A target gene for identifying gender of long-stalk gynostemma pentaphyllum, primer, kit, method and application

Abstract

This application relates to the field of bioengineering technology, specifically disclosing a molecular marker primer, kit, method, and application for identifying the sex of *Gynostemma pentaphyllum* plants. The molecular marker has the nucleotide sequence shown in SEQ ID NO:1. The invention also provides specific primers for amplifying this molecular marker, with sequences shown in SEQ ID NO:2 and SEQ ID NO:3. A kit containing these primers can be used for rapid molecular identification of the sex of *Gynostemma pentaphyllum*. This application enables accurate, efficient, and stable sex identification at the seedling stage, with an accuracy rate of up to 100%, which is of significant value for the targeted breeding and large-scale production of *Gynostemma pentaphyllum*.

Description

Technical Field

[0001] This application relates to the field of bioengineering technology, and in particular to a target gene (molecular marker), primers, kits, methods and applications for identifying the sex of Gynostemma pentaphyllum. Background Technology

[0002] Gynostemma longipes, a plant belonging to the genus Gynostemma in the family Cucurbitaceae, has high medicinal and nutritional value. Its active ingredients, such as gypenosides, have significant effects in anti-inflammation, anti-oxidation, and immune regulation. Due to the differences between male and female plants in the accumulation of secondary metabolites, growth and development characteristics, and cultivation methods, early and accurate sex identification is of great significance for improving production efficiency, optimizing variety selection, and managing resources in the breeding, large-scale cultivation, and resource development of Gynostemma longipes.

[0003] Current technology primarily relies on morphological observation to determine the sex of Gynostemma pentaphyllum: after the plant enters its reproductive growth stage, the morphology and structure of the flowers are observed. Male flowers are typically arranged in spikes, while female flowers are solitary or clustered. The differences in the morphology of the floral organs are used to distinguish between male and female flowers. However, this morphological observation method requires the plant to be in bloom for identification and is susceptible to environmental stress and growth status, resulting in significant fluctuations in accuracy.

[0004] Therefore, there is an urgent need in this field to develop a method that can quickly, accurately, and stably identify male and female plants in the early stages of growth of Gynostemma pentaphyllum. Summary of the Invention

[0005] The purpose of this application is to overcome the problems of existing technologies, such as dependence on growth stage, large interference from the environment, and insufficient accuracy, based on the technical solution of specific molecular markers and molecular detection, so as to meet the needs of early sex identification of Gynostemma pentaphyllum in actual breeding and production.

[0006] In a first aspect, this application provides a molecular marker for identifying the sex of Gynostemma pentaphyllum, wherein the nucleotide sequence of the molecular marker is selected from the following sequences: 1) The nucleotide sequence shown in SEQ ID NO:1; 2) The nucleotide sequence shown in SEQ ID NO:1 is derived by substitution, deletion, insertion or addition of one or more nucleotides, and retains the nucleotide sequence that can identify the sex of Gynostemma pentaphyllum. 3) Contains a nucleotide sequence that has at least 90% homology with SEQ ID NO:1 and has the function of sex identification of Gynostemma pentaphyllum.

[0007] Secondly, this application provides a primer for identifying the sex of Gynostemma pentaphyllum, wherein the primer is a primer that specifically amplifies the molecular marker described in the first aspect.

[0008] Optionally, the nucleotide sequence of the primer is as follows: Gynpe.TU.chr04.300-F: SEQ ID NO:2, Gynpe.TU.chr04.300-R: SEQ ID NO:3.

[0009] Thirdly, this application provides a kit for identifying the sex of Gynostemma pentaphyllum, the kit comprising the primers described in the second aspect.

[0010] Optionally, the kit may also include internal reference gene amplification primers.

[0011] Optionally, the internal reference gene is β-actin.

