Dual real-time fluorescent PCR detection kit and detection method for alternaria solani and alternaria solani

Abstract

This invention discloses a dual real-time fluorescent PCR detection kit and method for *Potato variegata* and *Tomato scab*, belonging to the fields of plant quarantine and molecular biology detection technology. The kit comprises a first primer and probe set designed for the *Potato variegata* LSO-16s gene and a second primer and probe set designed for the *Tomato scab* CMM_2476 gene, with the probes labeled with FAM and VIC fluorescent groups, respectively. By optimizing the probe concentration and reaction conditions, a dual real-time fluorescent PCR system capable of simultaneously detecting both pathogens is constructed. Experiments show that the kit exhibits good specificity and no cross-reactivity with closely related strains; the limit of detection is 2.4 copies / reaction, demonstrating high sensitivity. This method can reduce detection time and cost by approximately 50%, making it suitable for port quarantine and large-scale screening of tomato seeds.

Description

Technical Field

[0001] This application relates to the fields of plant quarantine and molecular biology detection technology, specifically to a dual real-time fluorescent PCR detection kit and detection method for potato spot disease and tomato canker disease. Background Technology

[0002] Detection of plant quarantine pathogens is a crucial step in port quarantine and seed health certification. Potato spot pathogen ( ) Candidatus Liberibacter solanacearum, Lso) and tomato canker pathogen ( Clavibacter michiganensis subsp. michiganensis Both L. solanum and Cmm are quarantine bacteria that seriously affect tomato production. L. solanum infection can cause stunted growth, yellowing, and terminal shoot wilting, leading to yield losses of over 50% in severe cases. Cmm causes wilting, browning of stems, and hollow rot of the pith, potentially resulting in total crop failure. Both pathogens can be transmitted over long distances through seeds and are difficult to eradicate once introduced. They are listed as quarantine pests for imported plants in my country.

[0003] Currently, detection methods for Lso and Cmm mainly include traditional isolation and culture, serological detection, and singlet PCR. Lso is a phloem-restricted, difficult-to-culture bacterium, making it impossible to obtain the pathogen through conventional isolation and culture, thus posing a significant detection challenge. Serological methods also fall short of meeting early sensitivity requirements. While singlet PCR offers high sensitivity, it can only detect one pathogen per reaction. In port quarantine and seed company settings requiring large-scale screening of two or more pathogens, the long detection time and high reagent costs make it difficult to meet the demands of high-throughput detection.

[0004] Dual real-time fluorescence PCR technology, by introducing specific primers and probes targeting different targets and labeling them with different fluorescent groups in the same reaction tube, can simultaneously detect multiple targets in a single amplification, offering advantages such as high efficiency, speed, and low cost. However, Lso and Cmm belong to the same genus Corynebacterium taxonomically and have high sequence homology, making the design of highly specific primers and probes and the avoidance of cross-reactivity a technical challenge. Furthermore, ensuring that the amplification efficiency and fluorescence signal of the two targets do not interfere with each other in the same system requires precise optimization of reaction conditions, for which current technologies lack mature solutions. Summary of the Invention

[0005] To address the technical problem of the inability to simultaneously and efficiently detect both potato spot causal agent and tomato canker pathogen in existing technologies, this application provides a dual real-time fluorescent PCR detection kit and method for both potato spot causal agent and tomato canker pathogen.

[0006] This application provides a dual real-time fluorescent PCR detection kit for simultaneously detecting *Potato variegata* and *Tomato scab*, comprising: a first primer-probe set and a second primer-probe set; the first primer-probe set includes an upstream primer, a downstream primer, and a probe for specifically amplifying the *Potato variegata* LSO-16s gene, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:1, the nucleotide sequence of the downstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the probe is shown in SEQ ID NO:3; the second primer-probe set includes an upstream primer, a downstream primer, and a probe for specifically amplifying the *Tomato scab* CMM_2476 gene, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:4, the nucleotide sequence of the downstream primer is shown in SEQ ID NO:5, and the nucleotide sequence of the probe is shown in SEQ ID NO:6. As shown in NO:6; the probe of the first primer-probe set is labeled with a first fluorescent reporter group at the 5' end and a first quencher group at the 3' end; the probe of the second primer-probe set is labeled with a second fluorescent reporter group at the 5' end and a second quencher group at the 3' end.

