A probe composition and its use in detecting pseudomonas aeruginosa

By combining magnetic nanoprobes with metal-organic framework probes, the problems of cumbersome operation and insufficient sensitivity in detecting Pseudomonas aeruginosa have been solved, enabling rapid and accurate on-site detection and quantitative analysis.

CN122487307APending Publication Date: 2026-07-31GUANGDONG OCEAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUANGDONG OCEAN UNIVERSITY
Filing Date
2026-05-14
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

Existing technologies for detecting Pseudomonas aeruginosa suffer from problems such as cumbersome operation, long detection cycle, insufficient sensitivity, and poor on-site applicability, making it difficult to meet the needs for rapid and accurate detection.

Method used

By employing a combination of magnetic nanoprobes and metal-organic framework probes, target genes are enriched using magnetic nanoprobes and combined with metal-organic framework materials as a fluorescence quenching platform, enabling rapid separation of nucleic acids and transduction of fluorescence signals, thus constructing an integrated separation-transduction-detection platform.

Benefits of technology

It achieves highly sensitive, highly specific and rapid detection of Pseudomonas aeruginosa, suitable for on-site detection and quantitative analysis, and simplifies the operation process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses a probe composition and its application in the detection of *Pseudomonas aeruginosa*, belonging to the field of biodetection technology. The probe composition comprises a magnetic nanoprobe and a metal-organic framework (MOF) probe. The magnetic nanoprobe is a covalently bound magnetic bead to an amino-based antibiotic. The MOF probe is prepared from fluorescent hairpin probes and MOF materials, wherein the MOF material is a coordination polymer modified with an amino-containing polymer. This probe composition integrates the enrichment, separation, recognition, and detection of *P. aeruginosa* nucleic acid, effectively overcoming the shortcomings of traditional methods such as long processing time, insufficient sensitivity, and poor on-site applicability, achieving highly sensitive, highly specific, and rapid detection of *P. aeruginosa*.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, and in particular relates to a probe composition and its application in the detection of Pseudomonas aeruginosa. Background Technology

[0002] Pseudomonas aeruginosa is a widely distributed opportunistic pathogen found in water, soil, and food environments, commonly present in ready-to-eat foods, dairy products, aquatic products, and fresh agricultural products. This bacterium can not only cause food spoilage but also potentially trigger foodborne illnesses by producing exotoxins, proteases, and other virulence factors, posing a serious health threat to immunocompromised populations. While the national standard GB 29921-2013 does not explicitly define limits for Pseudomonas aeruginosa, its potential hazards in certain high-risk ready-to-eat foods have attracted widespread attention.

[0003] Traditional detection methods primarily rely on selective culture, biochemical identification, and enrichment isolation techniques, such as using cetyltrimethylammonium bromide agar (CTA) or cephalosporin-fusidic acid-cetyltrimethylammonium bromide agar (CFC) media combined with oxidase assays for identification. However, while these methods offer high specificity, they are cumbersome to operate, typically requiring over 48 hours for detection, and are susceptible to interference from coexisting microorganisms, making them unsuitable for rapid and accurate detection. Although polymerase chain reaction (PCR) molecular detection technology has improved in sensitivity and specificity, it still relies on expensive instruments and specialized operation, limiting its application in on-site testing.

[0004] With the increasing demand for rapid response and high-throughput screening in food safety supervision, the development of highly sensitive, highly specific, and field-suitable nucleic acid detection technologies has become an urgent need. In recent years, isothermal amplification technology has attracted attention due to its advantages such as not requiring thermal cycling equipment and rapid reaction; however, its combination with efficient signal recognition systems still faces challenges. Furthermore, existing fluorescence detection systems often suffer from low quenching efficiency, high background signal, and poor probe stability, affecting detection accuracy.

