Flanking sequences of exogenous insert in transgenic maize WYN041 and application of DNA fragments of joint region

Abstract

This invention relates to the field of biotechnology, and more particularly to the flanking sequences and linker DNA fragments of the exogenous insert fragment in transgenic maize WYN041, and their applications. The core technology of this invention lies in the flanking sequences at both ends of the WYN041 exogenous insert fragment, explicitly providing the specific nucleotide sequences of the 5' flanking sequence (SEQ ID NO.1) and the 3' flanking sequence (SEQ ID NO.2), and further providing DNA fragments containing the linker site and their specific fragments, capable of reflecting the insertion structure unique to the WYN041 event. A system for the systematic identification of transgenic maize WYN041 has been established, providing complete sequence resources for WYN041 event identification, end-to-end verification, germplasm authenticity identification, progeny screening, and regulatory traceability.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to the flanking sequences and linker DNA fragments of the exogenous insert fragment in transgenic maize WYN041 and their applications. Background Technology

[0002] Transgenic maize event identification typically utilizes exogenous genes, promoters, terminators, or insertion site-related sequences as detection targets. Among these, event-specific detection methods based on the connection regions between exogenous insertion fragments and the host genome have high specificity and have been widely used in transgenic event identification, germplasm resource management, and regulatory monitoring.

[0003] The WYN041 transgenic maize event represents an insect-resistant and herbicide-tolerant transformation, and the insertion site of its exogenous insert in the maize genome is event-specific. While existing technologies have achieved detection of the WYN041 event, they largely rely on fixed amplified fragments; the lack of comprehensive utilization of flanking sequences and linker regions leads to insufficient resources for identifying subsequent systematic events, inadequate detection sensitivity and accuracy, and a lack of systematic methods for screening and identifying superior transformants of WYN041 transgenic maize. Therefore, it is particularly necessary to develop detection products and systems for identifying and breeding varieties of insect-resistant and herbicide-tolerant transgenic maize WYN041. Summary of the Invention

[0004] In view of this, the technical problem to be solved by the present invention is to provide a target fragment, primer set, kit and detection method for detecting insect-resistant and herbicide-tolerant maize WYN041.

[0005] This invention provides flanking sequences for exogenous inserts in transgenic maize WYN041, which include 5' flanking sequences and 3' flanking sequences;

[0006] The 5' flanking sequence includes a nucleotide sequence as shown in SEQ ID NO.1 or a specific fragment of a nucleotide sequence as shown in SEQ ID NO.1;

[0007] The 3' flanking sequence is the sequence shown in SEQ ID NO.2 or a specific fragment of the sequence shown in SEQ ID NO.2;

[0008] The genetically modified maize WYN041 has the accession number CGMCC No. 47181, and the accession date was June 4, 2026. Specifically, the accession information for the insect-resistant and herbicide-tolerant maize WYN041 transgenic with the Cry1Ab and am79epsps genes is as follows: biological material WYN041, classification name: maize Zea mays, deposited on June 4, 2026 at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the accession number CGMCC No. 47181;

[0009] Furthermore, the nucleotide sequence of a specific fragment of the nucleotide sequence shown in SEQ ID NO.1 is shown in SEQ ID NO.3;

[0010] The nucleotide sequence of a specific fragment of the nucleotide sequence shown in SEQ ID NO.2 is shown in SEQ ID NO.4.

[0011] This invention provides a target fragment for the detection of transgenic maize WYN041, the target fragment comprising the flanking sequence and exogenous insertion fragment described in this invention;

[0012] The exogenous inserted fragment includes: expression box 1 and / or expression box 2;

[0013] The expression box 1 includes: CaMV 35S promoter, adh1, truncated Cry1Ab and CaMV poly(A)signal;

[0014] The expression box 2 includes: ubiquitin promoter, sp, am79epsps and nos terminator.

[0015] Furthermore, the target fragment containing the expression cassette 2 is target fragment 1, which includes a nucleotide sequence as shown in SEQ ID NO. 5 or a specific fragment of a nucleotide sequence as shown in SEQ ID NO. 5;

[0016] The target fragment containing the expression cassette 1 is the target fragment 2, which includes: a nucleotide sequence as shown in SEQ ID NO. 6 or a specific fragment of the nucleotide sequence as shown in SEQ ID NO. 6;

[0017] Furthermore, the nucleotide sequence of a specific fragment of the nucleotide sequence shown in SEQ ID NO. 5 is shown in SEQ ID NO. 7 or SEQ ID NO. 8;

[0018] The nucleotide sequence of a specific fragment of the nucleotide sequence shown in SEQ ID NO. 6 is shown in SEQ ID NO. 9.

[0019] This invention provides a primer set for identifying transgenic maize WYN041, which uses the target fragment described in this invention as the detection target.

[0020] Furthermore, the primer set described in this invention includes:

[0021] Primer set 1, consisting of the upstream primer with nucleotide sequences as shown in SEQ ID NO. 11 and the downstream primer as shown in SEQ ID NO. 13; and / or

[0022] Primer set 2, consisting of the upstream primer with nucleotide sequences as shown in SEQ ID NO. 15 and the downstream primer with SEQ ID NO. 16; and / or

[0023] Primer set 3 consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.12 and a downstream primer as shown in SEQ ID NO.14.

[0024] Specifically, primer set 1 is used to amplify the 5' end linker region fragment of WYN041, and the amplification product is the fragment shown in SEQ ID NO.7;

[0025] Primer set 2 is used to amplify the substituted fragment of the 5' end linker region of WYN041, and the amplification product is the fragment shown in SEQ ID NO.8;

[0026] Primer set 3 is used to amplify the 3' end linker region fragment of WYN041, and the amplification product is the fragment shown in SEQ ID NO.9.

[0027] The primer combinations described above are not the sole focus of this technical solution, but rather a specific application method based on flanking sequences. As long as the target sequence is a flanking sequence of the WYN041 exogenous insert or a linker region formed by flanking sequences, it can be used as an application direction for the sequence resources of this technical solution.

[0028] This invention provides a kit for identifying transgenic maize WYN041, which includes the primer set and detection reagents described in this invention.

[0029] Furthermore, the detection reagents include: PCR amplification reagents and / or PCR product detection reagents.

[0030] The PCR product detection reagents include agarose gel electrophoresis reagents;

[0031] This invention provides the application of at least one of the following (A) to (D) in the detection of transgenic maize WYN041 or related materials, or in the breeding of superior varieties of transgenic maize WYN041:

[0032] A) The flanking sequence described in this invention;

[0033] B) The target fragment described in this invention;

[0034] C) The primer set described in this invention;

[0035] D) The reagent kit described in this invention.

