Molecular markers associated with seed length in zucchini squash, products and uses

Abstract

This invention belongs to the field of seed zucchini breeding technology, specifically relating to molecular markers, products, and applications related to the length of seed zucchini seeds. The molecular marker is an InDel marker, with nucleotide sequences of a 286bp DNA fragment as shown in SEQ ID NO.1 and / or a 497bp DNA fragment as shown in SEQ ID NO.2. The molecular marker of this invention is associated with the length of seed zucchini seeds. Through primer amplification of the molecular marker and the results of polyacrylamide gel electrophoresis, the length of seed zucchini seeds can be accurately and rapidly identified, significantly reducing the breeding time and improving breeding efficiency.

Description

Technical Field

[0001] This invention belongs to the field of seed zucchini breeding technology, specifically involving molecular markers, products and applications related to the length of seed zucchini seeds. Background Technology

[0002] Seed zucchini seeds are an excellent source of high-quality plant protein and oil, with crude protein content reaching 30%–40% and crude fat content as high as 40%–55%. The oil is predominantly composed of unsaturated fatty acids, such as oleic acid and linoleic acid. Simultaneously, seed zucchini seeds are rich in minerals such as potassium, magnesium, zinc, and iron, as well as vitamin E, phytosterols such as β-sitosterol, and phenolic compounds. Long-seeded seed zucchini typically have thinner seed coats, resulting in a higher kernel yield and better processing efficiency. Long-seeded varieties often have a high number of seeds per zucchini and a high 100-seed weight, demonstrating significant yield potential per unit area. For example, superior varieties such as "Jindi No. 2" have large, plump seeds, with a 100-seed weight reaching up to 19 grams.

[0003] Currently, the identification of seed zucchini requires measuring the length of the seeds after planting and harvesting. However, the planting cycle is long, making it impossible to quickly identify the length of the seeds in seed zucchini. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides molecular markers, products, and applications related to the length of seeds in seed-grade zucchini. The products are primers or kits for the molecular markers.

[0005] The first objective of this invention is to provide a molecular marker associated with the length of seeds in seed zucchini, said molecular marker being an InDel molecular marker, with nucleotide sequences of a 286 bp DNA fragment as shown in SEQ ID NO.1 and / or a 497 bp DNA fragment as shown in SEQ ID NO.2.

[0006] The SEQ ID The nucleotide sequence of NO.1 is: GGACGAACATGACTGAAGTAGCTATACATACAAATCCATTTACGGATCTATATGCTTTGATTGGAACTGGAAGTTTCAGAACAGGTGGCTGGTATACTACCATAATGAAACTACCTTTTTCTTTTTTTTATTCGGATA GGATTTCTGTTGGTTTCGTTAGGAGGCTCGCGTAGTTTGTTATGTTAGCTCCAAAAGGATAAGTTGCGTTGGAATTGAGAAAGTTCAGTGGAGTTCATAATTGCATAAAAAGAGGAGAAGTAGTGGGGCGAATCCCTTGGAGCACAGAT.

[0007] The SEQ ID NO.2: GGACGAACATGACTGAAGTAcaatactatttgggaggcaagaacatgagtaaagtcatacctgacaaaggcgatttgcgattcaccagtgtgagccctgtagttgttgttcgtggagatt tgatctacatcgctttccagctccagttcgcgacatccgtggctgaccaacacattttattggcaatcggctctgaaaatcccctacaaaatggccttctccccaaacatatcaacaagactacca ccttaatcgagctctcctcagggcaaaaagtagcgcccaacgttcaaaggcgataccacggactgacggcgataataggctggggcattattacgccctccggattgatgatcgctaggtacttt cgacacatcaaaccaatctggtattaccttcattcttcagtacagttcgtcggtttcttcgtcggaatcatctccatctccataggacgcaatctgtacgagaaaaAATCCCTTGGAGCACAGAT.

[0008] The InDel molecule is identified as NC42.1A19.

[0009] A second objective of this invention is to provide primers for amplifying the InDel molecular marker associated with seed length in zucchini as described in claim 1, comprising an upstream primer NC42.1A19-F and a downstream primer NC42.1A19-R.

