A biomarker for venetoclax-resistant acute myeloid leukemia and application thereof

By discovering the key role of CSF3R in veneclade-resistant AML, and providing CSF3R as a biomarker and inhibitor, the diagnostic and treatment challenges of veneclade-resistant AML have been solved, achieving the reversal of drug resistance and improved patient prognosis.

CN122487671APending Publication Date: 2026-07-31AFFILIATED HOSPITAL OF HEBEI UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
AFFILIATED HOSPITAL OF HEBEI UNIV
Filing Date
2026-04-29
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

In the current technology, veneclade resistance is prevalent in the treatment of acute myeloid leukemia (AML), leading to increased relapse rates and shortened survival. There is a lack of effective targets to reverse or prevent this resistance phenotype.

Method used

Colony-stimulating factor 3 receptor (CSF3R) was found to be highly expressed in veneclade-resistant AML, promoting drug resistance by regulating STAT5 phosphorylation and nuclear translocation. CSF3R is provided as a biomarker and inhibitor, such as CSF3R protein function inhibitors or gene expression inhibitors (such as shRNA or siRNA), for reversing drug resistance.

Benefits of technology

CSF3R inhibitors can effectively reverse the resistance of AML cells to Veneclazide, providing new diagnostic biomarkers and therapeutic targets, and improving the clinical prognosis of AML patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122487671A_ABST
    Figure CN122487671A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biomedical technology, specifically disclosing a biomarker for veneclade-resistant acute myeloid leukemia (AML) and its application. This invention discovers and confirms that high expression of CSF3R is closely related to veneclade resistance in AML patients, providing a new biomarker for the diagnosis of veneclade-resistant AML. This invention also finds that CSF3R can regulate the expression of downstream proliferation and apoptosis-related proteins by promoting STAT5 phosphorylation and nuclear translocation, ultimately leading to AML cells developing resistance to veneclade. Furthermore, knocking down or eliminating CSF3R can effectively reverse AML cell resistance to veneclade, providing a new target for developing drugs to reverse veneclade-resistant AML. Since resistance reversal can be achieved through CSF3R inhibitors, this invention provides a new diagnostic and treatment strategy for relapsed / refractory AML or veneclade-resistant AML.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to a biomarker for veneclade-resistant acute myeloid leukemia and its application. Background Technology

[0002] Acute myeloid leukemia (AML) is a malignant hematologic disorder originating from hematopoietic stem cells in the bone marrow. It is characterized by the massive proliferation and accumulation of abnormal myeloid blast cells in the bone marrow, which infiltrate other tissues and organs, severely suppressing normal hematopoietic function. The incidence of AML increases with age, and the prognosis is poor, especially for relapsed / refractory AML patients, for whom current clinical treatments are limited and survival rates are extremely low.

[0003] Venecella (VEN), a highly selective B-cell lymphoma factor 2 (BCL-2) inhibitor, induces apoptosis in AML cells by inhibiting the anti-apoptotic activity of BCL-2 protein, and has become a key drug in the clinical treatment of AML. However, the continuous emergence of veneclare resistance in clinical application has severely limited its therapeutic efficacy, directly leading to increased relapse rates and significantly shortened survival. Currently, the molecular mechanism by which AML cells develop resistance to veneclare is not fully understood, and there is a lack of effective targets in clinical practice to reverse or prevent the occurrence of this resistance phenotype.

[0004] Colony-stimulating factor 3 receptor (CSF3R) is a transmembrane glycoprotein receptor belonging to the cytokine receptor superfamily. Its natural ligand is granulocyte colony-stimulating factor (G-CSF). After binding to its ligand, CSF3R can activate multiple downstream signaling pathways, widely participating in the regulation of biological processes such as cell proliferation, differentiation, survival, and apoptosis. Existing studies have confirmed that abnormal expression or gene mutations of CSF3R are closely related to the occurrence and development of various hematologic diseases; however, whether it participates in regulating the resistance of AML cells to veneclade is rarely reported in the literature.

[0005] Therefore, screening and discovering novel drug targets that can reverse vinecella resistance in AML is of great scientific and clinical significance for improving the clinical prognosis of AML patients. Summary of the Invention

[0006] In light of this, this invention, through a series of studies including clinical sample testing, cell experiments, and in vivo animal experiments, creatively discovered that CSF3R is highly expressed in veneclade-resistant AML. CSF3R can promote AML cell resistance to veneclade by regulating STAT5 phosphorylation and nuclear translocation. Based on this discovery, this invention provides a biomarker for veneclade-resistant acute myeloid leukemia and its application, laying the foundation for subsequent diagnostic and therapeutic drug development for veneclade-resistant acute myeloid leukemia.

[0007] To achieve the above-mentioned objectives, the embodiments of the present invention employ the following technical solutions: In a first aspect, the present invention provides a biomarker for veneclade-resistant acute myeloid leukemia, wherein the biomarker is CSF3R.

[0008] This invention is the first to discover the key role of CSF3R in veneclade-resistant acute myeloid leukemia (AML), confirming that high expression of CSF3R is closely related to veneclade resistance in AML patients, and providing a new biomarker for the diagnosis of veneclade-resistant AML.

[0009] Secondly, this invention provides the application of CSF3R in the preparation of reagents or kits for the diagnosis or auxiliary diagnosis of Veneclare-resistant acute myeloid leukemia.

[0010] Thirdly, this invention provides the use of CSF3R inhibitors in the preparation of medicaments for treating Venecella-resistant acute myeloid leukemia.