[0007] The sequence is as follows: SEQ ID NO: 1: CAAGTCGAGCGCTTATTTTTAATAG; SEQ ID NO:2:TCCGTGCGTTATCCCGTAGA; SEQ ID NO:3:CCCACCGGTTACTCACCCGTCT; SEQ ID NO:4: CCTGGGCGTCGAGGAGC; SEQ ID NO: 5: GTGCTCAACACGGACGCCT; SEQ ID NO:6: CAGGACGACGTGGCCACCGC.

[0008] This kit utilizes specifically designed primers and probes targeting the LSO-16s gene of Lso and the CMM_2476 gene of Cmm. The two sets of probes are labeled with different fluorescent reporter groups (FAM and VIC), allowing independent detection of both targets in the same reaction tube. Primers were validated by NCBI BLAST analysis, demonstrating their ability to specifically amplify only the target sequences of the pathogens. Optimization of probe concentrations (0.16 μmol / L for the second primer / probe set and 0.1 μmol / L for the first primer / probe set) ensures that the amplification curves for both targets exhibit low Ct values ​​and high fluorescence signal intensities in the same reaction system, without interference. Specificity tests show that this kit exhibits excellent specificity against closely related strains (such as *Potamogeton crispus*, *Brassica napus*, *Brassica oleracea*, *Brassica oleracea*, and *Brassica oleracea*), with no cross-amplification. Sensitivity test results show that the kit's limit of detection is 2.4 copies / reaction, and its limit of stable detection is 24 copies / reaction, meeting the sensitivity requirements for port quarantine and high-throughput screening. This kit can be used directly with commercial nucleic acid extraction kits; after extracting total DNA from the sample, it can be used directly for amplification, making the operation simple and easy to standardize.

[0009] Furthermore, the first fluorescent reporter group is FAM, and the second fluorescent reporter group is VIC. The emission spectral peaks of FAM and VIC are around 520 nm and 550 nm, respectively, with little spectral overlap. They can be detected independently in different channels of commonly used real-time fluorescence PCR instruments, effectively avoiding interference between the two target detection signals and ensuring the accuracy of interpretation.

[0010] Furthermore, the 3' end of the probe in the first primer-probe set is labeled with a quenching group of BHQ1; the 3' end of the probe in the second primer-probe set is labeled with a quenching group of BHQ2. BHQ1 can effectively quench FAM fluorescence, and BHQ2 can effectively quench VIC fluorescence. Both are classic quenching groups that match their corresponding fluorescent groups well, which can significantly reduce background fluorescence signal and improve signal-to-noise ratio.

[0011] Furthermore, the kit also includes real-time fluorescence PCR premix, sterile water, and / or positive plasmid standards. The real-time fluorescence PCR premix (such as Tiangen SuperReal fluorescence quantitative premix reagent (probe method) FP206) can be directly used to prepare the reaction system, simplifying the operation process; the positive plasmid standards can form a complete positive control system to verify the validity of each experiment, avoid false negative results, and improve the reliability of the kit.

[0012] The second aspect of this application provides a dual real-time fluorescent PCR detection method for simultaneously detecting *Potato Fibrosum* and *Tomato Ulcer* for non-disease diagnostic purposes, comprising the following steps: extracting nucleic acid from the sample to be tested; preparing a dual real-time fluorescent PCR reaction system using the detection kit described in any one of the above claims, wherein the reaction system contains the first primer and probe set, the second primer and probe set, and the nucleic acid; performing real-time fluorescent PCR amplification under the following conditions: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 60℃ annealing and extension for 1 min, for a total of 40 cycles; detecting the fluorescence signals of the FAM channel and VIC channel respectively, and determining the results based on the amplification curves: if a typical S-shaped amplification curve appears in the FAM channel, the sample is determined to contain *Potato Fibrosum*; if a typical S-shaped amplification curve appears in the VIC channel, the sample is determined to contain *Tomato Ulcer*. This method, by simultaneously detecting two targets in the same reaction tube, can replace the original two single PCR operations, reducing detection time and reagent costs by approximately 50%, and significantly improving the efficiency of port quarantine and large-scale screening.

[0013] Furthermore, the dual real-time fluorescence PCR reaction system is a 50 μL system, comprising: 25 μL of 2× real-time fluorescence PCR premix, 1 μL each of forward and reverse primers, 0.5-0.8 μL each of probes, 2.0 μL each of nucleic acid template, and the remainder being sterile water. This system is easy to prepare, with appropriate amounts of each component, and can be used directly on a conventional real-time fluorescence PCR instrument.