[0010] The nucleotide sequence of the upstream primer NC42.1A19-F is shown in SEQ ID NO.3.

[0011] The nucleotide sequence of the downstream primer NC42.1A19-R is shown in SEQ ID NO.4.

[0012] The nucleotide sequence of SEQ ID NO.3 is: 5′-GGACGAACATGACTGAAGTA-3′.

[0013] The nucleotide sequence of SEQ ID NO.4 is: 5′-ATCTGTGCTCCAAGGGATT-3′.

[0014] A third objective of this invention is to provide a kit for identifying the length of seeds in seed-grade zucchini, comprising the aforementioned primers and auxiliary reagents.

[0015] Preferably, the auxiliary reagents are buffer solutions, DNA extraction reagents, PCR reagents, and electrophoresis reagents.

[0016] A fourth object of the present invention is to provide an InDel molecular marker associated with the length of seeds in seed-grade zucchini, the application of the primers or the kit, comprising at least one of the following: (1) Identify the length of seeds in zucchini.

[0017] (2) Assist in the breeding of long-grained zucchini varieties for seed production.

[0018] Preferably, the method for identifying the length of zucchini seeds includes the following steps: Using genomic DNA from the seed zucchini to be tested as a DNA template, PCR amplification was performed on the DNA template using primers shown in SEQ ID No. 2 and SEQ ID No. 3, and the PCR amplification products were detected by electrophoresis.

[0019] If a band of approximately 497 bp and a band of approximately 286 bp are amplified, the seed zucchini is a long-seeded zucchini variety. If a band of 286 bp is amplified, the seed zucchini is a short-seeded zucchini variety.

[0020] Preferably, the method for extracting genomic DNA from the seed zucchini sample to be tested is the hexadecyltrimethylammonium bromide method.

[0021] Preferably, the amplification conditions for the genomic DNA are as follows: 94℃ for 3 min, 94℃ for 20 s, 68℃ for 20 s, 72℃ for 30 s, repeated 6 times; 94℃ for 20 s, 58℃ for 20 s, 72℃ for 30 s, repeated 8 times; 94℃ for 20 s, 50℃ for 20 s, 72℃ for 30 s, repeated 20 times; 72℃ for 5 min, 4℃.

[0022] Compared with the prior art, the present invention has the following beneficial effects: The molecular marker associated with the seed length of seed-producing zucchini in this invention is an InDel molecular marker, with nucleotide sequences of a 286 bp DNA fragment as shown in SEQ ID NO.1 and / or a 497 bp DNA fragment as shown in SEQ ID NO.2. The InDel molecular marker of this invention for identifying the seed length of seed-producing zucchini is located on chromosome 5 of the seed-producing zucchini and is a codominant marker. The InDel molecular marker of this invention is associated with the seed length of seed-producing zucchini. Amplification using InDel molecular marker primers and the results of polyacrylamide gel electrophoresis can accurately and rapidly identify the seed length of seed-producing zucchini, significantly reducing the breeding time and improving breeding efficiency. Attached Figure Description

[0023] Figure 1 The images show actual photos of the ZHL-2, ZHL-6 and F1 zucchini seeds of the present invention.

[0024] Figure 2 This is a grain length distribution diagram of the F2 population of the present invention.

[0025] Figure 3 These are polyacrylamide gel electrophoresis images of ZHL-2, ZHL-6, and F2 of the present invention.

[0026] Figure 4 The images show actual grains of ZHL-2, ZHL-6, Hongchang 1585, Hongchang 502, Hongchang 601, Hongchang 1589, Hongchang 1008, Hongchang 1005, Hongchang 211 and Hope No. 9 of this invention.

[0027] Figure 5 The images show polyacrylamide gel electrophoresis images of ZHL-2, ZHL-6, Hongchang 1585, Hongchang 502, Hongchang 601, Hongchang 1589, Hongchang 1008, Hongchang 1005, Hongchang 211 and Hope No. 9 of the present invention. Detailed Implementation

[0028] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the following detailed description, in conjunction with preferred embodiments and accompanying drawings, provides a clear and complete account of the technical solutions of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0029] It should be noted that all technical terms used in this invention are for the purpose of describing specific embodiments only and are not intended to limit the scope of protection of this invention. Unless otherwise specified, all raw materials, reagents, instruments and equipment used in the following embodiments of this invention can be purchased from the market or prepared by existing methods.

