Peptides that bind to NKp46
By developing peptides containing VHH domains, antibody-binding domains, or thallium domains, the problem of low activation efficiency of NKp46 in tumor-infiltrating NK cells has been solved, achieving efficient binding and killing of NK cells and cancer cells, and providing a more effective cancer treatment method.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- OMONO ABBY CO
- Filing Date
- 2024-12-20
- Publication Date
- 2026-07-31
AI Technical Summary
In the existing technology, the NKp46 peptide is inefficient in recognizing and activating NK cells, and it is not downregulated in tumor-infiltrating NK cells, making it difficult to effectively bind to and activate NK cells to attack cancer cells.
Develop peptides containing VHH domains, antibody-binding domains, or acetylene domains to enhance NK cell activation and cancer cell killing ability by binding to NKp46. The peptides may contain amino acid sequences with selected VHH antibodies, common light chain antibodies, or ultra-long CDR3 domains to achieve multi-specific binding molecules and enhance the binding of NK cells to cancer cells.
It enhances the binding ability of NK cells to cancer cells, strengthens the killing efficacy of NK cells, and provides a more efficient means of cancer treatment.
Smart Images

Figure CN122497692A_ABST
Abstract
Description
[0001] Cross-referencing
[0002] This application claims the benefits of provisional application serial number 63 / 613,034 filed on December 20, 2023, provisional application serial number 63 / 666,374 filed on July 1, 2024, provisional application serial number 63 / 687,275 filed on August 26, 2024, and provisional application serial number 63 / 717,253 filed on November 6, 2024, all of which are incorporated herein by reference in their entirety.
[0003] The sequence list provided as a sequence list XML file will be incorporated by reference.
[0004] The sequence list, "OMNI-002WO_SEQLIST.xml", in XML format, was submitted along with the document. It was created on December 18, 2024, and is 2,004,172 bytes in size. The contents of the sequence list XML are incorporated herein by reference in their entirety.
[0005] background
[0006] NKp46 is a naturally occurring cytotoxic receptor expressed on most or all mature NK (natural killer) cells. NK cells are weakly activated by NKp46 binding alone. However, co-stimulation of NKp46 with other activating co-receptors (particularly 2B4, DNAM1, or CD2) significantly enhances NK cell activation. NKp46 appears not to be downregulated in tumor-infiltrating NK cells of several cancers (e.g., lung cancer, acute myeloid leukemia, and breast cancer), therefore, NKp46 is a promising target for NK cell conjugates (NKCEs) such as BiKE (bispecific killer cell conjugate) or TriKE (bispecific killer cell conjugate). NKCEs bind NK cells to cancer cells and activate NK cells when they attach to cancer cells. NK cells can also attack virus-infected cells.
[0007] We need novel peptides that specifically recognize NKp46.
[0008] Overview
[0009] This disclosure provides peptides comprising a VHH domain, the VHH domain comprising: (a) CDR1, CDR2, and CDR3 regions identical to those of VHH antibodies selected from Tables 1 and 10; or (b) CDR1, CDR2, and CDR3 regions identical to those of VHH antibodies selected from Tables 1 and 10, except for up to 10 amino acid substitutions in all CDR regions. In these embodiments, the VHH domain binds to NKp46.
[0010] This disclosure also provides peptides comprising an antibody-binding domain comprising: (i) a heavy chain variable domain comprising CDR1, CDR2, and CDR3 regions identical to those of the heavy chain CDR1, CDR2, and CDR3 regions of common light chain antibodies selected from Table 3 or Table 6, or CDR1, CDR2, and CDR3 regions identical to those of the heavy chain CDR1, CDR2, and CDR3 regions of common light chain antibodies selected from Table 3 or Table 6, except for up to 10 amino acid substitutions in all CDR regions; and (ii) a light chain variable domain comprising CDR1, CDR2, and CDR3 regions identical to those of the light chain CDR1, CDR2, and CDR3 regions of a selected common light chain antibody, or CDR1, CDR2, and CDR3 regions identical to those of the light chain CDR1, CDR2, and CDR3 regions of a selected common light chain antibody, except for up to 10 amino acid substitutions in all CDR regions, wherein the antibody-binding domain binds to NKp46.