[0011] Signal transducer and activator of transcription 5 (STAT5) is a member of the STAT family and plays a crucial role in cytokine- and growth factor-mediated signaling pathways. Once phosphorylated and activated, STAT5 can cross into the nucleus to regulate the expression of downstream target genes, participating in biological processes such as cell proliferation, apoptosis, and differentiation. Previous studies have confirmed that abnormal activation of the STAT5 signaling pathway is closely related to the occurrence, development, and drug resistance of AML, but the interaction between CSF3R and the STAT5 signaling pathway in AML veneclade resistance remains unclear.

[0012] This invention elucidates the molecular mechanism by which CSF3R mediates veneclade resistance in AML. Specifically, CSF3R promotes STAT5 phosphorylation and nuclear translocation, regulating the expression of downstream proliferation and apoptosis-related proteins, ultimately leading to AML cells developing resistance to veneclade. The role and regulatory mechanism of CSF3R in AML veneclade resistance are of great significance for developing drugs to reverse AML veneclade resistance and improving the clinical prognosis of AML patients.

[0013] This invention also demonstrates that knocking down CSF3R can effectively reverse the resistance of AML cells to Venecella, providing a new target for the development of drugs to reverse Venecella-resistant AML, and has important clinical translational value; in vivo and in vitro experiments have verified the role and mechanism of CSF3R in Venecella-resistant AML, laying the foundation for subsequent clinical research and drug development.

[0014] Preferably, the CSF3R inhibitor includes at least one of a CSF3R protein function inhibitor or a CSF3R gene expression inhibitor.

[0015] More preferably, the CSF3R gene expression inhibitor includes at least one of shRNA targeting CSF3R or siRNA targeting CSF3R.

[0016] More preferably, the shRNA targeting CSF3R is expressed in a lentiviral vector.

[0017] More preferably, the siRNA targeting CSF3R includes at least one of siRNA-CSF3R-1589 or siRNA-CSF3R-1731; wherein the nucleotide sequence of the positive strand of siRNA-CSF3R-1589 is shown in SEQ ID No. 1, and the nucleotide sequence of the antisense strand of siRNA-CSF3R-1589 is shown in SEQ ID No. 2; the nucleotide sequence of the positive strand of siRNA-CSF3R-1731 is shown in SEQ ID No. 3, and the nucleotide sequence of the antisense strand of siRNA-CSF3R-1731 is shown in SEQ ID No. 4.

[0018] The nucleotide sequence of the shRNA targeting CSF3R is shown in SEQ ID No. 5 or SEQ ID No. 6.

[0019] Fourthly, the present invention provides a medicament for treating veneclade-resistant acute myeloid leukemia, the medicament comprising at least one of a CSF3R protein function inhibitor or a CSF3R gene expression inhibitor.

[0020] This invention, through clinical samples, cell and animal in vivo experiments, confirms that CSF3R plays a key regulatory role in veneclade resistance in acute myeloid leukemia (AML). Studies found that CSF3R mRNA and protein levels were significantly upregulated in veneclade-resistant AML patients and resistant cell lines, accompanied by high expression of proliferation-related proteins PCNA, anti-apoptotic proteins BCL-2 and MCL-1, and decreased expression of pro-apoptotic proteins BAX and Cleaved-Caspase3, suggesting that CSF3R promotes veneclade resistance in AML cells by regulating proliferation and apoptosis-related proteins. Mechanistic studies showed that veneclade treatment induced increased levels of total STAT5 protein and phosphorylation, and promoted STAT5 nuclear translocation, suggesting that CSF3R may mediate resistance by activating the STAT5 pathway. In vitro knockdown of CSF3R significantly downregulated STAT5 and its downstream proliferative and anti-apoptotic proteins, upregulated pro-apoptotic proteins, and significantly reduced the IC50 of veneclax in drug-resistant cells, effectively reversing the drug resistance phenotype. Replenishment of STAT5 activators restored these signal changes and counteracted the drug resistance reversal effect, further confirming that CSF3R regulates drug resistance through the STAT5 pathway. Nude mouse tumorigenesis experiments showed that knockdown of CSF3R in drug-resistant cell lines significantly reduced the expression of STAT5, proliferative, and anti-apoptotic proteins in tissues, consistent with in vitro results. In conclusion, CSF3R can serve as a potential diagnostic biomarker for veneclax-resistant AML and also as a therapeutic target, achieving drug resistance reversal by inhibiting the CSF3R-STAT5 axis, providing a new diagnostic and therapeutic strategy for relapsed / refractory or veneclax-resistant AML. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The results of IC50 determination of different cell lines for Veneclare in this invention; Figure 2 This is the result of measuring the CSF3R mRNA expression level in drug-resistant cells after 48 hours of treatment with Veneclair in this invention; Figure 3 The results of Western blot analysis of the contents of CSF3R, proliferation-related proteins, anti-apoptotic proteins and pro-apoptotic proteins in different cell lines after Veneclare treatment for 48 h in this invention; Figure 4 This is the result of Western blotting analysis of STAT5 protein expression in parental and drug-resistant cell lines after 48 hours of treatment with Veneclair in this invention. Figure 5 The results of Western blotting analysis of the expression levels of cytoplasmic and nuclear proteins in parental and drug-resistant cell lines after 48 hours of treatment with Veneclair in this invention are as follows: Figure 6 This invention presents the expression of CSF3R-related genes and the CSF3R protein content in different cell lines after siRNA-CSF3R transfection of drug-resistant cell lines. Figure 7 The results of Western blot analysis of proliferation-related proteins and apoptosis-related proteins after siRNA-CSF3R transfection of drug-resistant cell lines in this invention; Figure 8 This is the result of Western blotting analysis of the STAT5 and p-STAT5 content in cytoplasmic and nuclear proteins after siRNA-CSF3R transfection of drug-resistant cell lines in this invention. Figure 9 This shows the expression of CSF3R-related proteins after knocking down drug-resistant cell lines using lentiviruses in this invention. Figure 10 The results of IC50 determination of Venecra in different cell lines after knocking down the CSF3R gene of drug-resistant cell lines using lentivirus in this invention. Figure 11 The results of Western blot analysis of STAT5, p-STAT5 and proliferation and apoptosis protein expression in drug-resistant cell lines after CSF3R gene knockdown in this invention were obtained after adding STAT5 activator. Figure 12 These are the single-cell sequencing results of bone marrow blood from veneclade-sensitive and resistant patients (n=3) in this invention; wherein... Figure 12 A represents the cell count of different clusters. Figure 12 B represents the proportion of samples from different cell clusters. Figure 12 C is the UMAP diagram with cell typing annotation. Figure 12 D is a volcano plot of significantly differentially expressed genes in the GMP cell population.