[0030] The main materials used in this invention include DNA extraction kit, mercaptoethanol, 2×Es Taq MasterMix, TBE, formaldehyde, and NaOH solution.

[0031] The DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd., under the trade name "Plant Whole Genome DNA Extraction Kit," and included buffer GP1, adsorption column CB3, buffer GD, and wash buffer PW. Mercaptoethanol (β-mercaptoethanol) was purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd., in 100 mL form. 2×Es TaqMasterMix was purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd., and included dyes; it was a ready-to-use PCR premix. TBE was purchased from Beijing Solarbio Technology Co., Ltd., under the trade name "5×TBE Buffer 500 mL." Formaldehyde, analytical grade, was purchased from Sinopharm Chemical Reagent Co., Ltd., under the trade name "Formaldehyde Solution." NaOH solution was purchased from Nanjing Chemical Reagent Co., Ltd., under the trade name "30% Sodium Hydroxide Solution."

[0032] The seed zucchini varieties used in this invention are ZHL-2, ZHL-6, Hongchang 1585, Hongchang 502, Hongchang 601, Hongchang 1589, Hongchang 1008, Hongchang 1005, Hongchang 211, and Hope No. 9. ZHL-2 and ZHL-6 were obtained from the Seed Cucurbita Research Group of Inner Mongolia Agricultural University, and the applicant guarantees to release them to the public within twenty years from the date of application. Hongchang 1585, Hongchang 502, Hongchang 601, Hongchang 1589, Hongchang 1008, Hongchang 1005, and Hongchang 211 were all obtained from Inner Mongolia Hongchang Agricultural Co., Ltd. Hope No. 9 was obtained from Gansu Jiuquan Hope Seed Industry Co., Ltd.

[0033] Example 1 A method for obtaining an InDel molecular marker associated with the length of seeds in seed-grade zucchini includes the following steps: 1. Construction and trait determination of a population associated with seed length in seed-producing zucchini The short-seeded ZHL-2 was used as the male parent and the long-seeded ZHL-6 as the female parent to obtain the F1 generation. ZHL-2 was designated as 1, and ZHL-6 as 2. 200 F1 seeds were planted and managed using standard field methods. After full maturity, seed zucchini seeds were harvested and designated as F2. The length of the F2 seeds was measured. Actual samples of the seed zucchini seeds from ZHL-2, ZHL-6, and F1 of this invention are shown below. Figure 1 As shown in the figure. The results show that the grain length of the F1 generation after hybridization is between ZHL-2 and ZHL-6. The grain length distribution of the F2 population of this invention is shown in the figure. The results show that the length of the F2 population follows a normal distribution within the population.

[0034] 2. DNA extraction from extremely long and extremely short grains DNA was extracted from individual leaves of 30 F2 plants, both extremely long and extremely short, using the hexadecyltrimethylammonium bromide method. DNA concentration was detected using a Thermo Nanodrop 2000, and DNA purity and integrity were assessed by 1 wt% agarose gel electrophoresis to obtain the DNA from the F2 plants. The specific method is as follows:

[0035] First, take 0.5g of young plant leaves, grind them thoroughly into powder in liquid nitrogen, and quickly transfer them to preheated CTAB extraction buffer. Incubate at 65℃ for 60 minutes to obtain the lysis buffer. Mix the lysis buffer and chloroform-isoamyl alcohol in equal volumes, extract, invert to mix, centrifuge, and collect the upper aqueous phase. The volume ratio of chloroform to isoamyl alcohol in the chloroform-isoamyl alcohol mixture is 24:1. Then, add 2 volumes of anhydrous ethanol to the resulting aqueous phase, incubate at -20℃ to precipitate DNA, centrifuge, discard the supernatant, wash the precipitate 1–2 times with 70% ethanol, air dry at room temperature, and dissolve the DNA in an appropriate amount of TE buffer or ddH2O.

