Transistor sensor for detecting rare earth metal scandium and application thereof

Abstract

This invention discloses a transistor sensor for detecting scandium, a rare earth metal, and its application in the field of rare earth metal ion detection technology. The transistor sensor includes a glass substrate, a source electrode, a drain electrode, a gold gate electrode modified with a self-assembled probe, a graphene channel, a silver paste layer, and a waterproof sealant. The self-assembled probe is a nucleic acid aptamer modified with a 5'-terminal thiol group, which specifically recognizes and captures scandium ions. This invention achieves targeted detection of scandium by combining a nucleic acid aptamer capable of specifically recognizing and capturing rare earth metal scandium with a transistor sensor, exhibiting advantages of high selectivity, high sensitivity, and high stability. This transistor sensor can be used for rapid detection of scandium ions in food.

Description

Technical Field

[0001] This invention relates to the field of rare earth metal ion detection technology, specifically to a transistor sensor for detecting rare earth metal scandium and its application. Background Technology

[0002] The mining of rare earth elements can lead to their diffusion into seawater, freshwater, and soil, causing environmental pollution and food safety issues, and even affecting human health. Scandium, as a typical light rare earth element, can enter the human body through multiple pathways, inducing the production of reactive oxygen species (ROS), DNA damage, and cell death. Therefore, identifying scandium in the environment and food is crucial for monitoring and managing environmental and food safety.

[0003] In the fields of chemical and biological detection, electrolyte-gate graphene transistors (SGGTs) have become one of the most promising devices due to their unique structure and excellent performance. The gate and graphene channel of an SGGT are not separated by an insulator, but rather by an electrolyte, thus achieving high sensitivity and high throughput detection. Currently, SGGTs have been successfully developed for the detection of metal ions, nucleic acids, cells, and other charged analytes. However, the detection effect of ordinary SGGTs lacks specificity. In complex detection systems, multiple substances participate in electrochemical reactions in the gate region of the SGGT, leading to abnormal changes in the channel current. Such potential interference directly affects the accuracy of SGGT detection of the target analyte. Furthermore, there are currently no reports on SGGTs that can specifically detect the rare-earth metal scandium in the system. Therefore, this invention proposes a transistor sensor for detecting the rare-earth metal scandium and its application. Summary of the Invention

[0004] To address the above technical problems, this invention provides a transistor sensor for detecting the rare earth metal scandium and its application.

[0005] The present invention achieves the above objectives through the following technical solutions: This invention provides a transistor sensor for detecting the rare earth metal scandium, comprising a glass substrate, on which are disposed a source electrode, a drain electrode, a gold gate electrode modified with a self-assembled probe, a graphene channel, a silver paste layer, and a waterproof sealant. The graphene channel is used to connect the source electrode and the drain electrode, and the silver paste layer and the waterproof sealant are used to protect the metal connection lines of the source electrode, the drain electrode, and the gold gate electrode. The self-assembled probe is a modified nucleic acid aptamer that specifically recognizes and captures scandium ions.

[0006] As a further optimization of the present invention, the sequence of the nucleic acid aptamer is: GACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC.

[0007] As a further optimization of the present invention, the self-assembled probe is a nucleic acid aptamer modified with a 5' end thiol group. The self-assembled probe self-assembles on the surface of the gold gate electrode through the strong interaction between the activated thiol group and the gold gate electrode.

[0008] The present invention also provides an application of the above-mentioned transistor sensor in the detection of the rare earth metal scandium.

[0009] As a further optimization of the present invention, the quantitative detection range of the transistor sensor is 1pM-100nM, the detection noise is 3mV, and the detection limit is 0.736pM.

[0010] As a further optimization of the present invention, the application is specifically for the rapid detection of scandium ions in food.

[0011] The beneficial effects of this invention are as follows: 1. The transistor sensor provided by this invention incorporates a nucleic acid aptamer on its gold gate electrode, which can specifically recognize and capture the rare-earth metal scandium. The nucleic acid aptamer is modified with a 5'-terminal thiol group and self-assembles onto the surface of the gold gate electrode via covalent gold-sulfur (Au-S) bonds. This transistor sensor can specifically detect the rare-earth metal scandium and possesses advantages such as high detection sensitivity, low detection limit, stable detection effect, and strong anti-interference effect.

