In-del marker cp8036 linked to a gene controlling lycopene content and use thereof

Abstract

The present application relates to an InDel marker Cp8036 linked with a capsanthin content control gene and application thereof.The marker is located between 234310939~234310977 of the No.4 chromosome of the reference genome, and is an insertion or deletion sequence between A at the 234310939th position and A at the 34 310 977th position of the nucleotide sequence shown in sequence 1.The marker can be used for molecular breeding of high capsanthin varieties, and the accuracy can reach more than 86%, which provides a practical molecular marker for high capsanthin molecular breeding.

Description

Technical Field

[0001] This invention relates to the field of chili pepper breeding, specifically to an InDel marker Cp8036 linked to a gene controlling capsanthin content and its application. Background Technology

[0002] Capsanthin, a carotenoid compound, is an important post-harvest processed product of chili peppers. It possesses various physiological functions, including antioxidant, anticancer, and immunomodulatory effects, and is widely used in food processing, animal feed, cosmetics, and pharmaceuticals. Capsanthin is mainly distributed on the thylakoid membranes of the pigment-producing cells in chili pepper pericarps, accounting for 56.06%–57.14% of the total carotenoids. Driven by industrial production, the capsanthin industry is developing steadily and has broad prospects.

[0003] Furthermore, in the process of cultivating chili pepper varieties with high capsanthin content, traditional capsanthin content identification usually waits until the chili peppers mature before testing, which has limitations such as complex operation, long time consumption, and a long breeding cycle, making it difficult to meet the needs of modern efficient breeding. Moreover, the molecular regulatory mechanism of capsanthin synthesis is complex, and molecular genetic progress is slow, which also limits the bio-breeding process of high capsanthin varieties. Therefore, screening for molecular markers that can be used to identify high capsanthin varieties is particularly important.

[0004] In view of this, the present invention is hereby proposed. Summary of the Invention

[0005] In view of the shortcomings of the prior art, one of the objectives of this invention is to provide an application of the InDel marker Cp8036 linked to the gene controlling capsanthin content.

[0006] The second objective of this invention is to provide a primer combination for identifying the genotype of the InDel marker Cp8036.

[0007] A third objective of this invention is to provide a kit containing the above-described primer combination.

[0008] The fourth objective of this invention is to provide a method for identifying whether chili pepper materials belong to varieties with high capsanthin content.

[0009] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of the present invention provides the use of the InDel marker Cp8036, which is linked to the gene controlling capsanthin content, in any of the following (1) to (3): (1) Application in chili pepper breeding or assisted breeding; (2) Application in identifying or assisting in the identification of whether chili pepper materials belong to varieties with high capsanthin content; (3) Application in the preparation of reagents for identifying or assisting in the identification of whether chili pepper materials belong to high capsanthin varieties; The InDel marker Cp8036 linked to the gene controlling capsanthin content is located between positions 234,310,939 and 234,310,977 on chromosome 4 of the reference genome. The InDel marker Cp8036 is defined as follows: inserting the nucleotide sequence shown in Sequence 1 of the ordered list between the A at position 234,310,939 and the A at position 34,310,977, abbreviated as In37; or deleting the nucleotide sequence shown in Sequence 1 of the sequence list between the A at position 234,310,939 and the A at position 34,310,977, abbreviated as Del37; the reference genome is the Zunla-1_v3.0 chili reference genome. When the genotype of the InDel marker Cp8036 is In37:In37 or In37:Del37, the chili pepper material is a high capsanthin variety; when the genotype of the InDel marker Cp8036 is Del37:Del37, the chili pepper material is a low capsanthin variety.

[0010] In the application of the first aspect above, as an optional implementation, the high capsanthin variety is a chili pepper material with a capsanthin content higher than 2658.3265 mg / KgDW; the low capsanthin variety is a chili pepper material with a capsanthin content not higher than 2658.3265 mg / KgDW.

[0011] A second aspect of this invention provides a primer combination for identifying the genotype of an InDel marker Cp8036 linked to a gene controlling capsanthin content. The InDel marker Cp8036 is located between positions 234,310,939 and 234,310,977 on chromosome 4 of a reference genome. The InDel marker Cp8036 is defined as follows: an insertion of the nucleotide sequence shown in Sequence 1 of the ordered list between A at position 234,310,939 and A at position 34,310,977, abbreviated as In37; or a deletion of the nucleotide sequence shown in Sequence 1 of the sequence list between A at position 234,310,939 and A at position 34,310,977, abbreviated as Del37. The reference genome is the Zunla-1_v3.0 pepper reference genome.

