KASP primer set for assisting wheat grain weight trait identification and breeding and application thereof

Abstract

This invention discloses a KASP primer set for assisting in the identification and breeding of wheat grain weight traits and its application. The KASP primer set is used to detect grain weight QTL loci located on wheat chromosome 3A. QTgw_3A The primer set includes the forward primer KASP-3A_514493982-1 (nucleotide sequence shown in SEQ ID NO.3), the forward primer KASP-3A_514493982-2 (nucleotide sequence shown in SEQ ID NO.4), and the reverse universal primer KASP-3A_514493982-3 (nucleotide sequence shown in SEQ ID NO.5). This KASP primer set provides a high-throughput, low-cost, highly operable, and accurate molecular marker for screening high-grain-weight wheat. It can efficiently screen for superior genotypes in early generations or at the seedling stage before grain formation, greatly meeting the demand for efficient detection of large-scale genetic lines in breeding practice, improving the efficiency of high-yield genetic improvement of wheat, and also assisting in the aggregation of superior thousand-grain-weight loci with other excellent traits, accelerating the breeding of new wheat varieties with outstanding yield and excellent comprehensive traits.

Description

Technical Field

[0001] This invention relates to wheat genetics and breeding, specifically to a KASP primer set for assisting in the identification and breeding of wheat grain weight traits and its application. Background Technology

[0002] As one of the world's three major food crops, wheat ( Triticum aestivum L. provides approximately 20% of the world's protein and energy, playing a vital role in ensuring food security.

[0003] Wheat yield is mainly composed of three factors: number of spikes per unit area, number of grains per spike, and grain weight. An increase in the number of grains per spike is often accompanied by a decrease in the number of spikes per unit area, while grain weight, usually expressed as thousand-grain weight, is relatively independent of other yield components and is significantly influenced by genetic factors. Studies have shown that grain weight is subject to varying degrees of positive selection in different wheat ecological regions and is significantly correlated with yield improvement, making it one of the most prominent traits contributing to the genetic improvement of wheat yield. Therefore, improving grain weight has always been an important focus for breeders in the breeding of new wheat varieties. Common wheat is an allohexaploid containing three subgenomes (A, B, and D). Its genome is large and complex, and the accurate identification and breeding transformation of QTLs / genes related to complex quantitative traits such as grain weight remain insufficient. Therefore, relying on high-quality genetic maps to deeply explore grain weight-related QTLs, especially superior loci derived from core parents with breeding potential, and developing accurate, efficient, and high-throughput molecular markers, is of great significance for accelerating the molecular breeding process of wheat yield traits.

[0004] Molecular marker-assisted selection (MAS) is an important method combining modern molecular biology techniques with crop breeding. It enables early selection of target traits at the genotype level, and is particularly suitable for improving traits that are difficult to identify phenotypes, susceptible to environmental influences, or have long identification cycles. KASP (Kompetitive Allele-Specific PCR) is a widely used SNP / InDel genotyping technique. Based on conventional PCR amplification and fluorescence signal detection, this technique achieves biallelic genotyping through allele-specific primer 3′ base matching. It has advantages such as simple operation, low cost, short cycle, high accuracy, and high throughput, making it suitable for rapid screening of large-scale breeding materials. It provides an efficient tool for molecular marker-assisted selection and molecular design breeding in crops (Kaur B, et al. (2020) Utilization of KASP technology for wheatimprovement. Cereal Res Commun, 48:409-421).

[0005] Therefore, in-depth exploration of QTLs related to wheat grain weight and the development of KASP molecular markers suitable for high-throughput identification of superior genotypes can provide important genetic resources and efficient detection tools for the breeding of high-yield wheat varieties. This is of great significance for accelerating the process of high-yield molecular breeding of wheat, improving yield per unit area, and ensuring national food security. Summary of the Invention

[0006] To address the shortcomings in the accurate identification and breeding transformation of grain weight QTLs / genes, this invention provides a KASP primer set and its application to assist in the identification and breeding of wheat grain weight traits. This KASP primer set is based on newly discovered QTL sites controlling wheat grain weight. QTgw_3A Design, QTL sites QTgw_3A It can significantly increase wheat grain weight, and the corresponding KASP marker can easily and accurately achieve high-throughput identification and assisted selection of superior genotype materials, which has high application value for high-yield molecular breeding of wheat.