[0014] Furthermore, the final concentration of the probes from the second primer-probe set in the reaction system was 0.16 μmol / L, and the final concentration of the probes from the first primer-probe set in the reaction system was 0.1 μmol / L. Optimization results showed that, under this concentration combination, both targets achieved the lowest Ct values ​​and the highest fluorescence signal intensities, achieving the best balance between detection efficiency and sensitivity.

[0015] Furthermore, the nucleic acid template is the total DNA of the sample to be tested. The total DNA can be extracted from the sample to be tested using common nucleic acid extraction methods (such as the CTAB method or magnetic bead method). The extracted DNA can be directly used for amplification without further purification, making the operation convenient.

[0016] Furthermore, the method has a limit of detection of 2.4 copies / reaction and a limit of stable detection of 24 copies / reaction. Experiments show that even with extremely low levels of target nucleic acid in the sample, this method can reliably detect the pathogen, effectively avoiding missed detections due to low concentrations of pathogens.

[0017] Furthermore, the sample to be tested is tomato seed or plant tissue. This method is particularly suitable for port quarantine of tomato seeds and seed health certification for enterprises, and is also applicable to the early diagnosis of diseases in tomato plants and other Solanaceae plant tissues. It has a wide range of applications and is highly practical.

[0018] This application has the following beneficial effects: By designing specific primers and probes targeting the LSO-16s gene of Lso and the CMM_2476 gene of Cmm, and labeling them with FAM and VIC fluorescent groups respectively, we were able to detect two quarantine pathogens simultaneously in a single real-time fluorescent PCR reaction. The detection efficiency was doubled compared to traditional singleton PCR, and the reagent cost was reduced by about 50%.

[0019] After optimizing the probe concentration, the amplification efficiency of the two sets of primers and probes in the same system is balanced, the fluorescence signals do not interfere with each other, the detection specificity is good, there is no cross-reaction with a variety of closely related strains, and the interpretation results are accurate and reliable.

[0020] It has high detection sensitivity, with a minimum detection limit of 2.4 copies / reaction and a minimum stable detection limit of 24 copies / reaction, which can meet the early warning needs of port quarantine and seedling enterprises for low concentrations of pathogens and effectively avoid missed detection.

[0021] The kit has a simple composition and standardized detection method, which can be used directly with conventional real-time fluorescence PCR instruments without the need for special equipment. It has good practicality and scalability.

[0022] It is suitable for rapid detection of tomato seeds and other plant tissue samples, providing an efficient technical tool for preventing the spread of quarantine diseases at ports and ensuring the sustainable development of the tomato planting industry. Attached Figure Description

[0023] Figure 1 These are the optimized detection curves for the CMM and LSO real-time quantitative PCR amplification systems. 1: LSO real-time quantitative amplification curve; 2: CMM real-time quantitative amplification curve; a: CMM probe 0.5 μL, LSO probe 0.5 μL; a: CMM probe 0.6 μL, LSO probe 0.5 μL; c: CMM probe 0.8 μL, LSO probe 0.5 μL; d: CMM probe 1 μL, LSO probe 0.5 μL.

[0024] Figure 2 This is the Cmm real-time quantitative PCR specific detection amplification curve, 1: Cmm real-time quantitative PCR amplification line.

[0025] Figure 3 This is the LSO real-time quantitative PCR specific detection amplification curve, 1: LSO real-time quantitative PCR amplification curve.

[0026] Figure 4 These are the amplification curves for Cmm and Lso real-time quantitative PCR sensitivity detection. 1: Lso amplification curve; a~j: 1.2×10 10 Copies / μL-1.2×10 Copies / μL.

[0027] Figure 5 This is the amplification curve for LSO real-time quantitative PCR sensitivity detection.

[0028] Figure 6 This is the Cmm real-time quantitative PCR sensitivity detection amplification curve, 1: Cmm amplification curve; a~k: 1.2×10 10 Copies / μL - 1.2 Copies / μL.

[0029] Figure 7 These are amplification curves for real-time quantitative PCR sensitivity detection of simulated bacterial seed samples. 1: Lso fluorescence quantitative amplification curve; 2: Cmm fluorescence quantitative amplification curve. Detailed Implementation

[0030] Example 1: Establishment of a dual real-time fluorescence PCR detection method 1. Materials and Methods 1.1 Test materials Positive materials: positive plasmids of potato spot disease, plasmids of tomato canker disease, and common strains of imported tomato seeds from Beijing port that require testing (for specificity testing).