[0005] Therefore, there is an urgent need to establish a novel detection method that integrates nucleic acid enrichment, efficient amplification, and sensitive fluorescence recognition to achieve rapid, accurate, and on-site detection of Pseudomonas aeruginosa. Summary of the Invention

[0006] Based on the shortcomings of existing technologies, this invention aims to at least solve one of the aforementioned technical problems. This invention provides a probe composition and its application in the detection of *Pseudomonas aeruginosa*. The probe composition comprises a magnetic nanoprobe for enriching and separating *P. aeruginosa* nucleic acid, and a metal-organic framework probe for recognizing *P. aeruginosa* nucleic acid and detecting a fluorescence signal dependent on the concentration of that nucleic acid. This effectively overcomes the shortcomings of traditional methods, such as long processing time, insufficient sensitivity, and poor field applicability. It provides technical support for high-throughput screening and real-time monitoring of *P. aeruginosa* in food, environmental, and clinical samples, achieving highly sensitive, highly specific, and rapid detection of *P. aeruginosa*.

[0007] The first objective of this invention is to provide a probe composition comprising a magnetic nanoprobe and a metal-organic framework probe, wherein the magnetic nanoprobe is a covalently bound magnetic bead to an amino-based antibiotic.

[0008] The raw materials for preparing the metal-organic framework probe include fluorescent hairpin probes and metal-organic framework materials, wherein the metal-organic framework material is a coordination polymer modified with an amino group.

[0009] In some embodiments of the present invention, the magnetic beads are epoxy-modified magnetic beads. The epoxy groups are derived from epoxy-silane coupling agents, such as 3-glycidoxypropyltrimethoxysilane and 3-glycidoxypropyltriethoxysilane. By selecting epoxy-modified magnetic beads, the present invention can easily achieve covalent bonding with amino antibiotics; specifically, the epoxy group and the amino group are bonded via a ring-opening covalent bond forming CN.

[0010] In some embodiments of the present invention, the average particle size of the magnetic beads is 60~150 nm.

[0011] In some embodiments of the present invention, the magnetic beads are selected from silicon dioxide magnetic beads.

[0012] In some embodiments of the present invention, the amino-based antibiotic is selected from at least one of kanamycin, gentamicin, amikacin, tobramycin, and streptomycin.

[0013] In some embodiments of the present invention, the amino-containing polymer is selected from polyethyleneimine.

[0014] In some embodiments of the present invention, the coordination polymer is formed by a trivalent transition metal ion and a terephthalic acid ligand, for example, MIL-101.

[0015] In this invention, the amino-containing polymer and the coordinating polymer have electrostatic attraction, hydrogen bonding, and / or coordination interaction. The metal-organic framework material formed serves as a fluorescence quenching platform. When combined with a fluorescent hairpin probe, it can detect Pseudomonas aeruginosa by means of changes in fluorescence signal.

[0016] In some embodiments of the present invention, the fluorescent hairpin probe is PA7-HP, and its nucleotide sequence is: 5'-CGGCCCTTATCGCGTTACGTGCGCCACTAAGATCTCAACGCGATAAGGGCCG-3'.

[0017] A second objective of this invention is to provide a method for preparing the above-mentioned probe composition, comprising the following steps:

[0018] S1. The magnetic beads are mixed with the amino-based antibiotic and reacted, followed by post-processing to obtain the magnetic nanoprobe;

[0019] S2. The coordination polymer is mixed with the fluorescent hairpin probe and reacted to obtain the metal-organic framework probe.

[0020] A third objective of this invention is to provide the application of the above-described probe composition in the detection of Pseudomonas aeruginosa. Specifically, it can be used to detect Pseudomonas aeruginosa in aquatic products such as fish, shrimp, and shellfish.

[0021] In some embodiments of the present invention, the magnetic nanoprobe is used to enrich and separate Pseudomonas aeruginosa nucleic acid.

[0022] In some embodiments of the present invention, the metal-organic framework probe is used to identify Pseudomonas aeruginosa nucleic acid and detect a fluorescence signal dependent on the concentration of that nucleic acid.