[0036] 3. BSA sequencing analysis of seed length traits in seed-producing zucchini We commissioned Gedio Biotechnology Co., Ltd. to perform whole-genome sequencing of the F2 genome using BSA sequencing technology. The specific procedures are as follows: The specific steps of BSA sequencing mainly include library construction, high-throughput sequencing, and bioinformatics analysis. Based on the phenotype of seed zucchini seed length, 30 individuals with extremely long seeds and 30 individuals with extremely short seeds were screened. The DNA from the 30 individuals with extremely long seeds was mixed in equal volumes to obtain an extremely long DNA pool. The DNA from the 30 individuals with extremely short seeds was mixed in equal volumes to obtain an extremely short DNA pool. Simultaneously, DNA was extracted from the 30 individuals with extremely long seeds to obtain long trait DNA. DNA was extracted from the 30 individuals with extremely short seeds to obtain short trait DNA. The long and short trait DNAs underwent quality testing, requiring an OD260 / 280 ratio between 1.8 and 2.0, a concentration greater than 20 ng / μL, and an intact, undegraded genome. The qualified long and short trait DNAs were fragmented to 350 bp using enzyme digestion, followed by end repair, polyA tailing, sequencing adapter ligation, purification, and PCR amplification to complete library construction.

[0037] Paired-end sequencing was performed on the Illumina high-throughput sequencing platform, with a sequencing depth of ≥30× for parental and progeny pools to obtain raw data. The raw data was filtered to remove adapter sequences, low-quality sequences, and sequences with excessively high N ratios, resulting in high-quality data. Subsequently, alignment software such as BWA was used to align the clean data to a reference genome, and tools such as SAMtools and Picard were used to sort and label PCR repetitive sequences based on the alignment results. On this basis, variant detection was performed using GATK software to identify single nucleotide polymorphisms (SNPs) and small insertion / deletion markers (InDels) across the entire genome, and the detected variant sites were annotated. Single nucleotide polymorphisms are abbreviated as SNPs, and small insertion / deletion markers are abbreviated as InDels. Finally, based on the detected SNP sites, the allele frequency differences between two extreme pools were analyzed by calculating indices such as SNP-index or ΔSNP-index, thereby locating candidate regions significantly associated with the target trait across the entire genome. Genes within these regions were then subjected to GO functional annotation and KEGG pathway enrichment analysis to screen for potential candidate genes. An InDel molecular marker closely linked to the seed length of seed-producing zucchini was obtained, located on chromosome 05 and named NC42.1A19. The InDel molecular marker contains a 286 bp DNA fragment with the nucleotide sequence shown in SEQ ID NO.1, denoted as NC42.1A19-1, and a 497 bp DNA fragment shown in SEQ ID NO.2, denoted as NC42.1A19-2.

[0038] The SEQ ID The nucleotide sequence of NO.1 is: GGACGAACATGACTGAAGTAGCTATACATACAAATCCATTTACGGATCTATATGCTTTGATTGGAACTGGAAGTTTCAGAACAGGTGGCTGGTATACTACCATAATGAAACTACCTTTTTCTTTTTTTTATTCGGATA GGATTTCTGTTGGTTTCGTTAGGAGGCTCGCGTAGTTTGTTATGTTAGCTCCAAAAGGATAAGTTGCGTTGGAATTGAGAAAGTTCAGTGGAGTTCATAATTGCATAAAAAGAGGAGAAGTAGTGGGGCGAATCCCTTGGAGCACAGAT.

[0039] The SEQ ID The nucleotide sequence of NO.2 is: GGACGAACATGACTGAAGTAcaatactatttgggaggcaagaacatgagtaaagtcatacctgacaaaggcgatttgcgattcaccagtgtgagccctgtagttgttgttcgtgg agatttgatctacatcgctttccagctccagttcgcgacatccgtggctgaccaacacattttattggcaatcggctctgaaaatcccctacaaaatggccttctccccaaacatatcaacaagact accaccttaatcgagctctcctcagggcaaaaagtagcgcccaacgttcaaaggcgataccacggactgacggcgataataggctggggcattattacgccctccggattgatgatcgctaggtact ttcgacacatcaaaccaatctggtattaccttcattcttcagtacagttcgtcggttcttcgtcggaatcatctccatctccataggacgcaatctgtacgagaaaaAATCCCTTGGAGCACAGAT.