[0012] In the primer combination of the second aspect above, the primer combination can be any primer pair designed based on the InDel marker Cp8036 that can identify the molecular marker genotype. As a preferred embodiment, the primer combination consists of an upstream primer and a downstream primer, wherein the upstream primer has a nucleotide sequence as shown in Sequence 2 of the sequence listing, and the downstream primer has a nucleotide sequence as shown in Sequence 3 of the sequence listing.

[0013] A third aspect of the present invention provides a kit comprising the primer combination described in the second aspect.

[0014] The kit may also include other reagents used in the PCR amplification system, such as DNA polymerase, dNTPs, and buffer solutions.

[0015] A fourth aspect of this invention provides a method for identifying whether a chili pepper material belongs to a high-capsaicin variety, comprising the following steps: S1: Extract genomic DNA from the chili pepper material to be identified; S2: Using the genomic DNA obtained in step S1 as a template, PCR amplification is performed using the primer combination described in the second aspect above to obtain PCR products; S3: Identify the PCR products obtained in step S2, and then determine whether the chili pepper material belongs to a high-capsaicin variety based on the identification results; the specific determination method is as follows: If the PCR product is the nucleotide sequence shown in sequence 4 of the sequence listing, then the chili material is a high capsanthin variety. If the PCR product is the nucleotide sequence shown in sequence 5 of the sequence listing, then the chili material is a low capsanthin variety. If the PCR product has both the nucleotide sequence shown in Sequence 4 of the sequence listing and the nucleotide sequence shown in Sequence 5 of the sequence listing, then the chili material is a high capsanthin variety.

[0016] In the fourth aspect of the method described above, as an optional implementation, the identification in step S3 is gel electrophoresis, and then the chili pepper material is determined to be a high-capsulacin variety based on the identification results; the specific determination method is as follows: When the PCR product is a single band of 289 bp, the chili pepper material is a high capsanthin variety. When the PCR product is a single band of 252 bp, the chili pepper material is a low capsanthin variety. When the PCR product consists of two bands of 289 bp and 252 bp, the chili pepper material is a high-capsaicin variety.

[0017] In the fourth aspect of the method described above, as an optional implementation, the high capsanthin variety is a chili pepper material with a capsanthin content higher than 2658.3265 mg / KgDW; the low capsanthin variety is a chili pepper material with a capsanthin content not higher than 2658.3265 mg / KgDW.

[0018] In the method of the fourth aspect above, as an optional implementation, the PCR amplification system is as follows: 2 μL genomic DNA, 10 μL 2×Phanta Max Master Mix, 1 μL upstream primer, 1 μL downstream primer, and 6 μL ddH2O.

[0019] In the method of the fourth aspect above, as an optional implementation, the PCR amplification program is as follows: pre-denaturation at 95°C for 3 min; then denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 30 s, for a total of 34 cycles.

[0020] The beneficial effects of this invention are: This invention utilizes two chili inbred lines with significantly different capsanthin content and a RILs population containing 240 lines constructed using these two lines as parents as experimental materials. A high-density genetic map of chili was constructed using SLAF-seq technology. Combined with capsanthin phenotypic data from two seasons, the major QTL for capsanthin content was located on chromosome 4, and the tightly linked InDel marker Cp8036 was developed. This marker is located between positions 234,310,939 and 234,310,977 on chromosome 4 of the Zunla-1_v3.0 chili reference genome. It represents the nucleotide sequence shown in Sequence 1 of the insertion or deletion sequence listing between positions 234,310,939 and 234,310,977. Validation using the RILs population showed a marker accuracy of 88.33%. Validation using other natural chili populations also achieved an accuracy of over 86%. This marker can be accurately applied in the molecular breeding of high capsanthin varieties, providing a practical molecular marker for high capsanthin molecular breeding. Attached Figure Description

[0021] To more clearly illustrate the technical solutions of the specific embodiments of the present invention, the drawings used in the description of the specific embodiments will be briefly introduced below. Obviously, the drawings described below do not constitute a limitation on the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 This is a high-density, fully linked genetic map of chili peppers, where the black horizontal lines represent SLAF markers; x shaft and yThe axes represent linkage group number and genetic distance (unit: centimole); Figure 2 QTL mapping results for capsanthin; Figure 3 The image shows the results of PCR amplification of 63 materials using the Indel-labeled primers of this invention, where M is the molecular weight marker and the others are material numbers.