[0036] This invention provides a method for detecting transgenic maize WYN041 or related materials, or for breeding superior varieties of transgenic maize WYN041, which involves detecting samples using at least one of the following methods (a) to (d):

[0037] a) The side sequence described in this invention;

[0038] b) The target fragment described in this invention;

[0039] c) The primer set described in this invention;

[0040] d) The reagent kit described in this invention.

[0041] This invention provides specific nucleotide sequences of flanking sequences at both ends of the exogenous insert fragment of transgenic maize WYN041, including 5' flanking sequences and 3' flanking sequences, and provides DNA fragments, specific fragments, and their applications based on the above flanking sequences.

[0042] Compared to existing identification methods for WYN041 transgenic maize, the technical focus of this invention is not simply to provide a PCR identification process, nor is it limited to a specific set of primers or a fixed amplification fragment. Instead, the core technical content lies in the flanking sequences at both ends of the WYN041 exogenous insert fragment. Specifically, this invention provides the 5' and 3' flanking sequences of the WYN041 exogenous insert fragment, and further provides specific fragments of these flanking sequences and their applications. By clearly defining the flanking sequences at both ends, basic sequence resources can be provided for the double-end confirmation, sequence verification, design of different detection targets, and regulatory tracing of the WYN041 event.

[0043] Furthermore, regarding the acquisition of flanking sequences, this invention employs a CRISPR / Cas9 targeted enrichment combined with long-read sequencing to directly enrich and resolve the linker region sequence between the WYN041 exogenous insert fragment and the maize genome, thereby obtaining or confirming the 5' flanking sequences, 3' flanking sequences, and boundary linker sequences. This is fundamentally different from existing technologies that obtain flanking sequences based on whole-genome short-read sequencing alignment, insertion site analysis, and segmented cloning and assembly.

[0044] This invention establishes a complete flanking sequence resource system for the WYN041 event by providing the 5' flanking sequence (SEQ ID NO.1) and 3' flanking sequence (SEQ ID NO.2) of the exogenous insertion fragment, as well as DNA fragments containing the linkage site (SEQ ID NO.5 and SEQ ID NO.6) and specific fragments (SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9). This resource system plays a crucial role in the subsequent development of new detection systems, the construction of standards, the establishment of two-end verification systems, and the implementation of regulatory traceability.

[0045] The present invention has promising applications in the identification of the WYN041 event, confirmation of germplasm materials, screening of offspring, and traceability of regulatory sources.

[0046] The method for identifying transgenic maize WYN041 based on flanking sequences in this invention has the following advantages:

[0047] First, the location of the exogenous DNA insertion in the WYN041 event determines its 5' and 3' flanking sequences. The connecting region formed by the adjacency of the flanking sequences and the exogenous insertion fragment is a continuous structure found only in the WYN041 genome.

[0048] Secondly, specific primers and PCR fragments are just one way to utilize flanking sequences. Focusing protection on flanking sequences and DNA fragments containing ligation sites allows for different primers, probes, amplification lengths, and detection platforms, thus avoiding the limitation of the technology to a single detection procedure.

[0049] Furthermore, the 5' flanking sequences and 3' flanking sequences can serve as two independent yet mutually corroborating sequence resources. If a sample simultaneously detects specific fragments formed by flanking sequences from both ends, it is more suitable for material authenticity verification and regulatory review than a single fixed amplified fragment.

[0050] Finally, this solution provides flanking sequence resources at both ends and application layouts based on these sequence resources, rather than repeating the detection process of one end of the first / second primer pair and the 517 bp / 373 bp fragment. This is fundamentally different from existing detection methods. Compared with existing technologies, this invention helps to improve detection accuracy and sensitivity.

[0051] This invention uses the flanking sequences at both ends of the exogenous insertion fragment WYN041 as its core technical content. For the first time, it clearly provides the specific nucleotide sequences of the 5' flanking sequence (SEQ ID NO.1) and the 3' flanking sequence (SEQ ID NO.2), and further provides the DNA fragment containing the linker site and its specific fragment. A system for the systematic identification of transgenic maize WYN041 has been established. This system provides complete sequence resources for WYN041 event identification, double-end verification, germplasm authenticity identification, progeny screening, and regulatory traceability, thereby improving the accuracy of WYN041 in subsequent detection processes. Attached Figure Description

[0052] Figure 1 A schematic diagram of the transformation vector Cry1Ab-am79-pC3301 is shown.

[0053] Figure 2 Figure showing the insect resistance screening results of single-copy candidate transformation events; where 1: WYN004; 2: WYN005; 3: WYN015; 4: WYN018; 5: WYN020; 6: WYN026; 7: WYN031; 8: WYN033; 9: WYN038; 10: WYN041; 11: WYN042; 12: WYN043; 13: WYN045; 14: WYN046; 15: WYN047; 16: WYN048; 17: WYN049; 18: WYN050;

[0054] Figure 3 The PCR detection results in step 4.3 of Example 1 are shown; where A: Cry1Ab gene; B: am79epsps gene; M: DNA molecular weight marker; 1: water; 2: non-transgenic maize SX1395; 3: plasmid Cry1Ab-am79-pC3301; 4~12, transgenic maize WYN041 of different generations;

[0055] Figure 4 The results of the insect resistance experiment in Example 2 are shown in the figure;

[0056] Figure 5 Schematic diagram showing the exogenous inserted sequence in transgenic maize WYN041;

[0057] Figure 6The image shows the PCR results specific to the 5' flanking sequence of the in vitro inserted fragment in transgenic maize WYN041; where M: DNA molecular weight marker; 1: plasmid Cry1Ab-am79-pC3301; 2: non-transgenic maize SX1395; 3: water; 4-6: T2 generation transgenic maize WYN041 plants; 7-9: T3 generation transgenic maize WYN041 plants; 10-12: T4 generation WYN041 plants;

[0058] Figure 7 The image shows the PCR results specific to the 3' flanking sequence of the in vitro inserted fragment in transgenic maize WYN041; where M: DNA molecular weight marker; 1: plasmid Cry1Ab-am79-pC3301; 2: non-transgenic maize SX1395; 3: water; 4-6: T2 generation transgenic maize WYN041 plants; 7-9: T3 generation transgenic maize WYN041 plants; 10-12: T4 generation WYN041 plants;