[0023] The basic principle of the above probe composition for detecting Pseudomonas aeruginosa is as follows:

[0024] First, target genes are enriched using magnetic nanoprobes, and rapid separation of nucleic acids from impurities is achieved under an applied magnetic field. Then, a coordination polymer (metal-organic framework) modified with amino groups is introduced as a fluorescence quenching platform, on which a fluorescent hairpin probe is loaded. When the target nucleic acid is present, it specifically binds to the fluorescent hairpin probe, causing the hairpin structure formed by the metal-organic framework and the probe to open, displacing the fluorescent group from the surface of the coordination polymer, thus restoring the fluorescence signal of the probe. This process achieves signal transduction from "recognition" to "energy conversion" through the metal-organic framework. Finally, quantitative analysis of the target is achieved by detecting fluorescence intensity. The entire method of this invention integrates the separation and enrichment capabilities of magnetic nanomaterials with the fluorescence modulation characteristics of coordination polymers, constructing an integrated rapid nucleic acid detection platform encompassing "separation-transduction-detection."

[0025] A fourth objective of this invention is to provide a method for detecting Pseudomonas aeruginosa, comprising the following steps:

[0026] SS1. Nucleic acid extraction: The sample solution to be tested is mixed with lysozyme and the magnetic nanoprobe in the above probe composition, shaken and incubated, magnetic separation is performed by applying an external magnetic field, the supernatant is discarded, and then washed and eluted to obtain the DNA template of the sample to be tested;

[0027] SS2. Isothermal amplification: The fluorescent hairpin probe, the raw material for preparing the metal-organic framework probe in the above probe composition, the DNA template of the sample to be tested obtained in step SS1, the primers of Pseudomonas aeruginosa, the nucleotide raw material, and the DNA polymerase are mixed and incubated to obtain the isothermal amplification solution.

[0028] SS3. Fluorescence detection: The isothermal amplification solution obtained in step SS2 and the metal-organic framework material used to prepare the metal-organic framework probe in the above probe composition are mixed, reacted, and then fluorescence detection is performed.

[0029] In some embodiments of the present invention, the primer for Pseudomonas aeruginosa in step SS2 is PA7-P5, and its nucleotide sequence is: 5'-CGGCCCT-3'.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] In this invention, the metal-organic framework material exhibits highly efficient quenching of fluorescent hairpin probes with low background signal.

[0032] When the probe composition of the present invention is used to detect Pseudomonas aeruginosa, it combines magnetic enrichment and isothermal amplification to achieve integrated detection of "sample in - result out".

[0033] The detection method of the present invention has high sensitivity, strong specificity, and simple operation, and is suitable for rapid on-site detection and quantitative detection. Attached Figure Description

[0034] Figure 1 The images are scanning electron microscope (SEM) images of MNPs (A1-A3) and the obtained Kan@MNPs (B1-B3) in Example 1 of the present invention.

[0035] Figure 2 This is an electrophoresis diagram showing the enrichment efficiency of Kan@MNPs against Pseudomonas aeruginosa nucleic acid obtained in Example 1 of this invention.

[0036] Figure 3 The images show transmission electron microscopy (TEM) image (A) of PEI@MIL-101 in Example 2 of this invention and fluorescence emission images (B) of different systems.

[0037] Figure 4 This is an agarose gel electrophoresis image of the isothermal amplification product obtained in Example 3 of the present invention;

[0038] Figure 5 This is a calibration curve of the logarithm of the concentration of Pseudomonas aeruginosa and the change in voltage value ΔmV, which is the basis of this invention. Detailed Implementation

[0039] To enable those skilled in the art to better understand the technical solutions of this invention, the technical solutions of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this invention.

[0040] Unless otherwise specified, all materials and reagents used are commercially available.

[0041] Example 1

[0042] This embodiment provides magnetic nanoprobes Kan@MNPs, and the specific steps are as follows:

[0043] S1. Preparation of magnetic beads: After the silica magnetic beads with an average particle size of 100 nm are shaken and mixed evenly, 1 mL of 50 mg / mL silanol-coated magnetic beads (MNPs) is added to a 2 mL centrifuge tube. After magnetic separation of the supernatant, 1 mL of PBS is added for washing. After mixing, the supernatant is removed by magnetic separation using a magnetic rack. The washing process is repeated 3 times.

[0044] S2. Coupling: Add 1 mL of piranha solution (H2SO4 / H2O2=3:1) to the above centrifuge tube, treat at 70℃ for 10 min, wash, add 1 mL of 1% 3-glycidoxypropyltrimethoxysilane, react at 25℃ for 2 h, wash again, add different concentrations of amino antibiotics and react for 16 h, after the reaction is completed, remove the supernatant by magnetic separation;

[0045] S3. Washing: Add 1 mL of washing buffer and mix and resuspend for 1 min. Then remove the supernatant by magnetic separation. Repeat this washing process 3 times to obtain magnetic nanoprobes Kan@MNPs.