[0023] Figure 4 The electrophoresis diagrams of PCR products from 59 natural population materials were obtained using the InDel-labeled primers of this invention. M represents the molecular weight marker, and the others are the material numbers. Detailed Implementation

[0024] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in literature, books, and manuals in the field, or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0026] The following examples use chili pepper materials B158 (high capsanthin) and B161 (low capsanthin). B158 was introduced from Xinjiang and is an annual chili pepper. Capsicum annuum L.), with no epidermal hairs on the stem and leaf surface, the fruit is horn-shaped, the plant height is 110-120cm, the fruit length is 13-16cm, the diameter is 3-4cm, the flesh thickness is 3-4mm, it has 3 locules, the fruit stalk length is about 4cm, the fruit has a high capsanthin content, averaging 3181.163mg / KgDW; B161 is a semi-wild chili pepper material introduced from the United States, with the introduction number PI 594134 01 SD, belonging to the annual chili pepper ( Capsicum annuum (L.), with hairy stems and leaves, small conical fruit, plant height 170cm-200cm, fruit length 4-5cm, diameter 2-2.5cm, flesh thickness 1-1.5mm, 3 locules, fruit stalk length 4-5cm, low capsanthin content, average 412.106mg / KgDW. Both materials are deposited in the National Vegetable Germplasm Bank or provided by the Chili Pepper Research Group of the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences.

[0027] Example 1: Obtaining the InDel marker Cp8036 linked to the gene controlling capsanthin content and InDel primers. 1. Materials and Methods 1.1 Test Materials: Using the chili pepper materials B158 (high capsanthin) and B161 (low capsanthin), which have significantly different capsanthin contents, as parents, an F1 generation consisting of 240 strains was constructed. 10 Recombinant inbred lines (RILs) were used. For B158, B161 and 240 RILs, three biological replicates were set up for each planting, with 10 plants of each line planted in each replicate. The experiment was designed as a randomized block design.

[0028] 1.2 Method for determining capsanthin: The pericarps of fully ripe chili peppers were freeze-dried, then ground into powder using a grinder and passed through a 60-mesh sieve. 0.5g of the sieve-cross sample was weighed and the capsanthin content was determined by high performance liquid chromatography (HPLC). The determination method is described in the following literature: Hui Bodi, Zhang Xi, Wen Jing, Application of reversed-phase C30 column in HPLC analysis of carotenoids [J], Food Science, 2005, (01): 264-270.

[0029] 1.3 Constructing a high-density genetic map of chili peppers: 1.3.1 Genomic DNA extraction and SLAF library construction DNA from young tissues was extracted using the CTAB method for sequencing. Hae Genomic DNA from each sample that passed enzyme digestion detection was processed. At 37°C, the 3' ends of the digested fragments were treated with A addition (3'→5') using Klenow Fragment and dATP. Dual-index sequencing adapters were then ligated using T4 DNA ligase. PCR amplification was subsequently performed. The PCR products were purified using Agencourt AMPure XP (beads Beckman Coulter, High Wycombe, UK) and then mixed. The mixed samples were subjected to agarose gel electrophoresis and gel cutting. Target fragments of 314-394 bp were selected and defined as SLAF tags. After the library passed quality control, it was analyzed using Illumina HiSeq. TM PE 125bp sequencing was performed using a 2500 (Illumina, Inc.; San Diego, CA, USA) scanner. To assess the accuracy of the library construction experiment, Nipponbare rice (Oryza sativa L. japonica) was used as a control and underwent the same treatment for library construction and sequencing.