[0023] Figure 13 The results show the expression levels of CSF3R mRNA in bone marrow mononuclear cells of patients sensitive to and resistant to veneclade in this invention. Figure 14 This is the result of measuring the CSF3R protein expression level in Veneclare-sensitive and Veneclare-resistant patients in the Western blot experiment of this invention; Figure 15 The results of immunofluorescence detection of CSF3R protein expression levels in bone marrow mononuclear cells from patients sensitive to and resistant to veneclade in this invention; Figure 16 Gross images, tumor growth curves, tumor tissue images, and statistical graphs of average tumor volume and weight of nude mice 4 weeks after inoculation with MV4-11R-shNC and MV4-11R-shCSF3R, respectively, are shown. Figure 17 Immunohistochemical staining results of CSF3R, BCL-2, PCNA, BAX, MCL-1, and STAT5 expression in different groups of brown rat tumor tissues in this invention; Figure 18 The present invention presents the statistical results of the contents of CSF3R, BCL-2, PCNA, BAX, MCL-1 and STAT5 in tumor tissues of brown rats from different groups. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0025] Unless otherwise specified, the raw materials and reagents used in this invention are all conventional commercially available products; unless otherwise specified, the methods used in this invention are all conventional methods in the art.

[0026] I. Experimental Materials 1. Clinical Samples Bone marrow samples were collected from 20 patients with veneclade-sensitive AML and 17 patients with veneclade-resistant AML. Informed consent was obtained from all patients, and the samples were approved by the hospital's ethics committee. Single-cell sequencing was performed using 3 samples from each of the sensitive and resistant patients; qRT-PCR was performed using 6 samples from each of the sensitive and resistant patients; Western blot analysis was performed using 3 samples from each of the sensitive and resistant patients; and immunofluorescence analysis was performed using 8 samples from the sensitive patients and 5 samples from the resistant patients. Bone marrow samples were obtained from a hospital in Hebei Province and collected between July and October 2025.

[0027] 2. Cell lines Human AML cell lines HL-60, MV4-11, and U937 were purchased from the Cell Bank of the Chinese Academy of Sciences and cultured in RPMI-1640 medium containing 10% fetal bovine serum and 1% penicillin / streptomycin, and were incubated at 37°C in a 5% CO2 incubator.

[0028] 3. Laboratory animals SPF-grade BALB / c nude mice, 4-6 weeks old, male, weighing 18-22g, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. They were housed in an SPF-grade animal room with free access to food and water, and were used for experiments after one week of acclimatization.

[0029] II. Main Reagents Venekra was acquired from Selleck. RPMI-1640 medium and fetal bovine serum were purchased from Gibco. The qRT-PCR kit and Western blot-related reagents (protein extraction buffer, SDS-PAGE gel preparation kit, transfer buffer, primary antibody dilution buffer, secondary antibody) were purchased from Thermo Fisher Scientific. CSF3R, STAT5, p-STAT5, PCNA, BCL-2, MCL-1, BAX, Caspase3, Cleaved-Caspase3, P53 primary antibodies and corresponding secondary antibodies were all purchased from Cell Signaling Technology. siRNA-CSF3R and negative control siRNA-NC were purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd. Lentiviral vectors and packaging kits were purchased from Shanghai Hanheng Biotechnology Co., Ltd. The CCK8 reagent kit was purchased from Dojin Chemical Research Institute, Japan. The immunofluorescence kit and immunohistochemistry kit were purchased from Abcam.

[0030] III. Primer Sequence The specific information of the primer sequences used in this invention is shown in Table 1.

[0031] Table 1 Primer Sequences

[0032] IV. Statistical Analysis All experimental data were statistically analyzed using SPSS and GraphPad Prism software. Quantitative data are expressed as mean ± standard deviation (x ± s). Intergroup comparisons were performed using t-tests or one-way ANOVA. P <0.05 indicates a statistically significant difference.

[0033] Example 1 This invention, through a series of studies including clinical sample testing, cell experiments, and in vivo animal experiments, confirms that CSF3R promotes AML cell resistance to veneclade by regulating STAT5 phosphorylation and nuclear translocation. The specific technical solution is as follows: I. Experimental Methods for In Vitro Experiments 1. Establishment of Venecella-resistant cell lines Resistance to veneclade in AML cell lines was induced using a stepwise concentration escalation method. Parental cell lines HL-60, MV4-11, and U937 were seeded in RPMI-1640 medium containing different concentrations of veneclade (5 nM, 10 nM, 20 nM, 40 nM, 80 nM, 160 nM, 320 nM, 640 nM, and 1280 nM), and cultured at 37°C in a 5% CO2 incubator. The medium was changed every 3-4 days. Once the cells were stably grown at the specified concentration (viability ≥80%, approximately 1 week), the veneclade concentration was further increased until the cells could stably grow in 1 μM veneclade medium, resulting in stable resistant cell lines HL60R, MV4-11R, and U937R. The modeling process took approximately 8 weeks.