[0046] The prepared magnetic nanoprobes Kan@MNPs were suspended in 1 mL of PBS buffer (pH 7.5) and stored at 4 ºC for later use.

[0047] On the one hand, scanning electron microscopy analysis was performed on the MNPs in Example 1 and the obtained Kan@MNPs, and the results are as follows: Figure 1 As shown, A1~A3 are scanning electron microscope (SEM) images of MNPs at different magnifications, and B1~B3 are SEM images of Kan@MNPs at different magnifications. Figure 1 It can be seen that the average particle size of the Kan@MNPs obtained in Example 1 is generally larger than that of its raw material MNPs, and the overall particle size is relatively uniform.

[0048] On the other hand, the Kan@MNPs obtained in Example 1 were used for nucleic acid extraction from Pseudomonas aeruginosa, and PCR amplification and enrichment efficiency were verified by electrophoresis. The specific steps are as follows:

[0049] S1. Nucleic acid extraction from Pseudomonas aeruginosa:

[0050] Take 1 mL of freshly cultured bacterial suspension, centrifuge at 8000 rpm for 5 min to collect the bacterial pellet; add lysozyme to a final concentration of 10 mg / mL and 4 μL of 50 mg / mL Kan@MNPs obtained in Example 1, and incubate with shaking for 20 min to induce bacterial lysis and release of DNA, while Kan@MNPs adsorb DNA. Perform magnetic separation under an external magnetic field, discard the supernatant, and wash the particulate DNA complex three times with a specific washing buffer (1.6 mol / L guanidine hydrochloride, 100 mmol / L Tris-HCl, 75% ethanol (v / v)). Elute the DNA with 0.5% NH3·H2O.

[0051] S2. PCR amplification of Pseudomonas aeruginosa nucleic acid:

[0052] The Pseudomonas aeruginosa nucleic acid extracted from Kan@MNPs obtained in step S1 was serially diluted 10-fold to obtain 10 nucleic acid samples. 1 ~10 7 CFU / mL was used to amplify nucleic acids at different concentrations using PCR. A complete PCR system (25 μL) consisted of: 12 μL sterile water, 10 μL PCR Mix, 1 μL Pseudomonas aeruginosa genome release solution, 1 μL of 10 μM 27F (SEQ: AGAGTTTGATCCTGGCTCAG) as a front primer, and 1 μL of 10 μM reverse complementary specific sequence fragment as a back primer. The PCR program was set to high-temperature pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 45 s; annealing at 55 °C for 30 s; and extension at 72 °C for 90 s, for a total of 35 cycles. The amplified products were then stored at 4 °C for 10 min after the final extension at 72 °C.

[0053] S3. Electrophoretic verification of Pseudomonas aeruginosa nucleic acid enrichment efficiency:

[0054] Gel preparation: Dissolve 1 g of agarose in 99 mL of 1×TAE water, microwave to melt, and remove and shake to defoam once boiling. Repeat 2-3 times. Allow the solution to cool slightly at room temperature, then add 10 μL of gel-red dye and vortex horizontally to mix. Pour the mixture into a mold from one end, place a comb on top, allow it to solidify, remove the comb, place the gel in a spirit level, and submerge the gel in 1×TAE water. Sample loading: Add 10 μL of the novel, suitable, non-toxic DNA Marker dye (100-5000 bp) to the first well, and add 10 μL of sample (2 μL of 6×DNA loading buffer + 10 μL of amplified Pseudomonas aeruginosa nucleic acid DNA obtained from L2) to the other wells. Program settings: After sample loading, cap the gel, set the voltage to 110 V, the current to 330 mA, and the time to 60 min. Imaging: After electrophoresis, place the gel in a gel imaging machine for nucleic acid imaging. The results are shown below. Figure 2 As shown.