[0030] 1.3.2 SLAF-seq Data Analysis and Polymorphic SLAF Labels Dual-index was used to identify the raw sequencing data, obtaining reads for each sample. The sequencing quality and GC content of the filtered adapter-free sequencing reads were evaluated. Using BWA software, the sequencing reads were aligned to the Zunla-1_v3.0 pepper reference genome (http: / / www.bioinformaticslab.cn / PepperBase). Reads aligned to the same position at both ends were considered to originate from the same SLAF tag. Using GATK software, polymorphism analysis was performed based on allele counts and differences in gene sequences, resulting in three types of SLAF tags: polymorphic, non-polymorphic, and repetitive. The polymorphic SLAF tag encoding the genotype aa×bb was selected for constructing the genetic map. To ensure the quality of the genetic map, the polymorphic SLAF tags were filtered according to the following rules: A. Data with a sequencing depth of less than 10X from the parents are filtered out. The offspring are then genotyped according to the parents. Only a high sequencing depth from the parents can ensure the accuracy of the offspring genotyping. B. If the number of SNPs is greater than 8, the SLAF tag sequencing length is 200 bp. If too many SNPs appear, they are considered to be high-frequency mutation regions in the sequencing. C. Completeness filtering: Select markers whose genotypes cover at least 55% of all offspring individuals. D-biased marker filtering was used to filter out polymorphic markers with severe bias (chi-square test P < 0.001). The high-quality polymorphic SLAF tags after filtering were used as SLAF markers for constructing genetic maps.

[0031] 1.3.3 Construction of high-density genetic maps and QTL mapping For the polymorphic SLAF markers obtained after filtering, the MLOD value between each pair of tags is calculated. Tags are sorted from smallest to largest MLOD value, with the highest MLOD values ​​grouped into the same linkage group. Tags with MLOD values ​​below 8 for all other SLAF tags are filtered out, and all tags are divided into 12 groups. Based on the tag's location on the chromosome, tags on chromosomes chr1-chr12 are assigned to 12 linkage groups (linkage group numbers correspond one-to-one with chromosome numbers), obtaining the final grouping results. The SLAF markers are then mapped using MSTmap software, and genotype errors or deletions are corrected using the SMOOTH algorithm. This process involves at least three steps: mapping, correction, and re-mapping. Figure 4 After one iteration, a high-quality, high-density genetic map was constructed using HighMap software. The genetic distance between adjacent markers was calculated using the Kosambi mapping function.

[0032] A high-density genetic map was constructed based on SLAF-seq technology, and QTL mapping for multiple environments was performed using Icimapping V3.3 software. Trait values ​​from two different environments were input separately, and a comprehensive analysis was conducted to locate the capsanthin content using QTL mapping.

[0033] 2. Results Analysis 2.1 A high-density genetic map was constructed based on the RILs population. Using SLAF-seq sequencing, an average of 9.18 Gbp of clean data was obtained from the parents, and the total data volume of the progeny was 332.58 Gbp. The Q30 of the sequencing data all reached over 80%. Based on... Zunla-1_v3.0 Using the reference genome information of chili pepper, a high-density, fully linked genetic map of chili pepper containing 5867 Bin markers was constructed using SLAF-seq. The total map distance was 2039.72 cM, and the average map distance was 0.35 cM. Figure 1 ).

[0034] 2.2 Capsanthin QTL Mapping Based on the capsanthin content phenotypic data of the RILs population, QTL mapping analysis was performed using Icimapping V3.3 software. The major QTL for high capsanthin content in capsanthin was located on chromosome 4, flanked by molecular markers Block4535 and Block4597, located at positions 229,410,891–236,045,305 of the reference genome, with a region size of 6.63 Mb and a contribution rate of 8.4%. Figure 2 (Table 1).

[0035] Table 1. QTL mapping results of capsanthin content Note: LOD: Maximum LOD value associated with this trait; PVE: Phenotypic contribution rate.

[0036] 2.3 Develop markers linked to hyperlycine in chili peppers Based on whole-genome resequencing data, the QTL marker Block4593 was developed into the InDel marker Cp8036. This molecular marker is located between positions 234,310,939 and 234,310,977 on chromosome 4 of the reference genome. It consists of: inserting the nucleotide sequence shown in Sequence 1 of the ordered list between the A at position 234,310,939 and the A at position 34,310,977, abbreviated as In37; or deleting the nucleotide sequence shown in Sequence 1 of the sequence list between the A at position 234,310,939 and the A at position 34,310,977, abbreviated as Del37.

[0037] Sequence 1: AAAATATTTAGTAACAACCGGCCCAAAAGGGAAGT Marker primers were designed based on the Indel marker to identify its genotype. The upstream and downstream primer sequences are shown in Table 2.