[0059] Figure 8 The image shows the specific PCR results of the replacement fragment of the 5' end linker region of WYN041 in Example 4; where M: DNA molecular weight marker; 1: plasmid Cry1Ab-am79-pC3301; 2: non-transgenic maize SX1395; 3: water; 4-6: T2 generation transgenic maize WYN041 plants; 7-9: T3 generation transgenic maize WYN041 plants; 10-12: T4 generation WYN041 plants;

[0060] Figure 9 Figure 1 shows the results of PCR detection of transgenic maize WYN041 transformant; where M: DNA molecular weight marker; 1: transgenic maize WYN041; 2: water; 3: transgenic maize Ruifeng 125; 4: transgenic maize BT11; 5: transgenic maize DBN9936; 6: transgenic maize MON810; 7: transgenic maize MON863; 8: transgenic maize WYN17132. Detailed Implementation

[0061] This invention provides a target fragment, primer set, reagent kit, and detection method for detecting insect-resistant and herbicide-tolerant maize WYN041. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0062] I. Overall Technical Solution of the Invention:

[0063] This technical solution provides a target fragment for identifying the WYN041 event in transgenic maize. It includes flanking sequences and a foreign gene segment; further, the flanking sequences include a 5' flanking sequence and a 3' flanking sequence of the WYN041 foreign insertion fragment, and may further include specific fragments of the flanking sequences.

[0064] In one embodiment, the flanking sequence includes a 5' flanking sequence of the WYN041 exogenous insert. This 5' flanking sequence is located in a maize genome region adjacent to the 5' end of the exogenous insert and can be used to determine a connection direction of the WYN041 exogenous insert.

[0065] In another embodiment, the flanking sequence includes a 3' flanking sequence of the WYN041 exogenous insert. This 3' flanking sequence is located in a maize genome region adjacent to the 3' end of the exogenous insert and can be used to determine another connection direction of the WYN041 exogenous insert.

[0066] The flanking sequences mentioned above differ from individual Cry1Ab genes, am79epsps genes, promoter sequences, terminator sequences, or selector marker sequences; their location is determined by the genomic insertion site resulting from the WYN041 exogenous insertion event. Connecting DNA fragments further formed based on these flanking sequences can span the connection sites between the maize genome sequence and the exogenous insertion fragment.

[0067] In one embodiment, the 5' flanking sequences and 3' flanking sequences are obtained by CRISPR / Cas9 targeted enrichment combined with long-read sequencing. Specifically, based on the known sequence of the WYN041 exogenous insert, sgRNAs close to the 5' and / or 3' ends are designed, and after Cas9 targeted cutting and long-read sequencing, reads containing both the exogenous insert sequence and the maize genome sequence are screened to determine the connection site between the exogenous insert and the maize genome.

[0068] After confirming the connection sites and flanking sequences at the 5' and 3' ends, respectively, a target fragment, primer set, and detection method for identifying WYN041 were developed.

[0069] In some embodiments of the present invention, the target fragment includes: a 5' flanking sequence, a linker site, and part or full length of the am79epsps gene;

[0070] In other embodiments of the present invention, the target fragment includes: a 3' flanking sequence, a linker site, and part or the full length of the Cry1Ab gene;

[0071] II. Detection or Identification Purposes

[0072] The flanking sequences, flanking sequence-specific fragments, linker DNA fragments, probes, or primer combinations provided in this technical solution can be used to identify WYN041 events. Applicable objects include, but are not limited to, WYN041 plants, leaves, roots, stems, pollen, grains, seeds, parental materials, hybrid offspring, intermediate breeding materials, processed products, and mixed samples containing WYN041 components.

[0073] In one application, genomic DNA is extracted from the sample to be tested, and a target for amplification, hybridization, sequencing, or digital PCR is designed based on the 5' flanking sequence and / or the 3' flanking sequence. When the detection results show that a specific fragment identified by the WYN041 flanking sequence exists in the sample, it can be determined that the sample contains the WYN041 event component.

[0074] In another application, the results of 5' flanking sequence detection can be combined with those of 3' flanking sequence detection. When the sample being tested simultaneously detects specific fragments identified by both the 5' and 3' flanking sequences of WYN041, the reliability of event confirmation can be further improved.

[0075] III. Beneficial Effects:

[0076] This technical solution uses the flanking sequences at the 5' and 3' ends of the WYN041 exogenous insertion fragment as the core object. These flanking sequences are determined by the insertion position of the WYN041 event and can be distinguished from ordinary exogenous target genes, universal expression elements, and individual vector sequences.

[0077] Compared to solutions focusing solely on specific detection methods, this technical solution provides flanking sequence resources for the WYN041 event. These sequence resources can be used for PCR detection, probe hybridization, sequencing confirmation, digital PCR target design, standard construction, and multi-target verification.

[0078] This technical solution differs fundamentally from existing identification methods by treating the 5' flanking sequences and 3' flanking sequences as a whole sequence resource.

[0079] This technical solution uses both 5' flanking sequences and 3' flanking sequences for confirmation, which can reduce the limitations of a single fixed amplification fragment and is applicable to the identification and traceability of WYN041 germplasm, progeny materials, seeds, plant tissues and related products.

[0080] Furthermore, in terms of obtaining flanking sequences, this approach uses CRISPR / Cas9 targeted enrichment combined with long-read sequencing to directly resolve the linker region sequence, which differs from the method of analyzing insertion sites and cloning and assembling segments based on whole-genome short-read sequencing data.

[0081] 5'-flanking sequence of WYN041: ggcgcgggataggctggagcaagagcggggcgcgagcaaggcgaccgcgagcttgagagaggaacgagcaaggagggagcggcataggactcagcgcgcagcagggatcgagctccgctgatcgcgagcgagcagagagagatgcgcagagggagacgcgcacgcgtggcatggaccaatccgaactggagctgagcaccgtcagggacctgcgtccccgacgagcagagcaggggcgcggctgcgtgctgggaaaaccaggggcgcgtggccatgggaagggaaaaggagctcggactggagatggaaagcgccggctgggaagaaaggaaggacaacggagggcgcggcggctgggaaccctggccgggcgccatggagaaaaccgagcaggggcgtcgtgacccaagcgccatgggacgagcggagagcgctggggcgagctcacgcgcagagggagaagtaacgggagggagaatccgagcacagggagatggacaggggaccgagcagagcactggggtgagttcggagggagccagaggcgcgctcacgtggcactagggtagaagacgcgaggaagatatggaagcacgccgtggctgggaggagctggggcgagcggcacgcagggaagagaagcagctgggcgaataggtgagcggcg (SEQ ID NO.1);