[0007] To achieve the above objectives, the present invention provides a KASP primer set related to wheat grain weight, which is based on wheat grain weight QTL loci. QTgw_3A Developed QTgw_3AOn wheat chromosome 3A, the physical location on the control Chinese spring reference genome IWGSC RefSeq v1.0 is between 514.49 Mb and 528.52 Mb, with the SNP molecular markers flanking it being 3A_514493982 and 3A_528521672, respectively. The KASP primer set includes the forward primer KASP-3A_514493982-1 (nucleotide sequence as shown in SEQ ID NO.3), the forward primer KASP-3A_514493982-2 (nucleotide sequence as shown in SEQ ID NO.4), and the reverse universal primer KASP-3A_514493982-3 (nucleotide sequence as shown in SEQ ID NO.5).

[0008] The KASP primer set consists of two forward primers, KASP-3A_514493982-1 and KASP-3A_514493982-2, each with a different fluorescent tag attached to its 5' end. Specifically, KASP-3A_514493982-1 has a FAM fluorescent probe tag (SEQ ID NO.1) attached to its 5' end; and KASP-3A_514493982-2 has a HEX fluorescent probe tag (SEQ ID NO.2) attached to its 5' end. The second aspect of this invention provides the application of the above-described KASP primer set in any of the following: (1) Detection of wheat grain weight QTL loci QTgw_3A genotype; (2) Positioning QTgw_3A Related functional genes; (3) Detect the weight of wheat grains; (4) Select and create high grain weight wheat varieties.

[0009] A third aspect of the present invention provides a method for detecting the weight of wheat grains, comprising the following steps: (1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the above-mentioned KASP primer set to obtain the amplification product; (2) Perform fluorescence signal scanning and genotype clustering analysis on the amplification products to determine the properties of the test material. QTgw_3A Genotype at the locus; (3) Determine the weight of a thousand grains of wheat based on the genotype test results.

[0010] Specifically, in step (1), the PCR amplification system includes: 2.5 μL of wheat DNA template to be tested at a concentration of 120 ng / μL, 5 μL of 2×KASP Master Mix, 0.14 μL of KASP Assay Mix, and 2.36 μL of ddH2O; The preparation method for each 100 μL KASP Assay Mix is ​​as follows: 12 μL of 100 μM forward primer KASP-3A_514493982-1, 12 μL of 100 μM forward primer KASP-3A_514493982-2, 30 μL of 100 μM reverse universal primer KASP-3A_514493982-3, and 46 μL of ddH2O; The PCR amplification program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61–55℃ for 60 s, 10 touch cycles. Down cycling, decreasing the temperature by 0.6℃ per cycle; denaturation at 94℃ for 20 s, annealing at 55℃ for 60 s, for 28 cycles; final holding at 30℃, and collection and analysis of fluorescence signals.

[0011] Specifically, in step (2), it is determined that the material to be tested... QTgw_3A The method for determining the genotype of a locus is as follows: if a sample is close to the Y-axis and shows a blue fluorescent signal in the genotyping clustering diagram, it is recorded as the TT genotype (Ningmai 9 genotype); if a sample is close to the X-axis and shows a red fluorescent signal in the genotyping clustering diagram, it is recorded as the CC genotype (Yangmai 158 genotype).

[0012] Specifically, in step (3), the method for judging the weight of a thousand grains of wheat is: the weight of a thousand grains of wheat material carrying the CC genotype is higher than that of wheat material carrying the TT genotype.