[0040] 4. Preparation of InDel molecular marker primers The specific steps for designing primers for InDel molecular markers using Premier software can be divided into three core stages: sequence acquisition and format processing, primer design and parameter setting, and product verification.

[0041] First, based on parental resequencing data or BSA-seq localization results, obtain flanking genomic sequences of 200-500 bp upstream and downstream of the target InDel site. Save the sequences containing InDel differences and clearly label the insertion or deletion allelic variants in the sequences. Paste the processed sequences into the primer design window, and set the primer search range to both sides of the core region containing the InDel site, ensuring that the designed primers can cross the InDel site to distinguish alleles by differences in PCR product length.

[0042] Primer design parameters require primer lengths of 18-25 bp, GC content maintained at 40-60%, annealing temperature set at 55-60℃, with the annealing temperature difference between upstream and downstream primers not exceeding 2℃. The expected PCR product length range is set at 100-400 bp, with insertion or deletion length differences of at least 5-10 bp for easy differentiation by agarose gel electrophoresis. For 3' end specificity of primers, avoid more than three consecutive G or C sequences to reduce the risk of primer dimer and hairpin formation. After setting the parameters, run the primer search function. The software will return multiple candidate primer pairs. Prioritize combinations where the InDel site is located in the middle of the product rather than at the extreme ends to ensure the stability of PCR amplification. Subsequently, perform BLAST alignment on the selected primer pairs to confirm their uniqueness in the target species genome and avoid non-specific amplification.

[0043] The primers designed to obtain the InDel molecular marker for NC42.1A19 are the upstream primer NC42.1A19-F and the downstream primer NC42.1A19-R. The nucleotide sequence of the upstream primer NC42.1A19-F is shown in SEQ ID NO.2. The nucleotide sequence of the downstream primer NC42.1A19-R is shown in SEQ ID NO.3.

[0044] The nucleotide sequence of SEQ ID NO.3 is: 5′-GGACGAACATGACTGAAGTAGC-3′.

[0045] The nucleotide sequence of SEQ ID NO.4 is: 5′-ATCTGTGCTCCAAGGGATT-3′.

[0046] Example 2 Verification of the relationship between an InDel molecular marker and the length of seeds in seed zucchini includes the following steps: 1. Extraction of genomic DNA from seed zucchini Genomic DNA was extracted from the leaves of ZHL-2, ZHL-6, and F2 cells according to the instructions of the DNA extraction kit. The specific steps are as follows:

[0047] 1) Take 100mg of seed zucchini leaves, add liquid nitrogen and grind to obtain powder.

[0048] 2) Transfer the powder to a mixture of 0.7 μL mercaptoethanol and 700 μL buffer GP1 preheated at 65 °C, mix well, and incubate in a water bath at 65 °C for 20 min, mixing three times during the water bath process.

[0049] 3) Add 700 μL of chloroform, mix well, centrifuge at 12000 rpm for 5 min, and collect the supernatant.

[0050] 4) Mix the supernatant with 700 μL of buffer GP2, add it to the adsorption column CB3, centrifuge CB3 at 12000 rpm for 30 s, and discard the waste liquid.

[0051] 6) Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12000 rpm for 30 s, discard the waste liquid, and put the adsorption column CB3 into the collection tube.

[0052] 7) Add 600 μL of washing buffer PW to the adsorption column CB3, centrifuge at 12000 rpm for 30 s, discard the waste liquid, and put the adsorption column CB3 into the collection tube.

[0053] 8) Repeat step 7.

[0054] 9) Place the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm for 2 minutes, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to thoroughly dry any residual washing liquid in the adsorption material.

