. The method according to claim 9, characterized in that, The parrots mentioned are: Sun Conure (Aratingasolstitialis), Macaw (Ara macao), Monk Parrot (Myiopsitta monachus), Lorikeet (Trichoglossus haematodus), Lovebird (Agapornis roseicollis), Budgerigar (Melopsittacus undulatus), Cockatiel (Nymphicus hollandicus), or Amazon Parrot (Amazona).

Images