[0034] 2. CCK8 assay for the IC50 value of cells to Veneclare. (1) Uninduced parental cell lines (HL-60, MV4-11, U937) and drug-resistant cell lines (HL60R, MV4-11R, U937R) were respectively injected with 5×10 3 Cells were seeded at a density of 100 μL of culture medium per well in 96-well plates, with 3 replicates. Different concentrations of veneclade (0, 0.1, 0.5, 1, 5, 10, 20, 40 μM) were added, and the plates were incubated at 37°C with 5% CO2 for 48 h. 10 μL of CCK8 reagent was added to each well, and the plates were incubated for another 2 h. The absorbance (OD value) of each well was measured at 450 nm using a microplate reader, and cell viability was calculated. A dose-response curve was fitted using GraphPad Prism 8.0 software, and the IC50 value was calculated. Note: In this invention, the uninduced parental cell line was purchased from the Cell Bank of the Chinese Academy of Sciences, also known as a sensitive cell line (as opposed to a drug-resistant cell line).

[0035] 3. Single-cell sequencing analysis Bone marrow blood samples were collected from patients with veneclade sensitivity and veneclade resistance (n=3). Mononuclear cells were isolated using density gradient centrifugation, and single-cell suspensions were prepared, cells were lysed, cDNA was synthesized, and libraries were constructed. Single-cell RNA sequencing was performed using the Illumina NovaSeq 6000 sequencing platform. The sequencing data were subjected to quality control, cluster analysis, and differential gene expression analysis, with a focus on the differential expression of CSF3R in different cell subpopulations.

[0036] 4. qRT-PCR detection of gene mRNA expression levels Total RNA was extracted from cells or bone marrow mononuclear cells using the Trizol method. After testing the purity and integrity of the RNA, cDNA was synthesized by reverse transcription according to the qRT-PCR kit instructions. Using the cDNA as a template, real-time quantitative PCR was performed under the following conditions: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s; 60℃ annealing extension for 30 s, for a total of 40 cycles; final extension at 95℃ for 15 s, 60℃ for 60 s, and 95℃ for 15 s. GAPDH was used as an internal reference gene. -ΔΔCt The relative expression level of the target gene (CSF3R) was calculated using a method.

[0037] 5. Western blot analysis to detect protein expression levels Total cellular protein was extracted using RIPA lysis buffer (containing protease and phosphatase inhibitors). Cytoplasmic and nuclear proteins were extracted using a nuclear-cytoplasmic separation kit, and protein concentration was determined by the BCA method. Protein samples were mixed with loading buffer, denatured in a boiling water bath for 5 min, and then subjected to SDS-PAGE gel electrophoresis. The samples were transferred to PVDF membranes, blocked with 5% skim milk at room temperature for 1 h, and then incubated overnight at 4°C with the corresponding primary antibody (1:1000 dilution). The membranes were washed three times with TBST for 10 min each time, and then incubated for 1 h with the secondary antibody (1:5000 dilution) at room temperature. The membranes were washed three times with TBST for 10 min each time. Development was performed using an ECL chemiluminescence kit, and the grayscale values ​​of the protein bands were analyzed using ImageJ software. The relative expression levels of the target proteins were calculated using β-actin (internal control for total and cytoplasmic proteins) and Histone H3 (internal control for nuclear proteins) as internal controls.

[0038] 6. Immunofluorescence technique for detecting protein expression and localization Bone marrow mononuclear cells were seeded onto a slide, fixed with 4% paraformaldehyde for 15 min, permeabilized with 0.1% Triton X-100 for 10 min, blocked with 5% BSA for 30 min, and then incubated with CSF3R primary antibody (1:200 dilution) overnight at 4°C. The slide was then incubated with fluorescent secondary antibody (1:500 dilution) at room temperature for 1 h, stained with DAPI for 5 min, mounted with fluorescence quencher, and the expression location and fluorescence intensity of CSF3R protein were observed under a laser confocal microscope. The fluorescence intensity was quantitatively analyzed using ImageJ software, and the relative expression level was calculated.

[0039] 7. siRNA transfection and lentivirus knockdown experiments (1) siRNA transfection experiment siRNA-CSF3R and negative control si-NC transfection: drug-resistant cell lines were transfected at 2×10⁻⁶ cells / year. 5Cells were seeded per well in 6-well plates and cultured until the cell confluence reached 50%-60%. Then, following the instructions of the Lipofectamine 2000 kit, siRNA-CSF3R (final concentration 50 nM) or siRNA-NC was mixed with the transfection reagent and added to the cells. After culturing for 48 h, the knockdown efficiency was verified by qRT-PCR and Western blot analysis.

[0040] Among them, siRNA-CSF3R includes siRNA-CSF3R-1589, siRNA-CSF3R-1731, siRNA-CSF3R-425 or siRNA-CSF3R-752; the amplification primers for siRNA-CSF3R or siRNA-NC are shown in Table 1.

[0041] This invention verifies the efficiency of siRNA-CSF3R transfection in drug-resistant cell lines.

[0042] (2) Lentiviral knockdown experiment This invention knocks down the CSF3R gene in cells by constructing a CSF3RLV10N(U6 / mCherry&Puro)-CSF3R-Homo-196 knockdown lentiviral vector and a negative control vector. shRNA target selection: Based on the CSF3R target gene sequence and following the RNA interference sequence design principles provided on public websites, multiple RNA interference target sequences were designed using GenePharma Designer 3.0. The specific process is as follows: ① LV10N-shRNA DNA template design and synthesis The loop structure in the LV10N-shRNA DNA template was TTCAAGAGA to avoid the formation of a termination signal. A T was added to the 5' end of the sense strand template to complement the sticky end formed after HpaI digestion; an AGCT was added to the 5' end of the antisense strand template to complement the sticky end formed after XhoI digestion. Two shRNAs targeting the CSF3R gene (denoted as shCSF3R) were preferred in this invention, including shCSF3R-196 (also denoted as shCSF3R#1) and shCSF3R-1158 (also denoted as shCSF3R#2). The nucleotide sequence of shCSF3R-196 is shown in SEQ ID No. 5, and the nucleotide sequence of shCSF3R-1158 is shown in SEQ ID No. 6. A lentivirus containing shNC was used as a blank control; the nucleotide sequence of shNC is shown in SEQ ID No. 17.