[0055] 10) Transfer the adsorption column CB3 into a clean centrifuge tube, add 70 μL of elution buffer TE to the middle of the adsorption membrane, incubate at room temperature for 5 min, centrifuge at 12000 rpm for 2 min, collect the solution into the centrifuge tube, and obtain the genomic DNA of the father, mother and the zucchini to be tested.

[0056] 2. Amplification of genomic DNA using InDel-labeled primers Using genomic DNA from ZHL-2, ZHL-6, and F2 as templates, amplification was performed using InDel molecular marker primers NC42.1A19-F and NC42.1A19-R to obtain amplification products for ZHL-2, ZHL-6, and F2, respectively. The PCR amplification system is shown in Table 1, and the PCR amplification conditions are shown in Table 2.

[0057] Table 1 PCR amplification system Table 2 PCR amplification conditions 3. Identification of seed length in seed-producing zucchini 3.1 Polyacrylamide gel electrophoresis of amplification products The amplification products of ZHL-2, ZHL-6, and F2 were subjected to polyacrylamide gel electrophoresis, respectively, as follows: Clean and dry both glass plates thoroughly, ensuring they are free of watermarks and stains. Attach the base plate and ear plate together and secure them with clips. Shake the prepared 8% polyacrylamide gel solution well and slowly pour it between the two glass plates at a uniform rate. Use a plastic strip to remove any air bubbles between the plates. Finally, insert the gel comb horizontally into the wells and allow it to solidify for 2 hours. After the gel has solidified, slowly remove the gel comb, place and secure the ear plate near the inside of the electrophoresis tank, and add 1×TBE electrophoresis buffer. Add 1 μL of amplification product to each well using a pipette and perform electrophoresis at 140 V and 80 mA for 50 min.

[0058] After electrophoresis, the ear plate was separated from the base plate. The base plate containing the colloid was stained in a 1.3 g / L AgNO3 solution for 2 min. The colloid surface was rinsed with distilled water to remove the stain, and then the colloid was placed in the developing solution for 1 min. The developing solution was prepared by mixing 1.5 mL of formaldehyde solution, 15 g of NaOH, and 1 L of distilled water. The surface stain was washed away with water, and after drying, the colloid was placed on a light box, the bands were recorded, and photographs were taken for storage.

[0059] 3.2 Determination of seed length in seed-producing zucchini Polyacrylamide gel electrophoresis of ZHL-2, ZHL-6 and F2 of the present invention is as follows: Figure 3 As shown in the figure. The results show that the bands of the amplified products are clear and well separated. The band of ZHL-2 is missing the 497bp band. ZHL-6 has both 497bp and 286bp bands. The band in F2 is consistent with that of ZHL-2, which is a short seed. The band in F2 is consistent with that of ZHL-6, which is two bands, which is a long seed.

[0060] Therefore, the InDel molecular marker NC42.1A19 of the present invention can be used to identify the length of seeds in seed zucchini.

[0061] Example 3 The application of an InDel molecular marker in identifying the length of seeds in seed-grade zucchini includes the following steps: Genomic DNA was extracted from the leaves of ZHL-2, ZHL-6, Hongchang 1585, Hongchang 502, Hongchang 601, Hongchang 1589, Hongchang 1008, Hongchang 1005, Hongchang 211, and Hope No. 9 using the method described in Example 2. Hongchang 1585 was designated as 3, Hongchang 502 as 4, Hongchang 601 as 5, Hongchang 1589 as 6, Hongchang 1008 as 7, Hongchang 1005 as 8, Hongchang 211 as 9, and Hope No. 9 as 10. Seed length was determined by polyacrylamide gel electrophoresis.

[0062] The actual grain samples of ZHL-2, ZHL-6, Hongchang 1585, Hongchang 502, Hongchang 601, Hongchang 1589, Hongchang 1008, Hongchang 1005, Hongchang 211 and Hope No. 9 of this invention are shown below. Figure 4 As shown in the figure. The results show that ZHL-2, Hongchang 502, Hongchang 1008, Hongchang 1005, Hongchang 211, and Hope No. 9 are short-grained varieties. ZHL-6, Hongchang 1585, Hongchang 601, and Hongchang 1589 are long-grained varieties.