[0012] 2. When the transistor sensor provided by this invention is used for rapid detection of scandium ions in food, it can effectively resist signal interference caused by complex interfering substances such as proteins and fats in food, and achieve accurate and stable detection results. It helps to quickly determine the scandium ion contamination of food and has high practical value. Attached Figure Description

[0013] Figure 1 This is a schematic diagram of the fabrication process of a transistor sensor. Figure 2 Electrochemical impedance spectroscopy of a gold gate electrode modified with a 5'-terminal thiol aptamer; Figure 3 Electrochemical impedance spectroscopy of a gold gate electrode modified with a nucleic acid aptamer having a PolyA domain; Figure 4 The detection results of rare earth metal scandium ion solutions of different concentrations by a transistor sensor modified with a 5'-terminal thiol aptamer. Figure 5 Stability test results of transistor sensors modified with 5'-terminal thiol aptamers; Figure 6 The anti-interference test results of the transistor sensor modified with the 5'-terminal thiol aptamer; Figure 7The detection results of scandium ions in food by a transistor sensor modified with a 5'-terminal thiol aptamer; In the diagram: 1. Source electrode; 2. Drain electrode; 3. Gold gate electrode; 4. Glass substrate; 5. Graphene channel; 6. Silver paste layer; 7. Waterproof sealant. Detailed Implementation

[0014] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0015] I. Experimental Materials Unless otherwise specified, all methods used in this invention are conventional methods known to those skilled in the art, and all reagents and materials used are commercially available products.

[0016] II. Experimental Methods and Conclusions 1. Structure and composition of transistor sensors like Figure 1 As shown, the transistor sensor provided by the present invention includes a glass substrate 4, on which a source electrode 1, a drain electrode 2, a gold gate electrode 3 modified with a self-assembled probe, and a graphene channel 5 are disposed. The graphene channel 5 is used to connect the source electrode 1 and the drain electrode 2. The electrode 1, the drain electrode 2, and the gold gate electrode 3 all include a Cr layer and an Au layer. The thickness of the Cr layer is 10 nm, and the thickness of the Au layer is 100 nm. The surface of the source electrode 1, the drain electrode 2, and the gold gate electrode 3 on the same side is coated with a silver paste layer 6. A waterproof sealant 7 is provided in the middle section of the source electrode 1, the drain electrode 2, and the gold gate electrode 3. The silver paste layer 6 and the waterproof sealant 7 protect the metal connection lines of the source electrode 1, the drain electrode 2, and the gold gate electrode 3 to prevent short circuits. The self-assembled probe is a modified nucleic acid aptamer (sequence: GACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC), which specifically recognizes and captures scandium ions.

[0017] 2. Fabrication of transistor sensors 2.1 Transistor sensors containing 5'-terminal thiol-modified nucleic acid aptamers (1) Cut a glass substrate 4, and use magnetron sputtering to deposit patterned electrodes including source electrode 1, drain electrode 2 and gold gate electrode 3 on the glass substrate 4 in sequence. Then, graphene is prepared by chemical vapor deposition and transferred to the channel between source electrode 1 and drain electrode 2 to form graphene channel 5, thus obtaining the basic transistor sensor. The specific operation in the preparation process is directly referred to the existing similar transistor sensors. (2) Take a 5' end thiol-modified nucleic acid aptamer (ordered from Shanghai Sangon Biotech Co., Ltd., referred to as 5' end thiol aptamer), incubate with tris(2-carboxyethyl)phosphine (TCEP) for 1 h to activate the thiol group, clean the gold gate electrode 3, drop the mixed solution obtained after thiol activation onto the cleaned gold gate electrode 3 and spread it evenly, incubate at room temperature in the dark for 1 h, rinse with pure water and air dry, then add 6-mercaptohexyl-1-ol (MCH) to block the gold gate electrode 3, place for 24 h and rinse away the excess MCH with pure water to form a self-assembled probe-modified gold gate electrode 3; (3) Sensor encapsulation: The metal connection wires of the source electrode 1, drain electrode 2 and gold grid electrode 3 on the sensor are protected by silver paste layer 6 and waterproof sealant 7.