[0082] 3'-flanking sequence of WYN041: gcggcgggatctttttcaggcactgagcggcgggattttcctttctttgccaggagctaatcaatgcaggttcacggagaagaaaagatcaggggaaaaagagagagcggctgtgaaaaatctgagaagagagagaatagcgggagagagaggatgttttcatttccaattttgaatccccatttttagcgataaagtgagttagatcacaataatatgggtacacatttcattctctgaatttagggaaccaaattatttatattcgaagatttgaatccggtgagaaacgacaacgcgaattgaactgattttaacttcgatattgtagtcagcgttggtttacgtagaagtcagataaaaaattatctggtaaagaatagattaaattaccaaggttcgagttttagcctgatgttaacggatcaagctaaacgatatcggattcgactaggaaacgactcagtttataattctacgcctggtttttcttggattccgggtgtagtccgattttgtattaacacttttgtcgccgagttcaaataaatttagtcgggatagaaat (SEQ ID NO.2);

[0083] Specific fragment of the sequence shown in SEQ ID NO.1: tggcatggaccaatccgaactggagctgagcaccgtcagggacctgcgtccccgacgagcagagcaggggcgcggctgcgtgctgggaaaaccaggggcgcgtggccatgggaagggaaaaggagctcggactggagatggaaagcgccggctgggaagaaaggaaggacaacggagggcgcggcggctgggaaccctggccgggcgccatggagaaaaccgagcaggggcgtcgtgacccaagcgccatgggacgagcggagagcgctggggcgagctcacgcgcagagggagaagtaacgggagggagaatccgagcacagggagatggacaggggaccgagcagagcactggggtgagttcggagggagccagaggcgcgctcacgtggcactagggtagaagacgcgaggaagatatggaagcacgccgtggctgggaggagctggggcgagcggcacgcagggaagagaagcagctgggcgaataggtgagcggcg (SEQ ID NO.3);

[0084] Specific fragment of the sequence shown in SEQ ID NO.2: gcggcgggatctttttcaggcactgagcggcgggattttcctttctttgccaggagctaatcaatgcaggttcacggagaagaaaagatcaggggaaaaagagagagcggctgtgaaaaatctgagaagagagagaatagcgggagagagagagaggatgttttcatttccaattttgaatccccatttttagcgataaagtgagttagatcacaataatatg ggtacacatttcattctctgaatttagggaaccaaattatttatattcgaagatttgaatccggtgagaaacgacaacgcgaattgaactgattttaacttcgatattgtagtcagc gttggtttacgtagaagtcagataaaaaattatctggtaaagaatagattaaattaccaaggttcgagttttagcctgatgttaacggatcaagctaaacgatatcggattcg (seq ID NO.4);

[0085] The 5' flanking sequence of WYN041 and the DNA fragment containing the boundary junction site (including Figure 1 In ubiquitinpromoter, sp, am79epsps, nos terminator): ggcgcgggataggctggagcaagagcggggcgcgagca aggcgaccgcgagcttgagagaggaacgagcaaggagggagcggcataggactcagcgcgcagcagggatcgagct ccgctgatcgcgagcgagcagagagagatgcgcagagggagacgcgcacgcgtggcatggaccaatccgaactgga gctgagcaccgtcagggacctgcgtccccgacgagcagagcaggggcgcggctgcgtgctgggaaaaccaggggcg cgtggccatgggaagggaaaaggagctcggactggagatggaaagcgccggctgggaagaaaggaaggacaacgga gggcgcggcggctgggaaccctggccgggcgccatggagaaaaccgagcaggggcgtcgtgacccaagcgccatgg gacgagcggagagcgctggggcgagctcacgcgcagagggagaagtaacgggagggagaatccgagcacagggaga tggacaggggaccgagcagagcactggggtgagttcggagggagccagaggcgcgctcacgtggcactagggtaga agacgcgaggaagatatggaagcacgccgtggctgggaggagctggggcgagcggcacgcagggaagagaagcagc tgggcgaataggtgagcggcg

[0086] In the sequence shown in SEQ ID NO.5, the underlined part is the 5' flanking sequence shown in SEQ ID NO.1, and the remaining part includes the 10 bp rearranged sequence in the 5' connection region of the WYN041 event and the am79epsps expression cassette related sequence in the exogenous inserted fragment shown in SEQ ID NO.10.

[0087] The 3' flanking sequence of WYN041 and the DNA fragment containing the boundary junction site (including Figure 1gcggcgggatctttttcaggcactgagcggcgggattttcctttcttt gccaggagctaatcaatgcaggttcacggagaagaaaagatcaggggaaaaagagagagcggctgtgaaaaatctg agaagagagagaatagcgggagagagaggatgttttcatttccaattttgaatccccatttttagcgataaagtga gttagatcacaataatatgggtacacatttcattctctgaatttagggaaccaaattatttatattcgaagatttg aatccggtgagaaacgacaacgcgaattgaactgattttaacttcgatattgtagtcagcgttggtttacgtagaa gtcagataaaaaattatctggtaaagaatagattaaattaccaaggttcgagttttagcctgatgttaacggatca agctaaacgatatcggattcgactaggaaacgactcagtttataattctacgcctggtttttcttggattccgggt gtagtccgattttgtattaacacttttgtcgccgagttcaaataaatttagtcgggatagaaat (SEQ ID NO. 6);

[0088] The underlined portion of the sequence shown in SEQ ID NO.6 is the sequence shown in SEQ ID NO.2, i.e., the 3' flanking sequence, and the remaining portion is the truncated Cry1Ab gene expression cassette fragment in the exogenous insertion sequence shown in SEQ ID NO.10.