[0043] SEQ ID No. 5 is specifically: GGAAACTGCCTGACTTGG; SEQ ID No. 6 is specifically: GGAGCTGAGAACTACCGAACG; SEQ ID No. 17 is specifically: TTCTCCGAACGTGTCACGT.

[0044] It should be noted that, in the accompanying drawings or the following description of the present invention, if the shCSF3R is not specifically marked with a sequence suffix, then shCSF3R specifically refers to the shCSF3R-196 sequence.

[0045] ② Annealing of LV10N-shRNA DNA template Dissolve the DNA oligos separately in TE (pH 8.0) to a concentration of 100 μM. Take the corresponding sense and antisense oligo solutions and prepare the annealing reaction system according to the proportions in Table 2 below.

[0046] Table 2

[0047] Annealing was performed on a PCR instrument according to the following procedure: 95℃ for 5 min; 85℃ for 5 min; 75℃ for 5 min; 70℃ for 5 min; and then stored at 4℃. After annealing, a 10 μM shRNA template was obtained. The resulting template solution was diluted 50-fold to a final concentration of 200 nM for use in the ligation reaction.

[0048] ③ Construction of LV10N-shRNA vector The carrier linkage reaction was carried out according to the system provided in Table 3.

[0049] Table 3

[0050] Incubate at 22°C for 1 hour, then transform into competent cells.

[0051] ④ Preparation of competent cells using the calcium chloride method Competent cells were prepared using the calcium chloride method, following standard procedures in the field.

[0052] ⑤ Transformation of the linker products After the competent cells were thawed, 10 µL of ligation product was added, the contents were gently mixed, and the mixture was placed on ice for 30 min. The centrifuge tubes were placed on a test tube rack in a water bath preheated to 42 °C and left for 90 s. The centrifuge tubes were then quickly transferred to an ice bath to cool the cells for 3 min. 800 µL of LB medium (antibiotic-free) was added to each centrifuge tube, and the tubes were then transferred to a 37 °C shaker and incubated at 250 rpm for 45 min to revive the bacteria. 200 µL of cultured cells were evenly spread on an LB agar plate containing 50 µg / mL Ampicillin. The plate was then inverted in a 37 °C incubator and cultured for 16 h.

[0053] ⑥ Identification and sequencing of positive clones Three colonies were picked from each plate and inoculated into LB medium containing 50 µg / mL Ampicillin. The culture was carried out at 37°C for 16 h. Plasmids were extracted using the alkaline lysis method. The obtained plasmids were identified by double digestion with XhoI and NheI. The plasmids were then co-transfected with the packaging plasmid into 293T cells. The viral load was collected, with a titer of 2 × 10⁻⁶. 8 The MOI was 150. The virus solution was then mixed with 5 × 10⁻⁶ cells / mL. 5 Cells of the drug-resistant strains HL60R, MV4-11R, and U937R (500 μL / well) were co-cultured for 24 h, followed by medium replacement. After 48 h, puromycin was added to screen for stable expression cell lines, which were then designated as HL60R-shCSF3R, MV4-11R-shCSF3R, and U937R-shCSF3R, respectively. Two weeks after screening, Western blot analysis was used to verify the knockdown efficiency.

[0054] 8. Adding STAT5 activator to CSF3R knockdown cells To the above concentration of 10 7 1 μL of 20 μg / mL STAT5 activator IL-2 was added to 1 mL of a CSF3R knockdown resistant cell line, and the cells were incubated at 37℃ for 15 min in a 5% CO2 incubator. Western blot analysis was performed to analyze the changes in the expression of STAT5, p-STAT5, and proliferation and apoptosis proteins.

[0055] II. Results of in vitro experiments 1. The role of CSF3R in Venecla-resistant AML cells The results of IC50 assays for different cell lines against Veneclair are as follows: Figure 1 As shown. By Figure 1It was found that the IC50 values ​​of the parental cell lines HL-60, MV4-11, and U937 were 0.54 μM, 0.65 μM, and 0.86 μM, respectively, while the IC50 values ​​of the drug-resistant cell lines HL60R, MV4-11R, and U937R were 38.90 μM (72 times that before VEN induction), 25.42 μM (39.11 times that before VEN induction), and 18.37 μM (21.36 times that before VEN induction), respectively.

[0056] The results of CSF3R mRNA expression level measurement in drug-resistant cells after 48 h of treatment with Veneclair are as follows: Figure 2 As shown. By Figure 2 It was found that the expression levels of CSF3R mRNA in the drug-resistant cell lines HL-60R, MV4-11R, and U937R were 2.08 times, 2.64 times, and 2.13 times that of the parental cell lines HL-60, MV4-11, and U937, respectively.

[0057] After 48 hours of treatment with Veneclare, Western blot analysis was performed on the levels of CSF3R, proliferation-related proteins, anti-apoptotic proteins, and pro-apoptotic proteins in different cell lines. The results are as follows: Figure 3 As shown. By Figure 3 It was found that after 48 hours of treatment with Veneclair, Western blot analysis and Image J calculation of grayscale values ​​were performed. The relative expression levels of various proteins were calculated after β-actin calibration. The average relative expression levels of the three parental cell lines and the three drug-resistant cell lines were then compared. Compared to the parental cell lines, CSF3R, PCNA, BCL-2, MCL-1, and Caspase3 were significantly upregulated in the drug-resistant cell lines, by 2.64-fold, 1.22-fold, 1.66-fold, 2.04-fold, and 2.11-fold, respectively. Compared to the parental cell lines, BAX and Cleaved-Caspase3 were significantly downregulated in the drug-resistant cell lines, by 2.04-fold and 4.67-fold, respectively.