[0031] Seed samples: healthy tomato seeds (negative for Cmm and Lso by quantitative real-time PCR) and artificially simulated bacteria-carrying seeds (healthy tomato seeds were soaked in a mixed bacterial suspension carrying potato scab patches and plasmids of tomato canker pathogens).

[0032] Main reagents: Nucleic acid extraction kit (CTAB method or magnetic bead method), Tiangen SuperReal fluorescence quantitative premixed reagent (probe method) (FP206).

[0033] 1.2 Sequence alignment analysis of target pathogens and primer synthesis The reference genomes of *Potato variegata* (CP002371.1) and *Tomato ulcerans* (AM711867.1) were downloaded from the NCBI public database. By comparing the target genes of *Potato variegata* and *Tomato ulcerans* with other closely related pathogens in Table 1, conserved and specific target genes of each pathogen were selected to design primers and probes. The designed primers were analyzed by NCBI Blast and could only specifically amplify *Potato variegata* and *Tomato ulcerans*. The primers and probes were synthesized by Sangon Biotech Co., Ltd.

[0034] Table 1: Summary of Target Internal Standard Primer and Probe Design in this Invention

[0035] 1.3 Preparation of plasmid standards for potato spot disease and tomato canker disease The reference genome sequences of *Potato Fibroblastus* (CP002371.1) and *Tomato Ulcer* (AM711867.1) were downloaded from the NCBI public database. The amplified fragment sequences were determined by combining the primer and probe sequences in Table 1. Positive plasmid samples of *Potato Fibroblastus* and *Tomato Ulcer* were then synthesized by Qingke Biotechnology.

[0036] 1.4 Establishment and optimization of a dual real-time quantitative PCR system A 50 μL real-time quantitative PCR reaction system was prepared according to the instructions of the Tiangen SuperReal premixed reagent (probe method) (FP206) kit: 25 μL Premix ExTaq (2×), 2.0 μL each of CMM and LSO templates, 1 μL each of CMM forward and reverse primers, 0.5 μL probe, 1 μL each of LSO forward and reverse primers, 0.5 μL probe, and 16 μL sterile water. The real-time quantitative PCR reaction system and conditions were optimized under different final probe concentrations (0.1, 0.12, 0.16, 0.2 μmol / L). The optimal dual real-time quantitative PCR reaction system and reaction conditions were determined by fine-tuning the probe concentration based on the Ct value and fluorescence signal intensity of the amplification reaction: 25 μL Premix ExTaq (2×), 2.0 μL each of CMM and LSO templates, 1 μL each of CMM forward and reverse primers, 0.8 μL probe (final probe concentration 0.16 μmol / L), 1 μL each of LSO forward and reverse primers, 0.5 μL probe, and 15.7 μL sterile water; the reaction conditions were 95 ℃ for 10 min; 95 ℃ for 15 s, 60 ℃ for 1 min, for 40 cycles; the results are shown in the figure. Figure 1 .

[0037] In some preferred embodiments, the fluorescent reporter group labeled in the first primer-probe set can be selected from any one of FAM, HEX, ROX, CY5, and TET, and the corresponding quencher group can be selected from any one of BHQ1, DABCYL, and TAMRA; the fluorescent reporter group labeled in the second primer-probe set can be selected from any one of VIC, HEX, ROX, CY5, and TET, and the corresponding quencher group can be selected from any one of BHQ2, DABCYL, and TAMRA, as long as the fluorescence spectra of the two channels do not overlap.

[0038] In some preferred embodiments, the final concentration of the probe in the dual real-time fluorescence PCR reaction system can be arbitrarily selected between 0.05 μmol / L and 0.3 μmol / L, preferably between 0.1 μmol / L and 0.2 μmol / L. When the two probe sets are used simultaneously, the final concentration of each probe can be independently selected from any value among 0.05 μmol / L, 0.08 μmol / L, 0.1 μmol / L, 0.12 μmol / L, 0.16 μmol / L, 0.2 μmol / L, and 0.25 μmol / L. Through optimization, the Ct values ​​of the two targets can be brought to the optimal level.

[0039] In some preferred embodiments, the total volume of the dual real-time fluorescence PCR reaction system can be 20 μL, 25 μL, 30 μL, 50 μL, or 100 μL, and the amount of each component can be adjusted according to the total volume ratio. When the total volume of the system is 50 μL, the amount of 2× real-time fluorescence PCR premix can be 25 μL, with 0.5 μL to 2.0 μL each of the forward and reverse primers, 0.3 μL to 1.0 μL each of the probe, 1.0 μL to 5.0 μL each of the nucleic acid template, and the remainder being sterile water.