[0018] 2.2 Transistor sensors modified with nucleic acid aptamers containing PolyA domains (1) Fabricate the basic transistor sensor, using the same method as in 2.1; (2) Clean the gold gate electrode 3, measure out a nucleic acid aptamer with a PolyA domain (sequence: GACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTCAAAAAAAAAAAAAAAAAAAACTGCTGTATATGCATCAGTAAGGTGCCCTTACCAGGCAGCAG, ordered from Shanghai Sangon Biotech Co., Ltd.), drop it onto the surface of the gold gate electrode 3 and spread it evenly. Incubate it at room temperature in the dark for 1 hour, rinse it with pure water and air dry it naturally. Then add 6-mercaptohexyl-1-ol (MCH) to block the gold gate electrode 3. After 24 hours, rinse off the excess MCH with pure water to form a gold gate electrode 3 modified with a self-assembled probe. (3) Sensor encapsulation: The metal connection wires of the source electrode 1, drain electrode 2 and gold grid electrode 3 on the sensor are protected by silver paste layer 6 and waterproof sealant 7.

[0019] 3. Detection of the modification effect of nucleic acid aptamers on gold gate electrodes (1) Detection method Electrochemical impedance spectroscopy (EIS) of the gold gate electrode was performed using a CHI660D electrochemical workstation, yielding the corresponding EIS spectra. A standard three-electrode system was employed: a platinum wire (Pt) as the auxiliary electrode and a saturated calomel electrode (SCE) as the reference electrode; the working electrodes were the unmodified gold gate electrode and the modified gold gate electrode, respectively. EIS measurements were performed using a solution containing 0.1 mM KCl and 5 mM [Fe(CN)6]. 3- / 4- The experiment was conducted in 10 mL of electrolyte solution; the applied potential was 0.2 V, and the scan frequency range was 0.1-10. 5 Hz, scanning from high frequency to low frequency.

[0020] (2) Test results The electrochemical impedance spectroscopy of the gold gate electrode modified with a 5'-terminal thiol aptamer is as follows: Figure 2 As shown, the electrochemical impedance spectroscopy of the gold gate electrode modified with an aptamer having a PolyA domain is as follows: Figure 3 As shown, comparison Figure 2 , 3 It can be seen that, compared with the unmodified gold gate electrode, the electrochemical impedance of the gold gate electrode modified with the 5'-thiol aptamer is significantly increased, while the impedance increase of the gold gate electrode modified with the aptamer having the PolyA domain is smaller. This result indicates that, compared with PolyA domain modification, the 5'-thiol modification method has a higher compatibility with the nucleic acid aptamer and achieves better modification effect. Therefore, the 5'-thiol modification strategy for nucleic acid aptamers in transistor sensors is selected.

[0021] 4. Performance testing of transistor sensors modified with 5'-terminal thiol aptamers 4.1 Performance Characterization Methods The transistor sensor was immersed in a glass dish containing 10 mL of 1×PBS buffer. The three electrodes were connected to the corresponding ports on a Keithley 2400 instrument. The transfer characteristic curves of the gate voltage (VG) and the source and drain currents (IDS) were measured. The test conditions were: gate voltage scan range of -0.5–0.5 V, and sweep rate of 0.01 V·s. -1 A constant voltage (V) between the source and drain electrodes DS The voltage was 0.05V, and the source and drain currents (IDS) were collected by a custom LabVIEW sensing system.

[0022] 4.2 Performance Testing Items (1) Detection effect of rare earth metal scandium The samples added to each experimental group were rare earth metal scandium ion solutions of different concentrations (1pM, 10pM, 100pM, 1nM, 10nM, 100nM). A blank control group without rare earth metal scandium ion solution was set up. After the samples were added, the shift of the transfer characteristic curve of the transistor sensor in each group was monitored and the Dirac point shift was calculated. After adding scandium ion solution (a rare earth metal) for 5 minutes, the shift in the transfer characteristic curves of the transistor sensors in each group is as follows: Figure 4 As shown in figure a, a nonlinear fitting was performed on the sample concentration and the Dirac point offset (ΔVDirac), and the results are as follows. Figure 4 As shown in b, the correlation coefficient R 2=0.99676, linear range is 1pM-100nM. Three transfer characteristic curve scans were performed on the transistor sensor to determine the sensor's noise; the results are as follows. Figure 4 As shown in c, the noise of this sensor is only 3mV. Taking three times the signal noise value as the detection limit of this transistor sensor, the detection limit is determined to be 0.736pM.