[0055] Depend on Figure 2 It can be seen that the Kan@MNPs obtained in Example 1 of the present invention can achieve the enrichment and separation of Pseudomonas aeruginosa nucleic acid, and the enriched and separated Pseudomonas aeruginosa nucleic acid has good amplification specificity.

[0056] Example 2

[0057] This example demonstrates how to provide a metal-organic framework probe PEI@MIL-101@FAM-HP. The specific steps are as follows:

[0058] S1.MIL-101 Post-modification:

[0059] 10 mg of coordination polymer MIL-101 was suspended in 1 mL of 10 wt% polyethyleneimine aqueous solution. The mixture was shaken at 25 °C for 20 h. After the reaction, it was washed with deionized water to obtain the metal-organic framework material PEI@MIL-101. Furthermore, it was centrifuged at 10000 rpm for 8 min, resuspended in 1×PBS buffer, and stored at 4 °C for subsequent experiments.

[0060] S2. Design and modification of the FAM-HP probe:

[0061] The length, secondary structure, and GC ratio of sequence fragments can affect hybridization efficiency. The *Pseudomonas aeruginosa*-specific targets validated in the paper "Screening of Detection Targets and Sensor Construction for *Streptococcus pneumoniae* and *Pseudomonas aeruginosa*" were imported into Nupack software. Using its secondary structure simulation function, the structure of the sequence fragments was simulated to verify hybridization. Generally, sequence fragments meeting the following requirements have better hybridization: (1) the length of the sequence fragment is between 15-31 nt; (2) the GC content is 40%-60%; (3) when the secondary structure is stable, the bases at the stem are ≤6 nt, or the sequence exists alone without secondary structure, i.e., it is best not to form hairpins or stable hairpin structures. Specifically, open Nupack software, click Primer, input the specific sequence, select Self-complementarity from the Primer drop-down menu, and the most stable secondary structure of the sequence will be output. Sequence fragments meeting these conditions are more likely to hybridize, while ensuring the specificity of the hybridization.

[0062] Reversibility treatment: The hairpin probe PA7-HP (5'-CGGCCCTTATCGCGTTACGTGCGCCACTAAGATCTCAACGCGATAAGGGCCG-3') was annealed: heated at 88 ℃ for 15 min, and then rapidly cooled at 4 ℃ to obtain the fluorescent hairpin probe FAM-HP.

[0063] S3.PEI@MIL-101@FAM-HP Fixation:

[0064] Add 400 μL of 1×PBS buffer containing 0.4 mg / mL of PEI@MIL-101 obtained in step S1 to 400 μL of 40 nmol / L FAM-HP obtained in step S2, and incubate at 25 °C for 30 min to obtain the metal-organic framework probe PEI@MIL-101@FAM-HP.

[0065] Scanning electron microscopy analysis was performed on the PEI@MIL-101 obtained in step S1. Fluorescence analysis was performed on the FAM-HP obtained in step S3 before adding the PEI@MIL-101 obtained in step S1 and the PEI@MIL-101@FAM-HP obtained after incubation with the PEI@MIL-101 obtained in step S1. The results are as follows. Figure 3 As shown. By Figure 3 As can be seen from the scanning electron microscope images, the PEI@MIL-101 obtained in step S1 of Example 2 of the present invention has a relatively uniform structure; Figure 3 As can be seen from the fluorescence emission diagram, the fluorescent hairpin probe FAM-HP has strong fluorescence emission before binding to PEI@MIL-101, while the fluorescence intensity decreases significantly after binding to PEI@MIL-101.

[0066] In addition, following step S3 above, a conjugate MIL-101@FAM-HP, consisting of the coordination polymer solution MIL-101 and the fluorescent hairpin probe FAM-HP, was prepared and subjected to fluorescence analysis. The results are as follows: Figure 3 As shown. By Figure 3 It can be seen that MIL-101@FAM-HP is less effective at reducing fluorescence than PEI@MIL-101@FAM-HP. In other words, the metal-organic framework probe PEI@MIL-101@FAM-HP obtained in this invention has a more efficient fluorescence quenching effect and higher detection sensitivity.