[0089] Specific fragment 1 containing the linkage site: tggcatggaccaatccgaactggagctgagcaccgtcagggacctgcgtccccgacgagcagagcaggggcgcggctgcgtgctgggaaaaccaggggcgcgtggccatgggaagggaaaaggagctcggactggagatggaaagcgccggctgggaagaaaggaaggacaacggagggcgcggcggctgggaaccctggccgggcgccatggagaaaaccgagcaggggcgtcgtgacccaagcgccatgggacgagcggagagcgctggggcgagctcacgcgcagagggagaagtaacgggagggagaatccgagcacagggagatggacaggggaccgagcagagcactggggtgagttcggagggagccagaggcgcgctcacgtggcactagggtagaagacgcgaggaagatatggaagcacgccgtggctgggaggagctggggcgagcggcacgcagggaagagaagcagctgggcgaataggtgagcggcgggatttatcctagtttaattcccgatctagtaacatagatgacaccgcgcgcgataatttatcctagtttgcgcgctatattttgttttctatcgcgtattaaatgtataattgcgggactctaatcataaaaacccatctcataaataacgtcatgcattacatgttaattattacatgcttaacgtaattcaacagaaattatatgataatcatcgcaagaccggcaacaggattcaatcttaagaaactttattgccaaatgtttgaacgatcggggaaattcgagctggtcaccgagctctcactagttgtactccacgtggatgccgaacttctgcagctcctcgaagtaggccgggcaggtcttggacacgcagcccgggtccacgatcctgatgtgcggcaccttca (SEQ ID NO.7);

[0090] SEQ ID NO.7 is a specific fragment of the DNA fragment in the 5' linker region shown in SEQ ID NO.5, containing a 10 bp rearranged sequence in the 5' linker region of the WYN041 event.

[0091] Specific fragment 2 containing the connection site: (SEQ ID NO. 8);

[0092] SEQ ID NO.8 is a specific fragment of the DNA fragment in the 5' linker region shown in SEQ ID NO.5, containing a 10 bp rearranged sequence in the 5' linker region of the WYN041 event.

[0093] A specific fragment of the DNA fragment at the 3' end junction region shown in SEQ ID NO. 6: (SEQ ID NO. 9);

[0094] SEQ ID NO.9 is a specific fragment of the DNA fragment in the 3' end junction region shown in SEQ ID NO.6.

[0095] Exogenous inserted fragment sequences (including) Figure 1

[0096] The 5' integration site was used to identify upstream primer-1: tggcatggaccaatccgaactgga (SEQ ID NO.11);

[0097] The upstream primer for identifying the integration site 3' is: tcgatcgacaagctcgagtttctcc (SEQ ID NO.12);

[0098] The 5' end of the integration site was used to identify the downstream primer-1: tgaaggtgccgcacatcaggat (SEQ ID NO.13);

[0099] The downstream primer for identifying the integration site 3' is: cgaatccgatatcgtttagcttgatccg (SEQ ID NO.14).

[0100] The 5' end of the integration site was used to identify the upstream primer-2: tgggaagaaaggaaggacaacgga (SEQ ID NO.15);

[0101] The 5' end of the integration site was used to identify the downstream primer-2: gctcgaatttccccgatcgttcaa (SEQ ID NO.16);

[0102] The test materials used in this invention are all common commercially available products. The invention is further illustrated below with reference to embodiments:

[0103] Example 1: Construction of insect-resistant and herbicide-tolerant maize variety WYN041

[0104] 1. Construction of the transformation vector Cry1Ab-am79-pC3301

[0105] The Gus and Bar gene expression cassettes in the T-DNA region of the pCambia3301 vector were removed and replaced with an expression cassette consisting of the ubiquitin promoter-signal peptide SP-am79 gene-Nos terminator-CaMV35S promoter-adh1 enhancer-truncated Cry1Ab-gene-PolyA tail, constructing the plant expression vector Cry1Ab-am79-pC3301, with a T-DNA region size of approximately 7.5 kb. The vector map is shown below. Figure 1 As shown.

[0106] 2. Obtaining transgenic plants by transforming maize embryos with Agrobacterium tumefaciens.

[0107] The Cry1Ab-am79-pC3301 plasmid was transformed into Agrobacterium EHA105 by electroporation and identified for later use. Immature embryos of maize inbred line 4125-2, 12-14 days after self-pollination, were soaked in 70% ethanol for 20 minutes, removed on a clean bench, infected with Agrobacterium solution, transferred to co-culture medium and cultured in the dark at 23°C for 3 days, then transferred to recovery medium and cultured in the dark at 28°C for 7 days. Callus tissue was then screened on selective medium containing 1 mM glyphosate herbicide under the condition of dark culture at 28°C. After the emergence of tolerant callus, well-formed embryogenic callus was selected and transferred to differentiation medium. Differentiation culture conditions were 28°C, light intensity 2000-2300 lx, and 14-18 h light per day until seedlings appeared. Seedling vigor was maintained under the same conditions as differentiation culture. The regenerated seedlings were transferred to a rooting medium. After the seedlings developed secondary roots, they were transplanted into small pots containing a mixture of nutrient soil and vermiculite (1:3). At the same time, leaf samples were taken to extract DNA, and positive plants were identified by PCR testing. These positive plants were then transplanted into larger pots.

[0108] 3. Screening of candidate transformation events and analysis of side sequences

[0109] After obtaining transgenic positive plants, 500 transformation events were observed in the field. Based on agronomic performance such as plant growth, plant type, fruit set, uniformity of growth and genetic stability, preliminary screening was conducted to obtain several candidate transformation events with good overall performance.

[0110] Further flanking sequence analysis of the exogenous insert fragments was performed on the aforementioned candidate transformation events. Specifically, high molecular weight genomic DNA was extracted from the candidate transformation events, and sgRNAs were designed near the 5' and / or 3' ends based on the known sequence of the exogenous insert fragment. The high molecular weight genomic DNA was targeted and cleaved using the Cas9-sgRNA complex, and long-read sequencing adapters were ligated to the ends of the new DNA generated by Cas9 cleavage before sequencing. By screening for long reads that simultaneously contain the exogenous insert fragment sequence and the maize genome sequence, the connection site between the exogenous insert fragment and the maize genome was analyzed to obtain the flanking sequences of the exogenous insert fragments of the candidate transformation events.

[0111] Insertion structure and copy number analysis identified single-copy insertion candidate transformation events. Further comparisons based on field growth, genetic stability, glyphosate tolerance, and bollworm resistance showed that event WYN041 exhibited the best overall performance among the tested candidate transformation events. Figure 2 ).

[0112] The original number of this genetically modified maize is "Insect-resistant and herbicide-tolerant maize with Cry1Ab and am79epsps genes WYN041", the accession number is CGMCC No.47181, and the accession date is June 4, 2026.

[0113] 4. PCR identification of transgenic plants

[0114] 4.1 Extraction of total plant DNA: Total DNA was rapidly extracted from leaves of transgenic maize WYN041 and non-transgenic maize SX1395 using a magnetic bead method. The specific steps are as follows:

[0115] (1) Grind thoroughly with liquid nitrogen. Take 100 mg of liquid nitrogen to grind the sample into a centrifuge tube, add 500 μL of BG DNA Extraction Lysis Buffer, quickly invert and mix, and let stand at room temperature for 10 min.