[0023] (2) Stability testing At room temperature, the transistor sensor was stored in 1×PBS buffer for 7 consecutive days. The transistor sensor was used to detect rare earth metal scandium at concentrations of 10 pM and 100 pM, and the corresponding Dirac point shift was calculated. The results are as follows Figure 5 As shown, within 4 days, the transistor sensor produced similar ΔVDirac when detecting the same concentration of rare earth metal scandium. Figure 5 (b) The concentration decreased slightly afterward, but the detection capability remained intact; within 7 days, the transistor sensor consistently demonstrated the ability to detect scandium, and its concentration dependence on scandium remained good. These results indicate that the transistor sensor exhibits good stability when used for detecting scandium.

[0024] (3) Specific detection The samples added to each experimental group were mixtures of rare earth metal scandium ion solution (10 pM) and different interfering substances (200 pM), including K. + Na + Mg 2+ Fe 3+ Eu 3+ Ce 3+ Tb 3+ etc. (see details) Figure 6 After adding samples, the transfer characteristic curves of transistor sensors in each group were monitored, and the Dirac point offset was calculated. In each experimental group, the transfer characteristic curves of the transistor sensor are as follows: Figure 6 As shown in a, ΔVDirac is as follows Figure 6 As shown in Figure b, it can be seen from the figure that although the concentration of interfering substances is much greater than that of rare earth metal scandium, the rare earth metal scandium SGGT can still significantly distinguish rare earth metal scandium from other interfering substances. This result shows that the rare earth metal scandium SGGT biosensor has excellent anti-interference ability.

[0025] 5. Application of 5'-terminal thiol aptamer-modified transistor sensors in food safety detection Rice, clams, yellow croaker, and beef were selected as food samples from materials easily contaminated by scandium, a rare earth metal. Each food sample was homogenized and then mixed thoroughly with 1×PBS buffer. The supernatant was collected by centrifugation and spiked (1 pM, 10⁻⁶ PBS buffer was added). -2 pM and 10 -4 (pM scandium ions), the diluted solution was used as a sample for detection. Each experimental group had a blank control without adding the supernatant of the food sample. After adding the sample, the transfer characteristic curve of the transistor sensor in each group was monitored, and the Dirac point offset was calculated. The sample concentration is calculated based on the Dirac point offset using the formula: y = 25.88723 + 11.14714x (where y is the Dirac point offset and x is the logarithmic concentration of Sc). The sample concentration calculated based on the logarithmic concentration of Sc is the detection result, denoted as the detection concentration C. The spiked recovery rate is calculated based on the detection concentration C and the concentration of the standard used for spiked C0 using the formula: Recovery rate = (C / C0) * 100%. The results are as follows Figure 7 As shown, the 5'-terminal thiol aptamer-modified transistor sensor achieved a spiked recovery rate of 89-107% when used for food safety detection. This result indicates that the 5'-terminal thiol aptamer-modified transistor sensor has good anti-interference ability against impurities such as proteins and fats, and has good detection effect. Moreover, the detection process takes only about 5 minutes from sample addition to obtaining the detection result, making it suitable for rapid detection of rare earth metal scandium in food.

[0026] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A transistor sensor for detecting the rare earth metal scandium, comprising a glass substrate (4), characterized in that: The glass substrate is provided with a source electrode (1), a drain electrode (2), a gold gate electrode (3) modified with a self-assembled probe, a graphene channel (5), a silver paste layer (6), and a waterproof sealant (7). The graphene channel (5) is used to connect the source electrode (1) and the drain electrode (2). The silver paste layer (6) and the waterproof sealant (7) are used to protect the metal connection lines of the source electrode (1), the drain electrode (2), and the gold gate electrode (3). The self-assembled probe is a modified nucleic acid aptamer that specifically recognizes and captures scandium ions.

2. The transistor sensor according to claim 1, characterized in that: The sequence of the nucleic acid aptamer is: GACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC.

3. The transistor sensor according to claim 1, characterized in that: The self-assembled probe is a nucleic acid aptamer modified with a 5' end thiol group. The self-assembled probe self-assembles on the surface of the gold gate electrode (3) through the strong interaction between the activated thiol group and the gold gate electrode.

4. The application of a transistor sensor as described in any one of claims 1-3 in the detection of the rare earth metal scandium.

5. The application according to claim 4, characterized in that: The transistor sensor has a quantitative detection range of 1pM-100nM, a detection noise of 3mV, and a detection limit of 0.736pM.

6. The application according to claim 4, characterized in that: This application is specifically for the rapid detection of scandium ions in food.

Images