[0063] The polyacrylamide gel electrophoresis results of ZHL-2, ZHL-6, Hongchang 1585, Hongchang 502, Hongchang 601, Hongchang 1589, Hongchang 1008, Hongchang 1005, Hongchang 211, and Hope No. 9 of the present invention are as follows: Figure 5 As shown in the figure. The results show that ZHL-2, Hongchang 502, Hongchang 1008, Hongchang 1005, Hongchang 211, and Hope No. 9 all have amplification products of only 286bp in length, and are short-grain varieties. ZHL-6, Hongchang 1585, Hongchang 601, and Hongchang 1589 all have amplification products of 286bp and 497bp in length, and are long-grain varieties.

[0064] The InDel molecular marker of this invention is associated with the length of seed zucchini. The length of seed zucchini can be accurately and quickly identified by the amplification of InDel molecular marker primers and the results of polyacrylamide gel electrophoresis, which can significantly reduce the breeding time of seed zucchini and improve the breeding efficiency.

[0065] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described in this invention to avoid redundancy. Although preferred embodiments of this invention have been described, those skilled in the art, once they understand the inventive concept of this invention, can make other changes and modifications to these embodiments, and all such changes and modifications fall within the scope of this invention.

[0066] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. If such modifications and variations fall within the scope of equivalents of this invention, then this invention is also intended to include such modifications and variations.

Claims

1. A molecular marker associated with the length of seeds in seed-producing zucchini, characterized in that, The molecular marker is an InDel molecular marker, with nucleotide sequences of a 286bp DNA fragment as shown in SEQ ID NO.1 and / or a 497bp DNA fragment as shown in SEQ ID NO.

2.

2. A primer for amplifying the InDel molecular marker associated with seed length in the seed-growing zucchini of claim 1, characterized in that, This includes the upstream primer NC42.1A19-F and the downstream primer NC42.1A19-R; The nucleotide sequence of the upstream primer NC42.1A19-F is shown in SEQ ID NO.3; The nucleotide sequence of the downstream primer NC42.1A19-R is shown in SEQ ID NO.

4.

3. A kit for identifying the length of seeds in seed-producing zucchini, characterized in that, Includes the primers and auxiliary reagents as described in claim 2.

4. A kit for identifying the length of seeds in seed-producing zucchini according to claim 3, characterized in that, The auxiliary reagents are buffer solutions, DNA extraction reagents, PCR reagents, and electrophoresis reagents.

5. The application of the InDel molecular marker associated with the seed length of seed-grade zucchini as described in claim 1, the primer as described in claim 2, or the kit as described in claim 3, characterized in that, Includes at least one of the following: (1) Identify the length of seeds in zucchini; (2) Assist in the breeding of long-grained zucchini varieties for seed production.

6. The application of the InDel molecular marker associated with the seed length of seed-grade zucchini according to claim 5, characterized in that, The method for identifying the length of seeds in seed-grade zucchini includes the following steps: Using the genomic DNA of the seed zucchini to be tested as a DNA template, PCR amplification of the DNA template was performed using the primers shown in SEQ ID No. 3 and SEQ ID No. 4, and the PCR amplification products were detected by electrophoresis. The seed length of the seed zucchini variety with two bands (497bp and 286bp) amplified is greater than that of the seed zucchini variety with one band (286bp).

7. The application of the InDel molecular marker associated with the seed length of seed-grade zucchini according to claim 6, characterized in that, The method for extracting genomic DNA from the seed zucchini samples to be tested was the hexadecyltrimethylammonium bromide method.

8. The application of the InDel molecular marker associated with the seed length of seed-grade zucchini according to claim 6, characterized in that, The amplification conditions for the genomic DNA were as follows: 94℃ for 3 min, 94℃ for 20 s, 68℃ for 20 s, 72℃ for 30 s, for 6 cycles; 94℃ for 20 s, 58℃ for 20 s, 72℃ for 30 s, for 8 cycles; 94℃ for 20 s, 50℃ for 20 s, 72℃ for 30 s, for 20 cycles; 72℃ for 5 min, 4℃.

Images