[0116] (2) Centrifuge at 13,000 rpm for 5 min at room temperature (if the sample is rich in pigment, a clump of non-precipitable flocculent material will form in the supernatant. The pigment will be removed during the subsequent washing and will not affect the subsequent experiments).

[0117] (3) Transfer the supernatant to a new 2mL centrifuge tube, being careful not to aspirate the precipitate. Add an equal volume of BGMG ForDNA (shake vigorously before use to disperse the magnetic beads evenly) (make sure anhydrous ethanol has been added before use). Vigorously shake for several tens of times or vortex for 10 seconds (vigorously disperse the nano magnetic beads, otherwise the purity will be affected). Let stand at room temperature for 30 seconds.

[0118] (4) Place the centrifuge tube containing the mixture in a magnetic rack or other form of magnetic field and let it stand for 10 seconds until the magnetic beads are completely enriched.

[0119] (5) Pour out the supernatant in the magnetic field;

[0120] (6) Add 500 μL of DNA WB1 (make sure anhydrous ethanol has been added before use), remove from the magnetic field, and shake vigorously for several tens of times or vortex for 10 seconds (vigorously disperse the magnetic nanobeads, otherwise the purity will be affected);

[0121] (7) Place the centrifuge tubes back into the magnetic rack or other form of magnetic field and let them stand for 10 seconds;

[0122] (8) Pour out the supernatant in the magnetic field;

[0123] (9) Add 500 μL of 75% ethanol, remove from the magnetic field, and shake violently for 10 times or vortex for 10 seconds;

[0124] (10) Add 500 μL of 75% ethanol again, remove from the magnetic field, and shake violently for 10 times or vortex for 10 seconds;

[0125] (11) Place the centrifuge tubes back into the magnetic rack or other form of magnetic field and let them stand for 10 seconds;

[0126] (12) Pour out the supernatant in the magnetic field;

[0127] (13) Remove residual ethanol;

[0128] (14) Add 50 μL~100 μL of water, vortex to mix well or tap the bottom of the tube with your finger to completely resuspend the magnetic bead;

[0129] (15) Place the centrifuge tube back on the magnetic rack and draw up the clear solution, which is the DNA solution.

[0130] 4.2 Identification Primer Design

[0131] Based on the truncated Cry1Ab gene sequence information, the following amplification primers were designed:

[0132] Upstream primer: 5'-tctggggtatctttggtccatctca-3' (SEQ ID NO.17);

[0133] Downstream primer: 5'-taccctgattgataggccttccgt-3' (SEQ ID NO.18);

[0134] The amplified fragment is 1458 bp in length.

[0135] Based on the am79epsps gene sequence information, the following amplification primers were designed:

[0136] Upstream primer: 5'-ttgatcacctcgatggacacggcct-3' (SEQ ID NO.19);

[0137] Downstream primer: 5'-acgccgacctccaacaagatcaa-3' (SEQ ID NO.20);

[0138] The amplified fragment is 560 bp in length.

[0139] 4.3 PCR amplification system and reaction procedure

[0140] PCR reaction system: ddH2O 7.5 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, 2×Phanta Flash Master Mix (Dye Plus) 10 μL, total maize DNA 0.5 μL, total 20 μL;

[0141] PCR reaction procedure: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 60℃ annealing for 5 seconds, 72℃ extension for 15 seconds, 32 cycles; 72℃ extension for 1 minute; 4℃ incubation.

[0142] PCR reactions were performed using the above system and procedure to obtain transgenic positive plants, and the results are as follows: Figure 3 As shown; where A: Cry1Ab gene; B: am79epsps gene; M: DNA molecular weight marker; 1: water; 2: non-transgenic maize SX1395; 3: plasmid Cry1Ab-am79-pC3301; 4~12, different generations of transgenic maize WYN041. Figure 3 It can be seen that the Cry1Ab and am79epsps genes are integrated into the genome of transgenic maize WYN041.

[0143] Example 2: Identification of corn borer resistance in transgenic maize WYN041

[0144] (1) Resistance level of transgenic maize WYN041 to corn borer in indoor environment

[0145] Twenty transgenic maize plants (WYN041) planted in the field were randomly selected. During the whorl stage (V6-V8), unopened tender whorl leaves were collected; during the silking stage, newly silked but unpollinated tender silks were collected; and during the grain-filling stage (15-20 days after pollination), tender kernels were collected. Appropriate leaves, whole silks, or whole kernels from each maize plant were placed in suitable insect rearing containers, with one container per maize plant and five insects per container, for a total of 20 maize plants. The experiment was conducted in a culture room with a relative humidity of 70%–80%, a temperature of 26℃–28℃, and a photoperiod of 16h:8h (L:D). Five days after inoculation, larval mortality was assessed (larval death was defined as no reaction or significant growth inhibition when lightly touched with a small brush). The number of surviving larvae was recorded. During this period, fresh tissue from the same source was promptly replaced according to the freshness of the maize tissue. The experiment was repeated three times under the same conditions. Parallel experiments were conducted using corresponding non-GMO maize varieties (lines) and susceptible maize varieties (lines) as controls. The results are shown in Table 1 and... Figure 4 As shown.

[0146] Table 1. Results of Indoor Resistance Identification for Corn Borer

[0147]

[0148] Note: Data in the table are mean ± standard deviation. Different lowercase letters after the data in the same column indicate significant differences between different treatments (P<0.05). The same applies below.

[0149] According to Table 1 and Figure 4 The results of the survey 5 days after inoculation at the whorl stage showed that the survival rate of corn borer larvae fed with the whorl of susceptible corn variety 31 was 89.00%, the survival rate of corn borer larvae fed with the whorl of the non-transgenic control group was 71.33%, while the survival rate of larvae fed with the whorl of transgenic corn variety WYN041 was only 1.00%. The survival rate of corn borer larvae fed with the whorl of transgenic corn variety WYN041 was significantly lower than that of the non-transgenic control group, and the difference was statistically significant.

[0150] From Table 1 and Figure 4 Five days after inoculation during the silking stage, the survival rate of corn borer larvae fed with silks of the susceptible corn variety WYN041 was 75.33%, compared to 93.00% for those fed with silks from the non-GMO control group. However, the survival rate of larvae fed with silks from the GMO corn variety WYN041 was only 3.00%. The survival rate of corn borer larvae fed with silks from the GMO corn variety WYN041 was significantly lower than that fed with the non-GMO control group, and the difference was statistically significant.