[0067] Example 3

[0068] This example provides an isothermal strand substitution amplification (SDA) method based on the Klenow fragment, with the following specific steps:

[0069] In sterile microcentrifuge tubes, selectively add the following reaction components to prepare an amplification reaction system with a total volume of 50 μL:

[0070] Hairpin probe PA7-HP: Add 10 μL of PA7-HP at a concentration of 1.5 μmol / L;

[0071] Target probe PA7: Add 10 μL of target probe PA7 with a concentration of 1.5 μmol / L. Its nucleotide sequence is: 5'-GAGATCTTAGTGGCGCACGTAACGCGATAAG-3';

[0072] Primer PA7-P5: Add 10 μL of primer PA7-P5 at a concentration of 5.0 μmol / L. Its nucleotide sequence is: 5'-CGGCCCT-3'.

[0073] dNTP mixture: Add 10 μL of a 500 μmol / L deoxyribonucleoside triphosphate (dNTPs) mixture as the amplification substrate;

[0074] Klenow polymerase: Finally, add 10 μL of Klenow fragment (KF exo-) at a concentration of 500 U / mL.

[0075] After sealing the reaction tube containing the above components, place it on a vortex shaker for vortex oscillation to ensure that the reaction liquid inside the tube is fully mixed and homogeneous. Centrifuge at low speed for 3 seconds to cause the liquid adhering to the inner wall of the reaction tube to completely settle to the bottom of the tube.

[0076] The thoroughly mixed reaction tubes were placed in a thermostat, and the incubation temperature was set to 37 °C for 1 h. During this reaction, the KF exo- molecules underwent chain extension and isothermal amplification using a mixture of dNTPs, guided by primers and target probes.

[0077] After incubation, the required isothermal amplification product can be obtained and used for subsequent detection or analysis.

[0078] The isothermal amplification products described above are then verified by vertical electrophoresis:

[0079] Prepare the casting mold: Use a Bole mold. For better results, you can choose a mold that can pour larger TBEPAGE gel. Before casting, the casting mold must be thoroughly cleaned, and special attention should be paid to ensure that there is no SDS residue.

[0080] Preparation of gel polymerization catalyst: Weigh 0.1 g ammonium persulfate (APS), dissolve in distilled water, and bring the volume to 1 mL to prepare 10% ammonium persulfate, which is the gel catalyst. Prepare a 15% PAGE gel by mixing 25 mL of 30% Acr-Bis (29:1), 10 mL of 5×TBE electrophoresis buffer, 15 mL of ultrapure water, 25 μL of tetramethylethylenediamine (TEMED), and 250 μL of APS. Pour the gel solution into the gel casting mold, insert a comb to form sample wells, and allow the gel to cool and solidify. Carefully remove the comb and place the gel into the electrophoresis tank. Add 1×TBE electrophoresis buffer to the electrophoresis tank, ensuring the buffer covers the gel by 1 mm. Use a micropipette to mix 4 μL of loading butter buffer with 20 μL of sample (the above isothermal amplification product) thoroughly by pipetting, and slowly inject 20 μL of the mixed sample into the sample wells. Leave one well open for sample addition and add a standard reference DNA marker (100-2000 bp). Turn on the power, set the voltage to 70 V, the current to 330 mA, and the time to 60 min. When the indicator front migrates close to the edge of the gel, stop electrophoresis and place the gel into a gel imaging machine for nucleic acid imaging. The results are shown below. Figure 4 As shown.

[0081] Depend on Figure 4 It is known that the amplification reaction system with the simultaneous addition of hairpin probe PA7-HP, target probe PA7, primer PA7-P5, dNTP mixture, and Klenow polymerase has excellent amplification effect, which is beneficial to the amplification of subsequent fluorescence detection signals. Therefore, the amplification reaction system including the above components was determined as the amplification reaction system for subsequent experiments.

[0082] Example 4

[0083] This embodiment provides a probe composition consisting of the magnetic nanoprobe Kan@MNPs obtained in Example 1 and the metal-organic framework probe PEI@MIL-101@FAM-HP obtained in Example 2, and its application in the detection of Pseudomonas aeruginosa. The specific process is as follows:

[0084] S1. Preprocessing:

[0085] Using sterile tools (sterile bags, sterile forceps, sterile sampling spoons), samples were taken from representative sites (such as fish gills, internal organs, body surface, shrimp meat, shellfish meat, etc.). Under sterile conditions, 25.00 g of sample was weighed and added to a homogenizing bag containing 225 mL of 0.85% sterile physiological saline. The sample was then thoroughly homogenized using a beater to prepare a 1:10 sample homogenate.