[0012] Fourthly, this application provides a method for identifying the sex of Gynostemma pentaphyllum, comprising the following steps: 1) RNA extraction from Gynostemma pentaphyllum; 2) Perform qRT-PCR using the kit described in any one of claims 4-6; 3) Calculate the relative expression levels of molecular markers; 4) Judgment: If the relative expression level of the molecular marker is ≥10, it is judged as a female *Gynostemma pentaphyllum* plant; if the relative expression level of the molecular marker is <10, it is judged as a male *Gynostemma pentaphyllum* plant.

[0013] Fifthly, this application provides the application of the molecular markers described in the first aspect, the primers described in the second aspect, the kits described in the third aspect, or the method described in the fourth aspect in identifying the sex of Gynostemma pentaphyllum.

[0014] In summary, this application includes at least one of the following beneficial technical effects: 1. High accuracy and strong specificity: The specific primers designed for the discovered sex-related molecular markers performed excellently in qPCR detection. The target gene showed obvious amplification signals in male plants (stable and reasonable Ct values), while there was almost no amplification in female plants. The difference in Ct values ​​between the two was significant, which indicates that the primer pair can specifically identify key genetic differences between male and female plants with low background noise and strong specificity. 2. The results are stable, reliable, and highly reproducible: In the verification experiment, the identification results of the long-stemmed Gynostemma pentaphyllum samples (20 male and 20 female plants) from different populations were completely consistent with the actual sex, with an accuracy rate of 100%. This fully demonstrates that the molecular markers, primers, and detection methods provided by this invention have extremely high reliability and reproducibility, and are not affected by individual differences or different sources of samples. 3. Achieves early, rapid, and efficient identification: This invention is based on DNA-level detection and can complete identification in the seedling or vegetative growth stage with only a small amount of leaf tissue, reducing the time for sex identification from several months to several hours, greatly improving the efficiency of breeding screening and cultivation management. 4. Simple operation and easy to promote and apply: The established qPCR detection method has a standardized process and objective results interpretation (based on a clear ΔCt threshold), providing a stable and convenient technical solution for the sex identification of Gynostemma pentaphyllum, and has good prospects for industrial application. Detailed Implementation

[0015] In order to gain a clearer understanding of the technical features, objectives and beneficial effects of this application, the technical solution of the present invention will now be described in detail with reference to the following specific embodiments, but this should not be construed as limiting the scope of implementation of the present invention.

[0016] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, all reagents used are commercially available or publicly available.

[0017] Sample collection information Collection locations 1-14: Shaba Village, Huaping Town, Ankang City, Shaanxi Province; Collection locations 15-22: Groundbreaking ceremony in Shaba Village, Huaping Town, Ankang City, Shaanxi Province; Collection locations 23-30: Mazhen Village, Shuping Town, Zhenping County, Ankang City, Shaanxi Province; Collection locations 31-38: Zhulinwan Village, Linhe Town, Langao County, Ankang City, Shaanxi Province; Collection locations 39-46: Zhujiawuchang, Shaba Village, Huaping Town, Ankang City, Shaanxi Province.