[0011] This disclosure also provides polypeptides comprising a club-shaped domain, the club-shaped domain comprising an amino acid sequence that is identical to or comprises an amino acid sequence with up to 10 amino acid substitutions relative to the club-shaped domain selected from the ultra-long CDR3 domains in Table 9.
[0012] In some embodiments, the peptide comprises an amino acid sequence that is at least 90% (e.g., at least 95%) identical to the amino acid sequence of a selected VHH antibody, common light chain antibody, or ultra-long CDR3 domain.
[0013] In some embodiments, the peptide may be a multispecific binding molecule comprising a VHH domain, an antibody-binding domain, or a spur domain, and at least one other binding domain (e.g., a binding domain that recognizes a cancer antigen). In these embodiments, the peptide may be a bispecific binding molecule comprising (i) a VHH domain, an antibody-binding domain, or a spur domain (each binding NKp46) and (ii) a binding domain that recognizes a first antigen present on the surface of cancer cells, or a trispecific binding molecule comprising (i) a VHH domain, an antibody-binding domain, or a spur domain (each binding NKp46), (ii) a binding domain that recognizes a first antigen on the surface of cancer cells, and (iii) a binding domain that recognizes a co-stimulatory receptor or a binding domain that recognizes a second antigen on the surface of cancer cells.
[0014] It also provides methods for using this peptide to increase the binding between NK cells and cancer cells, kill cancer cells, and treat cancer.
[0015] In some embodiments, the peptide comprises a VHH domain based on VHH antibodies selected from Tables 1 and 10. The antibodies in Tables 1 and 10 are derived from chickens and therefore can potentially bind to epitopes in NKp46 from various mammals such as humans, mice, and monkeys. These epitopes should not be immunogenic in mammals (as they are already present), and because they are produced in chickens, at least some of the existing VHH domains are considered to bind to the novel epitopes, at least relative to antibodies produced in mammals. These antibodies may activate NK cells more efficiently or have other advantageous aspects. Furthermore, because the VHH domains are expected to bind to NKp46 from various mammals, the peptides of the present invention may be advantageous because their therapeutic potential can be readily tested in mammalian model systems of cancer (e.g., mice).
[0016] In other embodiments, the peptide may comprise the heavy and light chain sequences of a common light chain antibody based on Table 3 or Table 6. In these cases, the multispecific embodiment of the peptide may have a common light chain.
[0017] In other embodiments, the polypeptide may contain a trehalose domain based on the sequence in Table 9. Brief description of the attached diagram
[0019] Figure 1 A schematic diagram of the VHH3 transgenic design is shown. The endogenous chicken heavy chain locus (apical row) underwent genetic modification in chicken primordial germ cells (PGCs) through a series of steps. First, in two steps... 34-35In this study, the germline VDJ gene was deleted via gene targeting. In the targeting step, a loxP site and selectable markers were inserted into the locus (middle row), including the attP site (for insertion of the plasmid carrying attB via phiC31 integrase) and the promoterless neo gene (reverse from the locus). After the VHH3 transgene was inserted, the β-actin promoter on the incoming plasmid (not shown) activated the neo gene, allowing G418-selection in the transfectants. PGCs carrying the VHH3 insertion and selectable markers were injected into embryos to generate germline chimeras. Chimeric males producing germline offspring were mated with females expressing Cre to remove the selectable markers, resulting in the bottom row structure where the VHH3 functional gene, 14 pseudogenes, and intercalation sequences were correctly positioned for expression and spliced into the downstream chicken constant region. The chicken VH pseudogenes remained upstream. (Schematic diagram not to scale.) Abbreviations: cVH, chicken VH gene; D, chicken diversity gene segment; cJH, chicken JH gene; Pseudo cVH, chicken VH pseudogene; B-act-GFP, chicken β-actin promoter-driven EGFP gene; CAG-puro, CAG promoter (chicken β-actin promoter with CMV enhancer)-driven puromycin resistance gene; neo, neomycin resistance gene without promoter.