[0013] The wheat varieties to be tested were preferably from the wheat-growing region of the middle and lower reaches of the Yangtze River (for the definition of this wheat-growing region, please refer to Cheng Shunhe et al. (2012) (Cheng Shunhe, Guo Wenshan, Wang Longjun et al. (2012) Wheat in Southern China. Jiangsu Science and Technology Press)).

[0014] Through the above technical solution, the present invention achieves the following beneficial effects: 1. Based on the genetic populations created from Yangmai 158 and Ningmai 9, this invention identifies a new wheat grain weight-related QTL locus. QTgw_3A This locus can significantly increase wheat grain weight, providing not only a new functional locus and gene resource for high-yield wheat breeding, but also enabling breeding transformation and utilization through molecular marker-assisted selection, thereby promoting molecular improvement of grain weight traits and possessing high potential breeding application value.

[0015] 2. This invention is aimed at QTgw_3A A KASP molecular marker was developed for this locus, enabling precise detection of superior allelic variations at that site. This marker offers advantages such as stable amplification, accurate genotyping, and ease of operation, making it suitable for high-throughput screening of superior genotypes in large-scale wheat breeding.

[0016] 3. The molecular marker primer combination provided by this invention can promote particle weight QTL. QTgw_3A Its application in high-yield wheat breeding enables early identification and assisted selection of superior genotypes, improves the targeting and accuracy of breeding selection, and enhances breeding efficiency. At the same time, it can also assist in the aggregation of superior thousand-grain heavy loci with other excellent traits, and accelerate the breeding process of new high-yield wheat varieties with excellent comprehensive traits. Attached Figure Description

[0017] Figure 1 QTL sites for controlling wheat grain weight QTgw_3A A schematic diagram of genetic mapping; where a is... QTgw_3A At its location on the chromosome, b is... QTgw_3A The results of chain positioning; Figure 2 The test results of the KASP molecular marker provided by this invention are shown in the figure. The coordinate axis values ​​represent the fluorescence signal intensity of alleles. The point in the lower left corner represents the negative control (NTC, i.e., ddH2O), the point in the upper left corner represents the TT genotype (same as Ningmai 9), and the point in the lower right corner represents the CC genotype (same as Yangmai 158). Figure 3 The figure shows the genotyping effect of the KASP molecular marker provided by this invention in high-generation wheat breeding lines and the comparison of grain weight of two different genotypes. In figure a, the coordinate axis values ​​represent the fluorescence signal intensity of alleles, the dot in the lower left corner represents the negative control (NTC, i.e., ddH2O), the dot in the upper left corner represents the TT genotype (the same as Ningmai 9), and the dot in the lower right corner represents the CC genotype (the same as Yangmai 158). In figure b, TT ​​and CC are two genotypes, and TGW represents the thousand-grain weight. Detailed Implementation

[0018] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0019] Unless otherwise specified, the terminology used in this invention generally has the meanings commonly understood by those skilled in the art. Various processes and methods not described in detail in the embodiments are conventional methods well-known in the art.

[0020] Unless otherwise specified, the reagents, equipment, etc. used in the following examples are all commercially available.

[0021] The wheat materials used in this invention are all germplasm resources preserved by the Jiangsu Provincial Germplasm Resource Bank (Crops) – College of Agriculture, Yangzhou University, and can be obtained and used by technical and research personnel in this field.

[0022] Example 1: QTL loci for wheat grain weight QTgw_3A Genetic localization and acquisition of marker regions In this embodiment, the wheat variety Ningmai 9 was used as the female parent and Yangmai 158 was used as the male parent to obtain the F1 generation. The F1 generation was then self-crossed to obtain the F2 generation. A high-generation recombinant inbred line (RIL) genetic population containing 282 lines was obtained through single-seed propagation.

[0023] A whole-genome scan of the RIL population was performed using an Illumina 90k microarray. Referring to Meng et al. (2015) QTL IciMapping: Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop J, 3:269-283, redundant markers were removed using the bin function of QTL IciMapping v4 to construct a linkage genetic map. The map covered all 21 chromosomes of wheat and was 3022 cM in length.