[0040] In some preferred embodiments, the annealing extension temperature in the real-time fluorescence PCR reaction conditions can be selected between 58°C and 62°C, preferably 60°C; the number of cycles can be selected between 35 and 45 cycles, preferably 40 cycles; and the denaturation time can be selected between 10 seconds and 20 seconds, preferably 15 seconds.

[0041] In some preferred embodiments, the nucleic acid template extraction method can be selected from any one of the following: CTAB method, magnetic bead method, SDS method, and column extraction method. The nucleic acid extraction kit can be a commercially available plant genomic DNA extraction kit, such as the Tiangen Plant Genomic DNA Extraction Kit, Qiagen DNeasy Plant Mini Kit, and OmegaBio-Tek EZNA Plant DNA Kit.

[0042] In some preferred embodiments, the sample to be tested can be selected from any one or more of the following: tomato seeds, tomato leaves, tomato stems, tomato fruits, potato tubers, pepper fruits, eggplant fruits, soil samples, and irrigation water samples. The sample to be tested can be pretreated by grinding, homogenization, etc., before nucleic acid extraction.

[0043] In some preferred embodiments, the real-time fluorescence PCR premix can be selected from any one of the following: Tiangen SuperReal Quantitative Fluorescence Premix (Probe Method) (FP206), Takara Premix Ex Taq (Probe qPCR), Bio-Rad iQSupermix, and Roche LightCycler 480 Probes Master. Different brands of premixes may vary slightly in buffer composition, polymerase activity, and dNTP ratio, but all can achieve dual real-time fluorescence PCR amplification compatible with the primer and probe set described in this application.

[0044] In some preferred embodiments, the positive plasmid standard can be prepared by cloning the target amplification fragment into commonly used vectors such as pUC57 and pMD19-T and then transforming it into E. coli, or it can be obtained directly through commercial gene synthesis services by linearizing the plasmid.

[0045] In some preferred embodiments, the real-time fluorescence PCR amplification can be performed on commonly used real-time fluorescence PCR instruments such as the ABI 7500, ABI QuantStudio 5, Bio-Rad CFX96, Roche LightCycler 480, and Rotor-Gene Q. The fluorescence acquisition channel settings may differ between instruments; the appropriate fluorescent group can be selected based on the instrument's filter combination.

[0046] In some preferred embodiments, the criteria for determining the test result can be as follows: if the Ct value is less than 35 and a typical S-type amplification curve appears, it is determined to be positive; if the Ct value is between 35 and 40 and an S-type amplification curve appears, it is determined to be weakly positive and needs to be retested for confirmation; if the Ct value is greater than 40 or there is no Ct value, or although a Ct value appears but there is no typical S-type amplification curve (such as the curve height being lower than the threshold line), it is determined to be negative.

[0047] Example 2 Specificity Test The test subjects included DNA from *Potato rot*, *Tomato canker*, common strains of *Tomato* seeds imported through Beijing port that require testing (such as *Potato ring rot*, *Maize wilt*, *Cucurbita variegata*, *Bean wilt*, and *Tomato bacterial leaf spot*, see Table 2 for a summary of reference strains), DNA from healthy plants, and a blank control. Results are as follows: Figure 2 and Figure 3 As shown, only the reaction tube containing the target strain showed a typical S-shaped amplification curve in the corresponding channel, while other samples did not show an amplification curve.

[0048] Table 2 Summary of Reference Strains

[0049] Example 3 Sensitivity Test After centrifuging the positive plasmids of the two bacteria, 100 μL of sterile water was added as the initial concentration, which was 1.2 × 10⁻⁶. 10 Copies / μL, followed by 10-fold serial dilutions for dual detection. The results showed that the initial concentration diluted 10 times... -10 At this time, Lso no longer has an effective amplification curve (see...). Figure 5 ), initial concentration diluted 10 -11 At this time, Cmm no longer showed an effective amplification curve (see...). Figure 6 The lowest detection limit for Cmm and Lso was calculated to be 2.4 copies, and the lowest stable detection limit was 24 copies for both.