[0018] 1 FM-L-1 109.340159E 31.721630N 1244.11 2 FM-L-2 109.340150E 31.721634N 1245.17 3 FM-L-3 109.340155E 31.721637N 1235.11 4 ML-1 109.340154E 31.721635N 1245.22 5 ML-2 109.340152E 31.721644N 1246.23 6 ML-3 109.340153E 31.721635N 1245.11 7 Female-1 109.340153E 31.721634N 1245.1 8 Female-2 109.340163E 31.721632N 1248.22 9 Female-3 109.340155E 31.721630N 1249.14 10 Female-4 109.340161E 31.721634N 1241.35 11 Xiong-1 109.340156E 31.721633N 1233.93 12 Xiong-2 109.340143E 31.721636N 1241.21 13 Xiong-3 109.340151E 31.721635N 1245.19 14 Xiong-4 109.340153E 31.721634N 1246.85 15 Female-5 109.326453E 31.72357N 1358.15 16 Female-6 109.326464E 31.72349N 1356.12 17 Female-7 109.326463E 31.72357N 1350.14 18 Female-8 109.326464E 31.72345N 1355.24 19 Hsiung-5 109.326445E 31.72343N 1356.12 20 Hsiung-6 109.326431E 31.72355N 1355.14 21 Hsiung-7 109.326464E 31.72361N 1359.22 22 Hsiung-8 109.326466E 31.72352N 1351.93 23 Female-9 109.414414E 31.78273N 1233.16 24 Female-10 109.414415E 31.78263N 1235.29 25 Female-11 109.414411E 31.78256N 1236.17 26 Female-12 109.414421E 31.78263N 1232.18 27 Hsiung-9 109.414431E 31.78278N 1222.85 28 Hsiung-10 109.414424E 31.78263N 1232.61 29 Hsiung-11 109.414434E 31.78276N 1223.81 30 Hsiung-12 109.414427E 31.78272N 1225.17 31 Female-13 109.003166′E 32.347781N 1100.28 32 Female-14 109.003177′E 32.347783N 1118.88 33 Female-15 109.003168′E 32.347771N 1105.26 34 Female-16 109.003166′E 32.347779N 1107.93 35 Hsiung-13 109.003165′E 32.347782N 1125.43 36 Xiong-14 109.003166′E 32.347779N 1102.55 37 Hsiung-15 109.003154′E 32.347782N 1101.38 38 Hsiung-16 109.003162′E 32.347781N 1105.66 39 Female-17 109.318753E 31.725195N 1458.11 40 Female-18 109.318755E 31.725199N 1456.33 41 Female-19 109.318743E 31.725194N 1459.35 42 Female-20 109.318748E 31.725195N 1466.46 43 Hsiung-17 109.318752E 31.725189N 1461.15 44 Hsiung-18 109.318751E 31.725194N 1454.21 45 Hsiung-19 109.318755E 31.725196N 1455.45 46 Hsiung-20 109.318753E 31.72515N 1454.12

[0019] Example 1: Differential Gene Screening 1. Sample collection: Healthy plants of Gynostemma pentaphyllum with long stalks were selected. Leaf tissue was collected during the growth period, with a weight of 0.1-0.2g. Three biological replicates were collected from each of the male and female plants, numbered FM-L-1, FM-L-2, FM-L-3, ML-1, ML-2, and ML-3.

[0020] 2. RNA Extraction and Library Construction: Total RNA was extracted using the "Tissue RNA Extraction Kit 2.0 Plus" (Novizan, R411-C3) according to the manufacturer's instructions; mRNA was captured using VAHTS mRNA Capture Beads 2.0 (Novizan, N403-C4); the library was constructed using the VAHTS Universal V10 RNA-seqLibrary Prep Kit (Premixed version) (Novizan, NR616-02) from Nanjing Novizan Biotechnology Co., Ltd.; the ligation products were purified using VAHTS DNA Clean Beads (Novizan, N411-03), and the library concentration was detected using the Equalbit 1 x dsDNA HS Assay Kit (Novizan, EQ121-02).

[0021] 3. Differential Gene Screening: Transcriptome sequencing of male and female *Gynostemma pentaphyllum* plants was performed using the Illumina NovaSeq 6000 platform, yielding 139.75 Gb of clean data with a Q30 ≥ 95%. The genome was aligned to the reference genome using HISAT2 (alignment rate ≥ 76%). Differential genes were then screened using DESeq2 software (padj < 0.05 and |log2FC| ≥ 2 were used as screening parameters). The statistical list of differentially expressed genes is shown in Table 1.