[0058] It should be noted that the upregulation and downregulation folds of the expression levels of each protein or mRNA of the drug-resistant strains compared with the parental cell lines in this invention are calculated by comparing the average expression values ​​of the corresponding indicators in the three drug-resistant cell lines HL-60R, MV4-11R, and U937R with the average expression values ​​of the three parental cell lines HL-60, MV4-11, and U937.

[0059] 2. The promoting effect of CSF3R on pSTAT5 nuclear translocation After 48 hours of treatment with Veneclare, the expression of STAT5 protein in the parental cell line and the drug-resistant cell line was detected by Western blotting. The results are as follows: Figure 4 As shown. After the analysis Figure 4Analysis revealed that, compared with the parental cell lines HL-60, MV4-11, and U937, the average expression level of STAT5 protein in the drug-resistant cell lines HL60R, MV4-11R, and U937R was upregulated by 7.67-fold.

[0060] After treatment with venetoclax for 48 h, the results of detecting the expression levels of cytoplasmic and nuclear proteins in the parental cell lines and drug-resistant strains by Western blotting are as Figure 5 shown. After Figure 5 analysis, it was found that, compared with the parental cell lines HL-60, MV4-11, and U937, STAT5 in the cytoplasm and nucleus of the drug-resistant cell lines HL60R, MV4-11R, and U937R was upregulated by 6.97-fold and 1.83-fold, respectively, and p-STAT5 in the cytoplasm and nucleus was upregulated by 5.34-fold and 2.87-fold, respectively.

[0061] 3. CSF3R is a regulator of STAT5 and the reversal effect of knocking down CSF3R on venetoclax resistance After transfection of the drug-resistant cell lines with siRNA-CSF3R, the expression of CSF3R-related genes and the content of CSF3R protein in different cell lines are as Figure 6 shown. Figure 6 In Figure 6 , siRNA is abbreviated as "si". As

[0062] shown, taking the drug-resistant cell lines transfected with siRNA-NC as the control, the interference efficiency of the transfected cells was verified. The results showed that the knockdown efficiency of siRNA-CSF3R-425 and siRNA-CSF3R-7,52 was only about 10%, and the interference effect was poor. The knockdown efficiency of siRNA-CSF3R-1,589 and siRNA-CSF3R-1,731 reached 7,0%. Figure 7 After transfection of the drug-resistant cell lines with siRNA-CSF3R, the results of detecting the proliferation-related proteins and apoptosis-related proteins by Western blotting are as Figure 7 shown. As

[0063] shown, the results of Western blotting analysis after knocking down CSF3R indicated that MCL-1, PCNA, BCL-2, and Caspase3 were downregulated by 3.68-fold, 5.78-fold, 7.8-fold, and 3.21-fold, respectively, and P53, BAX, and Cleaved-Caspase3 were upregulated by 7.67-fold, 6.98-fold, and 8.69-fold, respectively. Figure 8 After transfection of the drug-resistant cell lines with siRNA-CSF3R, the results of detecting the content of STAT5 and p-STAT5 in cytoplasmic and nuclear proteins by Western blotting are as Figure 8It was found that after CSF3R knockdown, Western blot analysis of cytoplasmic and nuclear proteins showed that STAT5 was downregulated by 9.56-fold and 3.83-fold in the cytoplasm and nucleus, respectively, while p-STAT5 was downregulated by 1.35-fold and 3.46-fold in the cytoplasm and nucleus, respectively. To verify the function of CSF3R in drug-resistant cells, this study used a CSF3R-targeting shRNA lentiviral vector (CSF3RLV10N (U6 / mCherry&Puro)-CSF3R-Homo-196) to silence the CSF3R gene in three Veneclare-resistant AML cell lines: HL-60R, MV4-11R, and U937R. Figure 9 Western blot results showed that, compared with the negative control group (shNC), both shRNAs targeting CSF3R (shCSF3R#1 being shCSF3R-196 and shCSF3R#2 being shCSF3R-1158) significantly inhibited the expression of CSF3R protein in drug-resistant cells. After gray value normalization (with β-actin as an internal reference), the average knockdown efficiency of CSF3R in the three drug-resistant cell lines reached 96%, suggesting that lentivirus-mediated CSF3R silencing can efficiently downregulate the protein level of CSF3R in drug-resistant cells.

[0064] After knocking down the CSF3R gene in drug-resistant cell lines using lentiviruses, the IC50 results of different cell lines for veneclade are as follows: Figure 10 As shown. By Figure 10 It can be seen that after knocking down the CSF3R gene in the drug-resistant cell line, the IC50 values ​​of HL60R, MV4-11R and U937R were 1.513 μM, 2.345 μM and 1.269 μM, respectively.

[0065] The expression levels of STAT5, p-STAT5, and proliferation / apoptosis proteins were determined by Western blot analysis in drug-resistant cell lines after CSF3R gene knockdown and the addition of STAT5 activator. Figure 11 As shown. By Figure 11 It can be seen that the addition of STAT5 activator can restore the expression of STAT5 and p-STAT5 in drug-resistant cell lines, and at the same time reverse the knockdown of CSF3R's regulatory effect on proliferation and apoptosis proteins, further confirming that CSF3R mediates AML veneclade resistance by regulating the STAT5 signaling pathway.