[0050] Example 4: Detection of Simulated Bacterial Seed Samples Healthy tomato seeds were soaked separately in suspensions containing potato scab plasmid and tomato canker pathogen, respectively, to prepare simulated pathogen-carrying seed samples. The dual-fluorescence quantitative PCR system designed in this invention was used to detect the pathogens in 20 tomato samples and the simulated pathogen-carrying samples, as detailed below: Preparation of simulated bacterial-carrying seed samples: Healthy tomato seeds (which were negative for Cmm and Lso by quantitative real-time PCR) were soaked in a mixed bacterial suspension carrying Lso and Cmm positive plasmids, and incubated at room temperature with shaking for 30 min. After being removed, the seeds were rinsed three times with sterile water and dried for later use.

[0051] Nucleic acid extraction: Weigh 1.0 g of simulated bacteria-carrying tomato seed sample, grind it into powder with liquid nitrogen, extract total DNA using the CTAB method, and finally dissolve it in 50 μL of sterile water. After determining the concentration, it is ready for use.

[0052] Reaction system preparation: Same as in Example 1, but the template is 2.0 μL of total DNA extracted from simulated bacterial-bearing seeds (added directly with nucleic acid extraction solution).

[0053] Real-time fluorescence PCR amplification procedure: Same as in Example 1.

[0054] Result determination: Figure 7 This indicates that only the simulated infected seed sample contained two pathogens, while none were detected in other samples.

Claims

1. A dual real-time fluorescent PCR detection kit for simultaneously detecting *Potato rotundus* and *Tomato canker*, characterized in that, include: First primer and probe set and second primer and probe set; The first primer-probe set comprises an upstream primer, a downstream primer, and a probe for specifically amplifying the LSO-16s gene of *Potato rotundus*. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:1, the nucleotide sequence of the downstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the probe is shown in SEQ ID NO:

3. The second primer-probe set comprises an upstream primer, a downstream primer, and a probe for specifically amplifying the CMM_2476 gene of *Tomato canker*. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:4, the nucleotide sequence of the downstream primer is shown in SEQ ID NO:5, and the nucleotide sequence of the probe is shown in SEQ ID NO:

6. The probe of the first primer-probe set is labeled with a first fluorescent reporter group at its 5' end and a first quencher group at its 3' end. The probe of the second primer-probe set is labeled with a second fluorescent reporter group at its 5' end and a second quencher group at its 3' end.

2. The detection kit according to claim 1, characterized in that, The first fluorescent reporter group is FAM, and the second fluorescent reporter group is VIC.

3. The detection kit according to claim 1, characterized in that, The quenching group labeled at the 3' end of the probe in the first primer-probe set is BHQ1; the quenching group labeled at the 3' end of the probe in the second primer-probe set is BHQ2.

4. The detection kit according to claim 1, characterized in that, The kit also includes real-time fluorescence PCR premix, sterile water, and / or positive plasmid standards.

5. A dual real-time fluorescent PCR detection method for simultaneously detecting *Potato rotundus* and *Tomato canker* pathogens for non-disease diagnostic purposes, characterized in that, Includes the following steps: Nucleic acid was extracted from the sample to be tested; a dual real-time fluorescence PCR reaction system was prepared using the detection kit according to any one of claims 1-4, wherein the reaction system contained the first primer and probe set, the second primer and probe set, and the nucleic acid; real-time fluorescence PCR amplification was performed under the following conditions: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 15 s, annealing and extension at 60℃ for 1 min, for a total of 40 cycles; the fluorescence signals of the FAM channel and VIC channel were detected respectively, and the results were determined according to the amplification curve: if a typical S-shaped amplification curve appeared in the FAM channel, the sample was determined to contain potato spot disease; if a typical S-shaped amplification curve appeared in the VIC channel, the sample was determined to contain tomato canker disease.

6. The detection method according to claim 5, characterized in that, The dual real-time fluorescence PCR reaction system is a 50 μL system, comprising: 25 μL of 2× real-time fluorescence PCR premix, 1 μL each of upstream and downstream primers, 0.5-0.8 μL each of probes, 2.0 μL each of nucleic acid templates, and the remainder being sterile water.

7. The detection method according to claim 6, characterized in that, The final concentration of the probes in the second primer-probe set in the reaction system is 0.16 μmol / L, and the final concentration of the probes in the first primer-probe set in the reaction system is 0.1 μmol / L.

8. The detection method according to claim 5, characterized in that, The nucleic acid template is the total DNA of the sample to be tested.

9. The detection method according to claim 5, characterized in that, The method has a limit of detection of 2.4 copies / reaction and a limit of stability of 24 copies / reaction.

Images