[0086] In the preliminary experiment, roughly observe the dilution concentration of the bacterial solution, take 100 µL of sample solution and 100 µL of bacterial solution and plate them separately, and calculate the total number of colonies.

[0087] S2. Nucleic acid extraction:

[0088] Take 1 mL of the sample homogenate obtained in step S1, centrifuge at 8000 rpm for 5 min to collect the bacterial pellet. Add lysozyme to a final concentration of 10 mg / mL and 4 μL of the 50 mg / mL magnetic nanoprobe Kan@MNPs obtained in Example 1, and incubate with shaking for 20 min to induce bacterial lysis and release of DNA, while Kan@MNPs adsorb DNA. Perform magnetic separation under an external magnetic field and discard the supernatant. Wash the particulate DNA complex three times with a specific washing buffer (1.6 mol / L guanidine hydrochloride, 100 mmol / L Tris-HCl, 75% ethanol (v / v)). Elute the DNA with 0.5% NH3·H2O to obtain the DNA template of the sample to be tested.

[0089] S3. Isothermal amplification:

[0090] Before use, the fluorescent hairpin probe PA7-HP was annealed in ultrapure water at a concentration of 10 μmol / L. The specific steps were: first, heating at 88 °C for 15 min, followed by rapid cooling at 4 °C. 20 μL of the annealed hairpin probe PA7-HP (1.5 μmol / L), 20 μL of the DNA template from the sample obtained in step S2 (1.5 μmol / L), 20 μL of primer PA7-P5 (5.0 μmol / L), 20 μL of dNTP mixture (500 μmol / L), and 20 μL of KFexo- (500 U / mL) were placed in the same reaction system and vortexed until homogeneous. The total reaction system was 100 μL. The mixture was centrifuged at low speed for 3 s to mix the solution at the bottom of the centrifuge tube, and incubated at 37 °C for 30 min to obtain the isothermal amplification product.

[0091] S4. Fluorescence detection:

[0092] To the isothermal amplification product obtained in step S3, PEI@MIL-101, a metal-organic framework material from Example 2, was added to a final concentration of 10 μg / mL. The mixture was vortexed at 25 °C for 10 min, and then detected using a fluorescence spectrometer. Fluorescence parameters were: excitation wavelength 490 nm, emission wavelength range 500-600 nm, excitation slit 5 nm, emission slit 3 nm, interval 1 nm, and medium-speed detection. The concentration of *Pseudomonas aeruginosa* in the sample was determined based on the calibration curve of the logarithm of the *Pseudomonas aeruginosa* concentration and the voltage change ΔmV.

[0093] The calibration curves for the logarithm of Pseudomonas aeruginosa concentration and the voltage change value ΔmV were obtained using the following method:

[0094] Take 1 mL of 1×10 7 A CFU / mL solution of Pseudomonas aeruginosa was serially diluted 10-fold. 1~ 10 6 Centrifugation was performed on 1 mL of *Pseudomonas aeruginosa* culture at CFU / mL. The supernatant was discarded, and the culture was dissolved in PBS buffer. Nucleic acid extraction was then performed using the magnetic nanoprobe Kan@MNPs obtained in Example 1. The culture was washed and eluted under a magnetic field, and the supernatant was collected to obtain 1 mL of *P. aeruginosa* genome release solution, which served as the *P. aeruginosa* DNA template. 20 μL of the *P. aeruginosa* DNA template was added to the isothermal amplification reaction system determined in Example 3 and incubated at 37 °C for 30 min. The fluorescence voltage value mV1 was measured. Then, PEI@MIL-101 (from Example 2) at a final concentration of 10 μg / mL was added to the amplified system, and the mixture was vortexed for 10 min. The fluorescence voltage value mV2 was measured, and the voltage change ΔmV was the value of mV1-mV2. 10 μg / mL of *P. aeruginosa* was then added to the amplified system. 1 ~10 6 A standard curve was established by comparing the CFU / mL concentration with the corresponding voltage change ΔmV, such as... Figure 5 As shown.