[0066] 4. Expression of CSF3R in bone marrow cells of patients with Venecella-resistant AML Bone marrow single-cell sequencing results of patients sensitive to and resistant to Veneclare (n=3) are as follows: Figure 12 As shown. Among them. Figure 12 A represents the cell count of different clusters. Figure 12B represents the proportion of samples from different cell clusters. Figure 12 C is the UMAP diagram with cell typing annotation. Figure 12 D is a volcano plot of significantly differentially expressed genes in the GMP cell population. Figure 12 It can be seen that the expression level of CSF3R in GMP cells of drug-resistant patients is significantly higher than that in Veneclare-sensitive patients.

[0067] The results of measuring the expression level of CSF3R mRNA in bone marrow mononuclear cells of patients with veneclade sensitivity and veneclade resistance are as follows: Figure 13 As shown. SEN represents the sensitive group; RES represents the resistant group. (From...) Figure 13 It can be seen that the expression level of CSF3R mRNA in drug-resistant patients is 1.53 times that in sensitive patients.

[0068] In Western blot experiments, the expression levels of CSF3R protein in veneclade-sensitive and veneclade-resistant patients were measured as follows: Figure 14 As shown. SEN represents the sensitive group; RES represents the resistant group. (From...) Figure 14 It can be seen that the expression level of CSF3R protein in drug-resistant patients is 1.5 times that in sensitive patients.

[0069] Results of CSF3R protein expression levels detected by immunofluorescence assay of bone marrow mononuclear cells in patients sensitive to and resistant to veneclade are as follows: Figure 15 As shown. SEN represents the sensitive group; RES represents the resistant group. (From...) Figure 15 It was found that the expression level of CSF3R protein in bone marrow mononuclear cells of drug-resistant patients (n=8) was 1.89 times that of sensitive patients (n=5).

[0070] III. Animal Experiments – Subcutaneous Tumor Formation Experiment in Nude Mice 1. Tumor Administered subcutaneously at a dose of 1×10 7 MV4-11R-shNC and MV4-11R-shCSF3R cells were subcutaneously inoculated into the right back of nude mice at a dose of 1 cell per mouse. The mean tumor volume (volume = length × width) was measured weekly after inoculation. 2 / 2), plotting tumor growth curves. From day 8 to day 28 after inoculation (i.e., week 1 to week 4), mice were treated with veneclade at a gavage dose of 100 mg / (kg×d). On day 29 after inoculation, nude mice were euthanized, tumor tissue was dissected, weighed, and photographed. Some tumor tissue was fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned for immunohistochemical detection. 2. Immunohistochemical detection Tumor tissue sections were dewaxed to water, antigen retrieval was performed, endogenous peroxidase was blocked with 3% H2O2, and then blocked with goat serum. CSF3R, PCNA, BCL-2, BAX, MCL-1, and STAT5 primary antibodies (1:200 dilution) were added, and the sections were incubated overnight at 4°C. Secondary antibodies were incubated at room temperature for 30 min, followed by DAB staining, hematoxylin counterstaining, dehydration, clearing, and mounting. The sections were observed under an optical microscope, and the positive expression area and optical density were quantitatively analyzed using Image-Pro Plus software to calculate the relative expression level.

[0071] IV. Animal Experiment Results Gross images, tumor growth curves, tumor tissue images, and statistical graphs of average tumor volume and weight in nude mice 4 weeks after inoculation with MV4-11R-shNC and MV4-11R-shCSF3R are shown below. Figure 16 As shown in the figure. Analysis revealed that the average tumor volume in the MV4-11R-shNC group was 449 mm. 3 The average tumor weight was 307.66 mg; the average tumor volume in the MV4-11R-shCSF3R group was 156 mm. 3 The average tumor weight was 114.37 mg. The average tumor volume in the MV4-11R-shNC group was 2.88 times that of the MV4-11R-shCSF3R group, and the average tumor weight was 2.69 times that of the MV4-11R-shCSF3R group. The average weights of the parental cell line MV4-11 and the drug-resistant cell line MV4-11R were 21.15 g and 20.74 g, respectively, with no significant decrease in body weight.

[0072] Immunohistochemical staining results of CSF3R, BCL-2, PCNA, BAX, MCL-1, and STAT5 expression in tumor tissues of different groups of brown mice are as follows: Figure 17 As shown in the figure. The statistical results of the contents of CSF3R, BCL-2, PCNA, BAX, MCL-1, and STAT5 in tumor tissues of different groups of brown rats are as follows. Figure 18 As shown. By Figure 17-18 It can be seen that, compared with the MV4-11R-shNC group, the MV4-11R-shCSF3R group showed down-regulation of CSF3R, down-regulation of anti-apoptotic protein BCL-2, and down-regulation of proliferation-related protein PCNA, while up-regulation of pro-apoptotic protein BAX, down-regulation of drug resistance-related marker protein MCL-1, and down-regulation of STAT5.

[0073] In summary, the present invention can draw the following conclusions: 1. CSF3R is highly expressed in patients with veneclade-resistant AML. By collecting bone marrow samples from patients with vinecella-sensitive and drug-resistant AML, and using single-cell sequencing, qRT-PCR, Western blot analysis, and immunofluorescence techniques, we analyzed multiple dimensions including mRNA level, protein level, and spatial expression location. The results showed that the mRNA and protein expression levels of CSF3R in bone marrow cells of drug-resistant patients were significantly higher than those of sensitive patients, and the difference was most significant in the GMP cell subset. This confirms that high expression of CSF3R is closely related to AML drug resistance to vinecella.