[0024] From 2021 to 2024, the aforementioned RIL population was planted at the Yangzijiang Experimental Base of Yangzhou University (119.41°E, 32.35°N) for three consecutive years, with single-row sowing, row length 1.2 m, row spacing 0.3 m, and three replicates. Before harvest, the field management was completely consistent, following the method published by Ma Hongxiang et al. (2021) (Ma Hongxiang, Gu Kejun, Chen Huaigu (2021), 100 Questions on Key Practical Technologies of Wheat Industry, China Agriculture Press). After the grains matured, five plants of uniform growth from each line were randomly harvested, threshed, and naturally dried. Then, 1000 seeds were randomly selected and weighed. The weight of each thousand seeds was expressed as the grain weight, and the average value was used for data analysis.

[0025] Using combined genotype and phenotypic data, the QTL linkage for grain weight trait was performed using QTL IciMapping v4 software and the Complete Interval Mapping Method (ICIM-ADD), with a LOD value of 2.5 as the significance threshold. A repeatable QTL under different environments was ultimately identified, whose enhancing allele originated from Yangmai 158 and significantly increased wheat grain weight. The applicant named this QTL as follows: QTgw_3A The genetic mapping results are as follows: Figure 1 As shown. QTgw_3ALocated on wheat chromosome 3A, the SNP molecular markers flanking it are 3A_514493982 and 3A_528521672, respectively, with a physical location between 514.49 Mb and 528.52 Mb on the Chinese spring reference genome IWGSCRefSeq v1.0.

[0026] Example 2: Development, screening and validation of KASP molecular markers To facilitate the identification of particle weight sites in Example 1 QTgw_3A In this embodiment, based on the SNP variation type linked to this site, a KASP marker for high-throughput, precise genotyping was further developed for transformation and utilization in wheat breeding. First, 150 bp sequences upstream and downstream of SNP site 3A_514493982 were extracted, and multiple candidate amplification primers were designed using Primer Premier 5 software. Subsequently, the quality of the candidate primers was evaluated using DNAMAN software, and the primer sequences were further aligned using the Ensembl Plants database to verify their specificity. Finally, primer sequences that could specifically recognize the target site and meet the requirements for efficient PCR amplification were screened and converted into KASP primers. Specifically, the KASP primer set consists of three primers: forward competitive primer 1: FAM fluorescent tag sequence + amplification primer sequence; forward competitive primer 2: HEX fluorescent tag sequence + amplification primer sequence; and reverse universal primer: amplification primer sequence. The nucleotide sequences of the FAM fluorescent tag sequence and the HEX fluorescent tag sequence are as follows: FAM fluorescent tag sequence (SEQ ID NO.1): 5' GAAGGTGACCAAGTTCATGCT 3' (can bind FAM fluorescent groups); HEX fluorescent tag sequence (SEQ ID NO.2): 5' GAAGGTCGGAGTCAACGGATT 3' (can be combined with HEX fluorescent groups).

[0027] Table 1 KASP primer design

[0028] Fifty samples were randomly selected from the RIL population, and young leaves were taken from both parents. The CTAB method (Stein N, et al. (2001) A new DNA extraction method for high-throughput marker analysis in a large-genome species such as Triticum aestivum Genomic DNA was extracted from the sample (PlantBreed, 120:354-356) and dissolved in sterile ultrapure water. The dissolved DNA was then subjected to quality testing using 0.8% agarose gel electrophoresis, requiring clear bands free of impurities and degradation. DNA concentration was determined using a Tnano micro-spectrophotometer and uniformly diluted to approximately 120 ng / μL.

[0029] The KASP primer set obtained in Table 1 was used for real-time PCR amplification. The reaction system, amplification program, and genotyping method are as follows: 1) PCR reaction system: The total volume is 10 μL, including 2.5 μL of sample DNA (120 ng / μL), 5 μL of 2×KASPMaster Mix (LGC Genomics, Hoddeston, UK), 0.14 μL of KASP Assay Mix, and 2.36 μL of ddH2O.