[0022] Table 1 M-L_vs_FM-L 1457 432 1025

[0023] 4. Quantitative validation of different differentially expressed genes by qRT-PCR Primers were designed using NCBI Primer-BLAST, and the primer information is shown in Table 2. qRT-PCR was performed using a kit (ToloScript RT EasyMix for qPCR; 2 × Q3 SYBR qPCR Master Mix (Universal)). The PCR reaction volume was 10 μl, specifically: 5 μl 2×Pro TaqMasterMix, 1 μl 30 ng / μl DNA, 0.4 μl 10 μM positive and negative primers, and ddH2O added to complete the mixture. PCR amplification conditions were: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 62℃ annealing for 15 s, 72℃ extension for 30 s, 30–35 cycles followed by a final extension at 72℃ for 5 min. The relative expression level of the target gene was calculated, using β-actin as an internal reference gene for correction. The specific calculation steps were: ΔCt (performed for each sample), ΔCt = Ct(target gene) - Ct(internal reference gene).

[0024] Table 2 Gynpe.TU.chr03.392 CTGGGATTCTCATGGTCATG GTGACTCCATTCATCAGGTC Gynpe.TU.chr04.300 TGCAACCAATTTTCTGGGAGG AAGGAAAACCAAGTGCCATGC Gynpe.TU.chr01.740 CCCATGAGGGAGAAAAGCAT TTCTTTTTTTGGCGCCCGTC Gynpe.TU.chr07.234 ACCACATATGTTCACCATTCATGG CTTGATACGGCGTTTGTTGTC Gynpe.TU.chr07.1312 CCCAGAACATCACTGACTCA GATTTTGGGGGCAAGTTAGTC novel.2651 TCCTTCCTTATGTGCACAAGG GTGAAGGTCCAAATGAGTGTG novel.2969 ATGAGTCCTTCTGAGACTGATG TGCCTCAATAGACAAGAGTGC novel.5014 CCTATGCCCTTTATGTAGCTG TGGATAGTAAGACCCTGATGG novel.4667 TATCAACGACGTACTGCTGC ACCATACCAGCATAAGTGCTTC novel. 1918 GAAGCTTCCGAGAGTTGAAC ACACATCCACCCATGTAGTTTC β-actin CTCCTCTCAATCCTAAAGCC GGCATACAAAGATAGAACGG

[0025] The results are shown in Table 3. The Ct difference of the target gene Gynpe.TU.chr04.300 is relatively obvious, with significant amplification in male plants and almost no amplification in female plants; and the difference in ΔCt between male and female plants for this gene is significantly better than that for other target genes.

[0026] Table 3 Gynpe.TU.chr03.392 25.11 7.35 31.36 12.95 Gynpe.TU.chr04.300 24.72 6.96 40.00 21.59 Gynpe.TU.chr01.740 34.62 16.86 34.18 15.77 Gynpe.TU.chr07.234 23.02 5.26 32.98 14.57 novel.4667 26.81 9.05 34.39 15.98 Gynpe.TU.chr07.1312 34.55 16.79 37.65 19.24 novel.2651 25.72 7.96 30.88 12.47 novel.2969 22.93 5.17 26.40 7.99 novel.5014 31.42 13.66 34.74 16.33 novel. 1918 24.10 6.34 28.36 9.95 β-actin 17.76 / 18.41 /

[0027] Example 2 Accuracy Verification Twenty male and twenty female *Gynostemma pentaphyllum* plants were selected and qRT-PCR of the target gene *Gynpe.TU.chr04.300* was performed using the same method as in Example 1. The sex was determined by the relative expression level (ΔCt) (ΔCt = Ct(Gynpe.TU.chr04.300) - Ct(β-actin)). The determination criteria were: a relative expression level (ΔCt) ≥ 10 indicated a female plant, and a relative expression level (ΔCt) < 10 indicated a male plant. The relative expression levels of the twenty male and twenty female *Gynostemma pentaphyllum* plants are shown in Table 4. All the above results are consistent with actual results, indicating that the *Gynpe.TU.chr04.300* primers of this invention can accurately identify the sex of *Gynostemma pentaphyllum* plants from different populations with an accuracy rate of 100%.