[0074] 2. CSF3R promotes the acquisition of Veneclare resistance in AML cells. Stable veneclade-resistant cell lines (HL60R, MV4-11R, and U937R) were established by inducing three AML cell lines (HL-60, MV4-11, and U937R) with veneclade. CCK8 assay results showed that the IC50 values ​​of the resistant cell lines to veneclade were significantly higher than those of the sensitive cell lines, with resistance folds ranging from 21.36 to 72 times. Further analysis revealed that veneclade treatment significantly upregulated the mRNA and protein expression levels of CSF3R in the resistant cells, while upregulating the expression of proliferation-associated proteins (PCNA) and anti-apoptotic proteins (BCL-2 and MCL-1), and downregulating the expression of pro-apoptotic proteins (BAX and Cleaved-Caspase 3). This confirms that CSF3R can promote AML cells to acquire veneclade resistance by regulating the expression of cell proliferation and apoptosis-related proteins.

[0075] 3. CSF3R promotes STAT5 phosphorylation and nuclear translocation. After treating AML cells with Veneclare, Western blot analysis was used to detect the expression and subcellular localization of STAT5 and phosphorylated STAT5 (p-STAT5). The results showed that after Veneclare treatment, the total protein expression of STAT5 was significantly upregulated, and the expression levels of STAT5 and p-STAT5 in the cytoplasm and nucleus were significantly increased, with the upregulation of p-STAT5 in the nucleus being more significant, suggesting that CSF3R may promote the phosphorylation and nuclear translocation of STAT5.

[0076] 4. CSF3R is an upstream regulator of STAT5; knocking down CSF3R can reverse vinecella resistance in AML. In drug-resistant cell lines, siRNA-CSF3R was introduced to knock down CSF3R expression. Validation showed that the knockdown efficiency of siRNA-CSF3R-1589 and siRNA-CSF3R-1731 reached 70%. After CSF3R knockdown, Western blot analysis showed that the expression of STAT5 and downstream proliferative anti-apoptotic proteins (MCL-1, PCNA, BCL-2) was significantly downregulated, while the expression of pro-apoptotic proteins (P53, BAX, Cleaved-Caspase3) was significantly upregulated. Simultaneously, the expression levels of STAT5 and p-STAT5 in the cytoplasm and nucleus were significantly reduced, with the downregulation of p-STAT5 in the nucleus being more significant. A drug-resistant cell line with stable CSF3R knockdown (knockdown efficiency of 96%) was constructed. CCK8 assays showed that after CSF3R knockdown, the IC50 value of the drug-resistant cells against Veneclair was significantly reduced, and drug resistance was significantly reversed. Adding a STAT5 activator to CSF3R knockdown cells restored the expression of STAT5 and p-STAT5, and reversed the regulatory effect of CSF3R on proliferation and apoptosis proteins, further confirming that CSF3R mediates AML veneclade resistance by regulating the STAT5 signaling pathway.

[0077] 5. In vivo experiments confirmed that CSF3R promotes Veneclare resistance in AML cells. The effect of CSF3R on veneclade resistance in AML was observed in vivo using a subcutaneous tumorigenesis assay in nude mice. Results showed that the average tumor volume in the MV4-11R-shNC group was 2.88 times that of the MV4-11R-shCSF3R group, and the average tumor weight was 2.69 times that of the MV4-11R-shCSF3R group. Immunohistochemical staining confirmed that the expression levels of CSF3R, STAT5, and proliferation-antiapoptotic resistance markers (PCNA, BCL-2, MCL-1) in the tumor tissue of the MV4-11R-shNC group were significantly higher than those in the MV4-11R-shCSF3R group, while the expression level of pro-apoptotic protein (BAX) was significantly lower than that in the MV4-11R-shCSF3R group. These results were consistent with in vitro experiments, confirming that CSF3R can promote AML cell resistance to veneclade in vivo.

[0078] In summary, this invention reveals a close correlation between high CSF3R expression and veneclade resistance in AML patients, suggesting that CSF3R can serve as a biomarker for veneclade-resistant AML. Furthermore, CSF3R could be developed into a reagent or kit for diagnosing or assisting in the diagnosis of veneclade-resistant acute myeloid leukemia.

[0079] Given the inventive discovery of this invention that knocking down CSF3R can effectively reverse the resistance of AML cells to Venecella, CSF3R inhibitors can be developed into drugs for the treatment of Venecella-resistant acute myeloid leukemia.

[0080] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A biomarker for veneclade-resistant acute myeloid leukemia, characterized in that: The biomarker is CSF3R.

2. Application of CSF3R in the preparation of reagents or kits for the diagnosis or auxiliary diagnosis of Venecrane-resistant acute myeloid leukemia.

3. Application of CSF3R inhibitors in the preparation of drugs for treating Venecella-resistant acute myeloid leukemia.

4. Use according to claim 3, wherein: The CSF3R inhibitor includes at least one of a CSF3R protein function inhibitor or a CSF3R gene expression inhibitor.

5. The use according to claim 4, characterized in that: The CSF3R gene expression inhibitor includes at least one of shRNA targeting CSF3R or siRNA targeting CSF3R.

6. Use according to claim 5, wherein: The shRNA targeting CSF3R is expressed in a lentiviral vector.

7. The use according to claim 5, characterized in that: The siRNA targeting CSF3R includes at least one of siRNA-CSF3R-1589 or siRNA-CSF3R-1731; wherein the nucleotide sequence of the positive strand of siRNA-CSF3R-1589 is shown in SEQ ID No. 1, and the nucleotide sequence of the antisense strand of siRNA-CSF3R-1589 is shown in SEQ ID No. 2; the nucleotide sequence of the positive strand of siRNA-CSF3R-1731 is shown in SEQ ID No. 3, and the nucleotide sequence of the antisense strand of siRNA-CSF3R-1731 is shown in SEQ ID No. 4; and / or The nucleotide sequence of the shRNA targeting CSF3R is shown in SEQ ID No. 5 or SEQ ID No.

6.

8. A medicament for treating venetoclax-resistant acute myeloid leukemia, characterized by: Including at least one of CSF3R protein function inhibitors or CSF3R gene expression inhibitors.