[0038] Table 2 InDel primer sequences Example 2: Verification of marker accuracy using 60 RILs lines and two parents. Further population validation was conducted using 60 RILs lines with extreme capsanthin content from Example 1 and two parent lines. Specifically, genomic DNA was first extracted from the materials, and then PCR amplification was performed using the primers listed in Table 2. The PCR system and procedure are as follows: PCR system: DNA 2 µL; 2×Phanta Max Master Mix 10 µL; Primer F 1 µL; PrimerR 1 µL; ddH2O 6 µL.

[0039] The PCR program was as follows: pre-denaturation at 95℃ for 3 min; then denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 30 s, for a total of 34 cycles.

[0040] The high capsanthin gene is a dominant gene. Among the 240 RILs population, those with capsanthin content higher than the median of 2658.3265 mg / KgDW were considered high capsanthin materials, and those with content not higher than the median of 2658.3265 mg / KgDW were considered low capsanthin materials (statistical method reference: Wu Xizhi, Statistics: From Data to Conclusions (4th Edition) [J], Chinese Statistics, 2013, (06):2). The InDel genotypes of high capsanthin materials were In37:In37 (abbreviated as a) or In37:Del 37 (abbreviated as h). The PCR product of the a genotype was a single band of 289 bp, and the PCR product of the h genotype was two bands of 289 bp and 252 bp. The InDel genotypes of low capsanthin materials were Del37:Del 37 (abbreviated as b). The PCR product of the b genotype was a single band of 252 bp. The nucleotide sequence of the 289 bp PCR product is shown in Sequence 4 of the sequence listing; the nucleotide sequence of the 252 bp PCR product is shown in Sequence 5 of the sequence listing.

[0041] Sequence 4: TGGCTATTAGAGCCCATCGTCCTTAGATGACTTGATAGTGTAATTGTTAGTATATAGAAATTAAATTACTAATTTAAGGTAAATCTAAGGTAGTAAAAGTCATTCTCTTTTTTTTAAAGATTGAACTTATATATACTGGTTGT GTAAAAATATTTATAGTAACAACCGGCCCAAAAGGGAAGTAAAATATTTATAGTAACATGTTGTAAGAGGTTACCTTGTCTCATTTTCGAGTATATTAATCTCCGTTATTGTTGGCTATTAGAACCAGTCGTCCTTTAGATGACC Sequence 5: TGGCTATTAGAGCCCATCGTCCTTAGATGACTTGATAGTGTAATTGTTAGTATATAGAAATTAAATTACTAATTTAAGGTAAATCTAAGGTAGTAAAAGTCATTCTCTTTTTTTTAAAGATTGAACTTATATATACTGGTTGTGTAAAAATATTTATAGTAACATGTTGTAAGAGGTTACCTTGTCTCATTTTCGAGTATATTAATCTCCGTTATTGTTGGCTATTAGAACCAGTCGTCCTTTAGATGACC The test results are shown in Table 3 and Figure 3 The accuracy of this marker in detecting 60 RILs lines was 88.33%. The amplified fragment of the marker Cp8036 contained 289 bp in high capsanthin lines and only 252 bp in low capsanthin lines, indicating a 37 bp fragment insertion in the high capsanthin material.

[0042] Table 3. Accuracy verification of the markers using 60 RILs materials and two parents, F1 cells. Example 3 The InDel marker Cp8036 was used to examine 59 high-generation homozygous inbred lines from natural populations to determine the accuracy of this marker in marker-assisted selection. These 59 materials are deposited in the germplasm bank of the Vegetable Research Institute, Beijing Academy of Agricultural and Forestry Sciences.

[0043] The detection method and the method for determining the marker genotype are described in Example 2. The capsanthin content and molecular validation results are shown in Table 4, and the bands of the PCR products are shown in [the table / reference needed]. Figure 4The detection accuracy was 86.44%.

[0044] Table 4. Phenotypic and molecular validation results of high / low capsanthin content in 59 natural chili pepper populations. Examples 2 and 3 use the molecular markers of the present invention to identify whether the above-mentioned natural population, RILs lines, two parents and F1 materials belong to high capsanthin varieties. The identification results show that the molecular markers of the present invention have a high accuracy rate, reaching more than 86%, and can be used for the auxiliary breeding of high capsanthin pepper varieties.