[0028] Table 4 Female-1 38.7 17.71 20.99 Xiong-1 23.85 17.79 6.06 Female-2 40 20.62 19.38 Xiong-2 24.76 18.47 6.29 Female-3 40 19.76 20.24 Xiong-3 25.02 17.77 7.25 Female-4 35.34 20.24 15.1 Xiong-4 27.1 19.91 7.19 Female-5 40 19.66 20.34 Hsiung-5 25.42 18.7 6.72 Female-6 40 20.23 19.77 Hsiung-6 22.92 18.32 4.6 Female-7 40 20.63 19.37 Hsiung-7 22.45 18.66 3.79 Female-8 40 20.84 19.16 Hsiung-8 23.37 19.18 4.19 Female-9 40 19.79 20.21 Hsiung-9 24.2 17.58 6.62 Female-10 38.07 20.97 17.1 male-10 23.87 18.8 5.07 female-11 40 18.21 21.79 male-11 23.65 19.15 4.5 female-12 34.19 20.31 13.88 male-12 25.79 19.79 6 female-13 40 18.63 21.37 male-13 22.24 17.89 4.35 female-14 38.77 18.31 20.46 male-14 24.53 19.02 5.51 female-15 40 24.36 15.64 male-15 25.25 19.54 5.71 female-16 40 19.36 20.64 male-16 22.89 18.65 4.24 female-17 35.92 19.12 16.8 male-17 27.72 22.78 4.94 female-18 36.7 18.81 17.89 male-18 24.94 18.95 5.99 female-19 34.98 18.67 16.31 male-19 27.68 19.07 8.61 female-20 40 18.4 21.6 male-20 26.24 17.5 8.74 sequence list Gynpe.TU.chr04.300 SEQ ID NO:1 Gynpe.TU.chr04.300-F SEQ ID NO:2 TGCAACCAATTTTCTGGGAGG Gynpe.TU.chr04.300-R SEQ ID NO:3 AAGGAAAACCAAGTGCCATGC Of course, the above description is only a specific embodiment of this application and is not intended to limit the scope of the invention. All equivalent changes or modifications made in accordance with the features and principles described in the claims of this invention should be included in the scope of the claims of this invention.

Claims

1. A molecular marker for identifying the gender of Gynostemma pentaphyllum, characterized in that, The nucleotide sequence of the molecular marker is selected from the following sequences: 1) The nucleotide sequence shown in SEQ ID NO:1; 2) The nucleotide sequence shown in SEQ ID NO:1 is derived by substitution, deletion, insertion or addition of one or more nucleotides, and retains the nucleotide sequence that can identify the sex of Gynostemma pentaphyllum. 3) Contains a nucleotide sequence that has at least 90% homology with SEQ ID NO:1 and has the function of sex identification of Gynostemma pentaphyllum.

2. A primer for identifying the gender of G. elliottii, characterized by, The primers are primers that specifically amplify the molecular marker described in claim 1.

3. The primer of claim 2, wherein, The nucleotide sequence of the primer is as follows: Gynpe.TU.chr04.300-F: SEQ ID NO:2, Gynpe.TU.chr04.300-R: SEQ ID NO:

3.

4. A kit for identifying the gender of G. elliottii, characterized by, The kit contains the primers as described in claim 2 or 3.

5. The reagent kit according to claim 4, characterized in that, The kit also includes primers for amplifying the internal reference gene.

6. The reagent kit according to claim 5, characterized in that, The internal reference gene is β-actin.

7. A method for identifying the sex of Gynostemma pentaphyllum with long stalks, characterized in that, Includes the following steps: 1) RNA extraction from Gynostemma pentaphyllum; 2) Perform qRT-PCR using the kit described in any one of claims 4-6; 3) Calculate the relative expression levels of molecular markers; 4) Judgment: If the relative expression level of the molecular marker is ≥10, it is judged as a female *Gynostemma pentaphyllum* plant; if the relative expression level of the molecular marker is <10, it is judged as a male *Gynostemma pentaphyllum* plant.

8. The use of the molecular marker of claim 1, the primer of claim 2 or 3, the kit of any one of claims 4-6, or the method of claim 7 in identifying the sex of Gynostemma pentaphyllum.