[0095] Depend on Figure 5 It is known that the probe composition consisting of magnetic nanoprobes Kan@MNPs and metal-organic framework probes PEI@MIL-101@FAM-HP exhibits a good linear relationship between its concentration and fluorescence signal when detecting Pseudomonas aeruginosa, enabling rapid and effective quantitative detection of Pseudomonas aeruginosa.

[0096] In summary, the probe composition of the present invention, consisting of magnetic nanoprobes and metal-organic framework probes, has the advantages of high sensitivity, high specificity, rapid and convenient detection of Pseudomonas aeruginosa, and is suitable for rapid on-site screening and quantitative detection of Pseudomonas aeruginosa.

[0097] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that after reading this application specification, they can still modify or make equivalent substitutions to the specific implementation of the present invention, but these modifications or changes do not depart from the protection scope of the pending claims of the present invention.

Claims

1. A probe composition, characterized in that, It includes magnetic nanoprobes and metal-organic framework probes, wherein the magnetic nanoprobes are covalently bound to magnetic beads and amino antibiotics; The raw materials for preparing the metal-organic framework probe include fluorescent hairpin probes and metal-organic framework materials, wherein the metal-organic framework material is a coordination polymer modified with an amino group.

2. The probe composition according to claim 1, characterized in that, The magnetic beads are epoxy-modified magnetic beads; And / or, the average particle size of the magnetic beads is 60~150 nm.

3. The probe composition according to claim 1, characterized in that, The amino-based antibiotics are selected from at least one of kanamycin, gentamicin, amikacin, tobramycin, and streptomycin.

4. The probe composition according to claim 1, characterized in that, The amino-containing polymer is selected from polyethyleneimine.

5. The probe composition according to claim 1, characterized in that, The coordination polymer is formed by trivalent transition metal ions and terephthalic acid ligands; And / or, the fluorescent hairpin probe is PA7-HP, and its nucleotide sequence is: 5'-CGGCCCTTATCGCGTTACGTGCGCCACTAAGATCTCAACGCGATAAGGGCCG-3'.

6. A method for preparing the probe composition according to any one of claims 1 to 5, characterized in that, Includes the following steps: S1. The magnetic beads are mixed with the amino-based antibiotic and reacted, followed by post-processing to obtain the magnetic nanoprobe; S2. The coordination polymer is mixed with the fluorescent hairpin probe and reacted to obtain the metal-organic framework probe.

7. The use of the probe composition according to any one of claims 1 to 5 in the detection of Pseudomonas aeruginosa.

8. The application according to claim 7, characterized in that, The magnetic nanoprobe is used to enrich and separate Pseudomonas aeruginosa nucleic acid; and / or, the metal-organic framework probe is used to recognize Pseudomonas aeruginosa nucleic acid and detect fluorescence signals dependent on the concentration of the nucleic acid.

9. A method for detecting Pseudomonas aeruginosa, characterized in that, Includes the following steps: SS1. Nucleic acid extraction: The sample solution to be tested is mixed with lysozyme and the magnetic nanoprobe in the probe composition according to any one of claims 1 to 5, shaken and incubated, magnetic separation is performed by applying an external magnetic field, the supernatant is discarded and then washed and eluted to obtain the DNA template of the sample to be tested; SS2. Isothermal amplification: The fluorescent hairpin probe, the raw material for preparing the metal-organic framework probe in any one of claims 1 to 5, the DNA template of the sample to be tested obtained in step SS1, the primers of Pseudomonas aeruginosa, the nucleotide raw material, and the DNA polymerase are mixed and incubated to obtain the isothermal amplification solution. SS3. Fluorescence detection: The isothermal amplification solution obtained in step SS2 and the metal-organic framework material used to prepare the metal-organic framework probe in any one of claims 1 to 5 are mixed, reacted, and then fluorescence detection is performed.

10. The method according to claim 9, characterized in that, The primer for Pseudomonas aeruginosa mentioned in step SS2 is PA7-P5, and its nucleotide sequence is: 5'-CGGCCCT-3'.