Claims

1. The use of the InDel marker Cp8036 linked to the gene controlling capsanthin content in any of the following (1) to (3): (1) Application in chili pepper breeding or assisted breeding; (2) Application in identifying or assisting in the identification of whether chili pepper materials belong to varieties with high capsanthin content; (3) Application in the preparation of reagents for identifying or assisting in the identification of whether chili pepper materials belong to high capsanthin varieties; The InDel marker Cp8036 linked to the gene controlling capsanthin content is located between positions 234,310,939 and 234,310,977 on chromosome 4 of the reference genome. The InDel marker Cp8036 is defined as follows: inserting the nucleotide sequence shown in Sequence 1 of the ordered list between the A at position 234,310,939 and the A at position 34,310,977, abbreviated as In37; or deleting the nucleotide sequence shown in Sequence 1 of the sequence list between the A at position 234,310,939 and the A at position 34,310,977, abbreviated as Del37; the reference genome is the Zunla-1_v3.0 chili reference genome. When the genotype of the InDel marker Cp8036 is In37:In37 or In37:Del37, the chili pepper material is a high capsanthin variety; when the genotype of the InDel marker Cp8036 is Del37:Del37, the chili pepper material is a low capsanthin variety.

2. The application according to claim 1, characterized in that, The high capsanthin variety is a chili pepper material with a capsanthin content higher than 2658.3265 mg / KgDW; the low capsanthin variety is a chili pepper material with a capsanthin content not higher than 2658.3265 mg / KgDW.

3. Primer combination, wherein the primer combination is used to identify the genotype of the InDel marker Cp8036 linked to the gene controlling capsanthin content. The InDel marker Cp8036 linked to the gene controlling capsanthin content is located between positions 234 310 939 and 234 310 977 on chromosome 4 of the reference genome. The InDel marker Cp8036 is: the nucleotide sequence shown in Sequence 1 of the ordered list inserted between the A at position 234 310 939 and the A at position 34 310 977, abbreviated as In37; or the nucleotide sequence shown in Sequence 1 of the ordered list inserted between the A at position 234 310 939 and the A at position 34 310 977. The nucleotide sequence shown in Sequence 1 of the 977th A deletion sequence is abbreviated as Del37; the reference genome is the Zunla-1_v3.0 pepper reference genome; the primer combination consists of an upstream primer and a downstream primer, wherein the upstream primer has the nucleotide sequence shown in Sequence 2 of the sequence listing, and the downstream primer has the nucleotide sequence shown in Sequence 3 of the sequence listing.

4. A kit comprising the primer combination of claim 3.

5. A method for identifying whether chili pepper materials belong to a high-capsaicin variety, characterized in that, Includes the following steps: S1: Extract genomic DNA from the chili pepper material to be identified; S2: Using the genomic DNA obtained in step S1 as a template, PCR amplification is performed using the primer combination described in claim 3 to obtain PCR products; S3: Identify the PCR products obtained in step S2, and then determine whether the chili pepper material belongs to a high-capsaicin variety based on the identification results; the specific determination method is as follows: If the PCR product is the nucleotide sequence shown in sequence 4 of the sequence listing, then the chili material is a high capsanthin variety. If the PCR product is the nucleotide sequence shown in sequence 5 of the sequence listing, then the chili material is a low capsanthin variety. If the PCR product has both the nucleotide sequence shown in Sequence 4 of the sequence listing and the nucleotide sequence shown in Sequence 5 of the sequence listing, then the chili material is a high capsanthin variety.

6. The method according to claim 5, characterized in that, The identification in step S3 is gel electrophoresis, and then the identification results are used to determine whether the pepper material belongs to a high capsaicin variety; the specific determination method is as follows: When the PCR product is a single band of 289 bp, the chili pepper material is a high capsanthin variety. When the PCR product is a single band of 252 bp, the chili pepper material is a low capsanthin variety. When the PCR product consists of two bands of 289 bp and 252 bp, the chili pepper material is a high-capsaicin variety.

7. The method according to claim 5, characterized in that, The high capsanthin variety is a chili pepper material with a capsanthin content higher than 2658.3265 mg / KgDW; the low capsanthin variety is a chili pepper material with a capsanthin content not higher than 2658.3265 mg / KgDW.

8. The method according to claim 5, characterized in that, The PCR amplification system consisted of: 2 μL genomic DNA, 10 μL 2×Phanta Max Master Mix, 1 μL upstream primer, 1 μL downstream primer, and 6 μL ddH2O.

9. The method according to claim 5, characterized in that, The PCR amplification procedure was as follows: pre-denaturation at 95℃ for 3 min; then denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 30 s, for a total of 34 cycles.

Images