[0151] From Table 1 and Figure 4 The results of a survey conducted 5 days after inoculation during the grain stage showed that the survival rate of corn borer larvae fed with infected corn kernels (such as the variety WYN041) was 91.67%, compared to 82.33% for the non-GMO control group and 0% for the genetically modified (GM) corn kernels (such as WYN041). The survival rate of corn borer larvae fed with GM corn kernels (WYN041) was significantly lower than that of the non-GM control group, and the difference was statistically significant.

[0152] Example 3: Obtaining the DNA fragment at the ligation site of the exogenous insertion fragment in transgenic maize WYN041 and verifying its paired-end specificity.

[0153] According to the flanking sequence analysis method described in Example 1, the connection site between the exogenous insertion fragment WYN041 and the maize genome was determined, and the 5' flanking sequence (SEQ ID NO.1), the 3' flanking sequence (SEQ ID NO.2), and the DNA fragment containing the boundary connection site (SEQ ID NO.5 and SEQ ID NO.6) of WYN041 were obtained.

[0154] 1. Specific PCR verification of DNA fragments in the 5' end junction region

[0155] Using the 5' flanking sequence of the exogenous insert fragment WYN041 from transgenic maize and the am79epsps gene sequence within the exogenous fragment, a pair of primers was designed targeting the 5' junction region of the WYN041 event to establish a PCR identification method for the 5' flanking sequence of the WYN041 event. The upstream primer designed for the 5' end of the maize genome at the integration site is shown in SEQ ID No. 11; the downstream primer designed based on the am79epsps gene expression cassette sequence is shown in SEQ ID No. 13.

[0156] Maize genomic DNA was extracted according to step 4.1 of Example 1. The extracted maize genomic DNA was used as a template for PCR amplification using the upstream and downstream primers described above.

[0157] PCR reaction system: ddH2O 7.5 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, 2×Phanta Flash Master Mix (Dye Plus) 10 μL, total maize DNA 0.5 μL, total 20 μL;

[0158] PCR reaction procedure: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 60℃ annealing for 5 seconds, 72℃ extension for 15 seconds, 32 cycles; 72℃ extension for 1 minute; 4℃ incubation.

[0159] The PCR products were detected by agarose gel electrophoresis, and the results are as follows: Figure 6 As shown; where M: DNA molecular weight marker; 1: plasmid Cry1Ab-am79-pC3301; 2: non-transgenic maize SX1395; 3: water; 4-6: T2 generation transgenic maize WYN041 plants; 7-9: T3 generation transgenic maize WYN041 plants; 10-12: T4 generation WYN041 plants. According to... Figure 6 As can be seen, when performing PCR amplification using the upstream and downstream primers provided in this invention, no amplification bands were observed in water, non-transgenic maize SX1395, or plasmid Cry1Ab-am79-pC3301. Only the DNA sample from transgenic maize WYN041 amplified a specific 915 bp target band, the specific sequence of which is shown in SEQ ID No. 7 (obtained by amplification using primers shown in SEQ ID No. 11 and SEQ ID No. 13). Based on this result, three replicate experiments were conducted, and the results were consistent.

[0160] Specific PCR verification of DNA fragments in the 2' and 3' end junction regions

[0161] A PCR identification method for the 3' flanking sequence of the WYN041 transgenic maize WYN041 event was established by designing a pair of primers for the 3' flanking sequence of the exogenous insertion fragment and the truncated Cry1Ab gene sequence in the exogenous fragment. The upstream primer designed based on the truncated Cry1Ab gene expression cassette sequence is shown in SEQ ID No. 12, and the downstream primer designed based on the 3' end of the maize genome of the integration site in the exogenous fragment is shown in SEQ ID No. 14.

[0162] Maize genomic DNA was extracted according to step 4.1 of Example 1. The extracted maize genomic DNA was used as a template for PCR amplification using the upstream and downstream primers described above.

[0163] PCR reaction system: ddH2O 7.5μL, upstream primer (10μM) 1μL, downstream primer (10 μM) 1μL, 2×Phanta Flash Master Mix (Dye Plus) 10 μL, total maize DNA 0.5 μL, total 20 μL;

[0164] PCR reaction procedure: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 60℃ annealing for 5 seconds, 72℃ extension for 15 seconds, 32 cycles; 72℃ extension for 1 minute; 4℃ incubation.

[0165] The PCR products were detected by agarose gel electrophoresis, and the results are as follows: Figure 7 As shown; where M: DNA molecular weight marker; 1: plasmid Cry1Ab-am79-pC3301; 2: non-transgenic maize SX1395; 3: water; 4-6: T2 generation transgenic maize WYN041 plants; 7-9: T3 generation transgenic maize WYN041 plants; 10-12: T4 generation WYN041 plants. According to... Figure 7 As can be seen, when performing PCR amplification using the upstream and downstream primers provided by this invention, no amplification band was observed in water, non-transgenic plants, or plasmid Cry1Ab-am79-pC3301. Only the DNA amplification sequence of transgenic maize WYN041 showed a specific 709 bp target band, the specific sequence of which is shown in SEQ ID No. 9 (obtained by amplification using primers shown in SEQ ID No. 12 and SEQ ID No. 14). Based on this result, three replicate experiments were conducted, and the results were consistent.

[0166] Example 4: Application and Extension of Flanking Sequences of Exogenous Inserts in Transgenic Maize WYN041

[0167] 1. Development of new primers and target regions for identifying transgenic maize WYN041

[0168] Using the 5' flanking sequence of the exogenous insertion fragment of transgenic maize WYN041 and the am79epsps gene expression cassette sequence in the exogenous fragment, a separate pair of primers was designed to perform PCR identification of the 5' flanking sequence of the WYN041 event. The upstream primer designed for the 5' end of the maize genome in one of the exogenous fragment integration sites is shown in SEQ ID No. 15; the downstream primer designed based on the am79epsps gene expression cassette sequence is shown in SEQ ID No. 16.

[0169] Genomic DNA of maize was extracted according to step 4.1 of Example 1. The extracted genomic DNA of transgenic maize WYN041 and non-transgenic maize SX1395 was used as a template, and PCR amplification was performed using the above-mentioned upstream and downstream primers.

[0170] PCR reaction system: ddH2O 7.5 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, 2×Phanta Flash Master Mix (Dye Plus) 10 μL, total maize DNA 0.5 μL, total 20 μL;

[0171] PCR reaction procedure: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 60℃ annealing for 5 seconds, 72℃ extension for 15 seconds, 30 cycles; 72℃ extension for 1 minute; 4℃ incubation.