[0030] The KASP Assay Mix is ​​prepared as follows: Each 100 μL KASP Assay Mix contains 12 μL of each of two forward competitive primers at a concentration of 100 μM, 30 μL of a reverse universal primer at a concentration of 100 μM, and 46 μL of ddH2O.

[0031] 2) KASP reaction procedure: 94℃ thermal activation for 15 min; 94℃ denaturation for 20 s; 61~55℃ annealing and extension for 1 min (10 touches) Down cycle (decreasing the temperature by 0.6℃ per cycle); denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 1 min, for 28 cycles. The amplified product was incubated at 30℃, and fluorescence signals were collected.

[0032] 3) Genotyping: Fluorescence signals were scanned and clustering was performed using a real-time PCR instrument (Applied Biosystems ABI Via7 Real-Time PCR System, Thermo Scientific, USA). Based on the genotyping results, the genotypes of the wheat materials under test were determined. QTgw_3AFor the genotype of a locus, if the sample is close to the Y-axis in the genotyping cluster diagram and shows a blue FAM fluorescence signal, it is recorded as the TT genotype (Ningmai 9 genotype); if the sample is close to the X-axis in the genotyping cluster diagram and shows a red HEX fluorescence signal, it is recorded as the CC genotype (Yangmai 158 genotype); samples clustered near the origin and showing black are blank controls (NTC, i.e., ddH2O).

[0033] The typing results showed that the selected KASP primer sets had high amplification efficiency, clear typing clusters, and their typing results were completely consistent with the corresponding parental genotypes. Figure 2 The applicant named the primer set KASP. QTgw -3A_514493982, this KASP primer set consists of three nucleotide sequences: KASP-3A_514493982-1 (SEQ ID NO.3), KASP-3A_514493982-2 (SEQ ID NO.4), and KASP-3A_514493982-3 (SEQ ID NO.5), and can be applied to wheat grain heavy loci. QTgw_3A Molecular detection of superior allelic variations and breeding-assisted selection.

[0034] Example 3 KASP QTgw Applications of the -3A_514493982 molecular marker In order to analyze the molecular marker KASP obtained in Example 2 QTgw -3A_514493982 was used for population typing and application verification. The applicant used widely cultivated wheat varieties in the middle and lower reaches of the Yangtze River (including Huaimai 28, Wanmai 54, Xiangmai 25, Yangmai 11, Emai 198, Zhenmai 9, Huamai 5, Ruihuamai 596, Yangfumai 20, etc.) as parents. From the high-generation wheat breeding lines obtained through hybridization, 320 F7-F8 generation materials were randomly selected as verification materials (Table 2). These high-generation wheat breeding lines were planted at the Nanjing Liuhe Experimental Base (118.68°E, 32.50°N) in 2024-2025, and their planting management methods and phenotypic examination methods were consistent with those described in Example 1. DNA extraction, the KASP reaction system, amplification procedures, and genotyping methods were all the same as in Example 2.

[0035] The results show that this KASP primer set can be effectively used for wheat breeding materials. QTgw_3A Genotyping of loci and the ability to clearly distinguish different allelic variant types ( Figure 3 (a) The specific genotype detection results for each material are shown in Table 2.

[0036] Table 2 Phenotypes and Genotypes of High Generation Wheat Breeding Lines

[0037] SPSS 19.0 software was used to statistically analyze the thousand-grain weight of breeding materials with different genotypes. The results showed that the average thousand-grain weight of wheat materials carrying the CC genotype was 46.92 g, while that of wheat materials carrying the TT genotype was 45.05 g. Compared with the TT genotype, the thousand-grain weight of the CC genotype materials increased by 1.87 g, an increase of 4.15%, indicating that wheat materials carrying the CC genotype had a higher grain weight. Figure 3 (b)

[0038] The difference in thousand-grain weight between the two genotypes was further analyzed using an independent samples t-test. The results showed that the thousand-grain weight of the CC genotype was significantly higher than that of the TT genotype, with a highly significant difference (t=4.72, p=3.47×10⁻⁶). -6 (Table 3).