[0172] The PCR products were detected by agarose gel electrophoresis, and the results are as follows: Figure 8 As shown; where M: DNA molecular weight marker; 1: plasmid Cry1Ab-am79-pC3301; 2: non-transgenic maize SX1395; 3: water; 4-6: T2 generation transgenic maize WYN041 plants; 7-9: T3 generation transgenic maize WYN041 plants; 10-12: T4 generation WYN041 plants. According to... Figure 8 As can be seen, when performing PCR amplification using the upstream and downstream primers provided by this invention, no amplification bands were observed in water, non-transgenic plants, or plasmid Cry1Ab-am79-pC3301. Only the DNA amplification sequence of transgenic maize WYN041 showed a specific 639 bp target band, the specific sequence of which is shown in SEQ ID No. 8 (obtained by amplification using primers shown in SEQ ID No. 15 and SEQ ID No. 16). Based on this result, three replicate experiments were conducted, and the results were consistent.

[0173] 2. Specificity identification of transgenic maize WYN041

[0174] Using the primer sets SEQ ID No. 15 and SEQ ID No. 16, maize genomic DNA was extracted according to step 4.1 of Example 1. The extracted genomic DNA of transgenic maize varieties WYN041, Ruifeng 125, WYN17132, BT11, DBN9936, MON863, and MON810 was used as templates, and PCR amplification was performed using the aforementioned upstream and downstream primers.

[0175] PCR reaction system: ddH2O 7.5 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, 2×Phanta Flash Master Mix (Dye Plus) 10 μL, total maize DNA 0.5 μL, total 20 μL;

[0176] PCR reaction procedure: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 60℃ annealing for 5 seconds, 72℃ extension for 15 seconds, 30 cycles; 72℃ extension for 1 minute; 4℃ incubation.

[0177] The PCR products were detected by agarose gel electrophoresis, and the results are as follows: Figure 9 As shown; where M: DNA molecular weight marker; 1: transgenic maize WYN041; 2: water; 3: transgenic maize Ruifeng 125; 4: transgenic maize BT11; 5: transgenic maize DBN9936; 6: transgenic maize MON810; 7: transgenic maize MON863; 8: transgenic maize WYN17132.

[0178] according to Figure 9 As can be seen, when using the upstream and downstream primers provided by this invention for PCR amplification, no amplification bands were observed in water or other transgenic plants. Only the DNA amplification sequence of transgenic maize WYN041 showed a specific 639 bp target band, as shown in SEQ ID No. 8.

[0179] As can be seen from the above, the technical solution provided by this invention can specifically detect genetically modified maize WYN041 and its related materials, and can better supervise and manage genetically modified maize.

[0180] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Flanking sequence for the exogenous insert of transgenic maize WYN041, characterized in that, Including 5' flanking sequences and 3' flanking sequences; The 5' flanking sequence includes a nucleotide sequence as shown in SEQ ID NO.1 or a specific fragment of a nucleotide sequence as shown in SEQ ID NO.1; The 3' flanking sequence is the sequence shown in SEQ ID NO.2 or a specific fragment of the sequence shown in SEQ ID NO.2; The genetically modified maize WYN041 has the accession number CGMCC No.47181.

2. The flanking sequence according to claim 1, characterized in that, The nucleotide sequence of a specific fragment of the nucleotide sequence shown in SEQ ID NO.1 is shown in SEQ ID NO.3; The nucleotide sequence of a specific fragment of the nucleotide sequence shown in SEQ ID NO.2 is shown in SEQ ID NO.

4.

3. The target fragment formed by the flanking sequences according to claim 1 or 2, characterized in that, The target fragment includes target fragment 1 and / or target fragment 2; target fragment 1 includes a nucleotide sequence as shown in SEQ ID NO. 5 or a specific fragment of a nucleotide sequence as shown in SEQ ID NO. 5; target fragment 2 includes a nucleotide sequence as shown in SEQ ID NO. 6 or a specific fragment of a nucleotide sequence as shown in SEQ ID NO.

6.

4. The target fragment according to claim 3, characterized in that, The nucleotide sequence of a specific fragment of the nucleotide sequence shown in SEQ ID NO. 5 is shown in SEQ ID NO. 7 or SEQ ID NO. 8; The nucleotide sequence of a specific fragment of the nucleotide sequence shown in SEQ ID NO. 6 is shown in SEQ ID NO.

9.

5. A primer set for identifying transgenic maize WYN041, characterized in that, The target fragment described in claim 3 or 4 is used as the detection target.

6. The primer set of claim 5, wherein, include: Primer set 1, consisting of the upstream primer with nucleotide sequences as shown in SEQ ID NO. 11 and the downstream primer as shown in SEQ ID NO. 13; and / or Primer set 2, consisting of the upstream primer with nucleotide sequences as shown in SEQ ID NO. 15 and the downstream primer as shown in SEQ ID NO. 16; and / or Primer set 3 consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.12 and a downstream primer as shown in SEQ ID NO.

14.

7. A kit for identifying transgenic maize WYN041, characterized in that, Includes the primer set and detection reagent as described in claim 5 or 6.

8. The reagent kit according to claim 7, characterized in that, The detection reagents include: PCR amplification reagents and / or PCR product detection reagents.

9. The application of at least one of the following (A) to (D) in the detection of transgenic maize WYN041 or related materials, or in the breeding of superior transgenic maize varieties WYN041: A) The side sequence as described in claim 1 or 2; B) The target fragment as described in claim 3 or 4; C) The primer set as described in claim 5 or 6; D) The kit according to claim 7; The genetically modified maize WYN041 has the accession number CGMCC No. 47181; The materials related to the transgenic maize WYN041 include the parents or hybrid offspring of the transgenic maize WYN041; The objects of the test include: plants, tissues, seeds, transgenic maize WYN041 products and / or transgenic maize WYN041 related materials.

10. The method for detecting transgenic maize WYN041 or related materials, or for breeding superior varieties of transgenic maize WYN041, wherein at least one of the following methods (a) to (d) is used to detect the sample: a) The side sequence as described in claim 1 or 2; b) The target fragment as described in claim 3 or 4; c) The primer set as described in claim 5 or 6; d) The kit according to claim 7.

11. A method for planting insect-resistant and herbicide-tolerant corn, characterized in that, This includes planting corn seeds; The genome of the maize seed contains the target fragment as described in claim 3 or 4; The corn seeds mentioned are those of the genetically modified corn variety WYN041; The genetically modified maize WYN041 has the accession number CGMCC No.47181.

Images