[0039] Table 3 t-test results

[0040] Note: ** indicates a difference at a significance level of 0.01.

[0041] In summary, this invention, based on genetic populations derived from the core parents Yangmai 158 and Ningmai 9 wheat varieties in the middle and lower reaches of the Yangtze River, combined with grain weight phenotypic identification and QTL linkage analysis, identified QTL loci significantly associated with wheat grain weight. QTgw_ 3A They also developed the KASP primer set KASP, which is closely associated with this site. QTgw -3A_514493982. This primer set enables rapid and accurate typing of target superior allelic variants. It has the advantages of simple operation, stable amplification, clear typing, and suitability for high-throughput detection. It can be used for efficient screening of high grain weight genotypes in large-scale genetic populations and breeding materials, providing technical support for wheat grain weight improvement, yield potential evaluation, and high-yield molecular breeding of wheat in the middle and lower reaches of the Yangtze River.

[0042] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0043] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0044] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A KASP primer set related to wheat grain weight, characterized in that, The KASP primer set is used for detecting the grain weight QTL site located on the 3A chromosome of wheat QTgw_3A comprising a forward primer KASP-3A_514493982-1 with a nucleotide sequence as shown in SEQ ID NO. 3, a forward primer KASP-3A_514493982-2 with a nucleotide sequence as shown in SEQ ID NO. 4, and a reverse universal primer KASP-3A_514493982-3 with a nucleotide sequence as shown in SEQ ID NO.

5.

2. The use of the KASP primer set according to claim 1 in any of the following: (1) detecting a QTL locus of wheat kernel weight QTgw_3A genotype; (2) Positioning QTgw_3A related functional genes; (3) Detect the weight of wheat grains; (4) Select and create high grain weight wheat varieties.

3. A method for detecting wheat grain weight, characterized in that, Includes the following steps: (1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the KASP primer set described in claim 1 to obtain the amplification product; (2) Perform fluorescence signal scanning and genotype cluster analysis on the amplification products to determine the properties of the test material. QTgw_3A Genotype at the locus; (3) Determine the weight of a thousand grains of wheat based on the genotype test results.

4. The method according to claim 3, characterized in that, In step (1), the PCR amplification system includes: 2.5 μL of wheat DNA template to be tested at a concentration of 120 ng / μL, 5 μL of 2×KASP Master Mix, 0.14 μL of KASP Assay Mix, and 2.36 μL of ddH2O; The preparation method for each 100 μL KASP Assay Mix is ​​as follows: 12 μL of 100 μM forward primer KASP-3A_514493982-1, 12 μL of 100 μM forward primer KASP-3A_514493982-2, 30 μL of 100 μM reverse universal primer KASP-3A_514493982-3, and 46 μL of ddH2O; The PCR amplification program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61–55℃ for 60 s, 10 touch cycles. Down cycle, decreasing the temperature by 0.6℃ per cycle; denaturation at 94℃ for 20 s, annealing at 55℃ for 60 s, 28 cycles; final hold at 30℃.

5. The method according to claim 3, characterized in that, In step (2), it is determined that the material to be tested is in QTgw_3A The method for determining the genotype of a locus is as follows: if a sample is close to the Y-axis and shows a blue fluorescent signal in the genotyping clustering diagram, it is recorded as the TT genotype; if a sample is close to the X-axis and shows a red fluorescent signal in the genotyping clustering diagram, it is recorded as the CC genotype.

6. The method according to claim 3, characterized in that, In step (3), the method for judging the thousand-grain weight of wheat is: the thousand-grain weight of wheat materials carrying the CC genotype is higher than that of wheat materials carrying the TT genotype.

Images