[0020] Figures 2A-2G Evaluation of transgenic birds in B cell development and subsequent antibody discovery. Based on plasma ELISA, the total circulating IgM or IgY titers of different versions of the transgenic birds (VHH3 / IgL- / - or VHH / tLCi) were compared. Figure 2A The transgenic chickens were compared with wild-type (WT) chickens. The transgenic chickens only exhibited IgM antibodies, without IgY allotype conversion / expression. Flow cytometry analysis of PBMCs was performed using immunostaining against chicken B cell (Bu1), CH1 domain-specific IgM (IgM), polyclonal IgM (IgM poly), light chain (IgL), VHH3 transgene (VHH), and T cell receptor staining controls (TCR1 and TCR2 / 3). Figure 2B The transgenic chickens exhibited a reduced B cell population, lacked the CH1 domain in their expressed IgM antibody, and had no light chain, but positively expressed the VHH3 transgene. Gel electrophoresis image of PBMC RT-PCR products ( Figure 2C The results showed that the size of IgM was reduced after amplification compared to wild-type chickens. No light chain mRNA was observed in the VHH3 / IgL- / - genotype, while reduced-sized light chains were observed in the VHH3 / tLCi genotype. Western blot analysis of plasma samples used to validate IgM or VHH3 transgenic protein expression (…) Figure 2DThe results showed reduced-size IgM (CH1-free) and positive expression of VHH3 transgenic protein compared to the protein weight of wild-type protein expressing full-length IgM and lacking VHH3. Omni was immunized with either NKp46 extracellular domain protein or progranulin (PGRN) protein. dAb A subgroup of chickens was selected to validate immunoreactivity to immunization and to develop candidate monoclonal antibodies. Antigen-specific immune responses were assessed from plasma samples using ELISA. Figure 2E Pre-immunization (PI) and final blood collection (FD) titers were shown for their respective antigen targets or His-tagged control targets used in immunization. No background binding to the target antigen was observed in the PI samples. The FD samples showed strong binding to their respective target antigens and no binding to the His-tagged control antigen. A selected group of NKp46-binding clones were screened by flow cytometry based on their binding to the native protein (transfected CHO-K1 cells). Figure 2F The antibody showed binding with mean fluorescence intensity (MFI) to CHO cells expressing NKp46, but very low binding with untransfected parental CHO cells. A commercially available mouse anti-NKp46 antibody was used as a biological positive control. A select group of NKp46-binding clones were also screened in cell cultures for their ability to induce the release of IFNγ from primary NK cells. Figure 2G Of the clones tested, two showed a significant ability to induce IFNγ compared to the culture medium control threshold. Iomycin was used as a positive control for the ionophore. The isotype control antibody was a non-binding IgG1 antibody that matched the antibody isotype of the experimental sample. The reference antibodies NKp46-1, NKp46-2, and NKp46-3 were publicly available NKp46 antibodies.
[0021] Figures 3A-3B Sequence analysis of antigen-specific HcAbs. Mutation frequencies of the VH regions against PGRN and NKp46 were calculated and compared to the frequencies of potential donor residues in the pseudogene library. VH sequences targeting PGRN (38 clones) or NKp46 (128 clones) were aligned with germline VHH3 sequences, and the mutation frequency at each position is shown in the WebLogo graph. Figure 3A The data for NKp46 are shown. The top figure shows the results of antibody cloning, and the bottom figure shows the same analysis of pseudogene sequences in the VHH3 construct used for comparison. The location of stabilization framework changes in the VHH3 functional genes (relative to the human VH3-23 gene) is indicated by an asterisk below the top labeling figure. The frequency of use of each pseudogene in the VHH3 construct for gene conversion against the anti-NKp46 HcAb clone is shown. Figure 3BFirst, the gene conversions and their pseudogene origins were identified. Then, for each pseudogene, the percentage of HcAb clones in which the pseudogene CDR was used for the mutant clone was calculated. Clones and CDRs in which no gene conversions were identified or in which gene conversions were identified but not clearly defined were not included. Gene conversions performed by the three CDRs are shown in different colors. Instances of gene conversions performed by each individual pseudogene CDR were found. The reference VHH3 sequence is SEQ ID NO:2197.
[0022] Figure 4 Genetic conversions in CDRs. Genetic conversion segments in the CDRs of the anti-NKp46 HcAb clones have been localized to their pseudogene sources. For each clone shown, the CDR is represented by lines, and boxes indicate the location and approximate length of each gene conversion segment. The numbers in the boxes represent the identification number of the pseudogene that provided the sequence. Segments with two or more numbers indicate that the pseudogene cannot be explicitly identified, and any listed pseudogene may have provided the sequence. Only CDRs are shown because the VHH3 construct pseudogene does not exhibit diversity in the FR, so gene conversions are only observable in the CDRs. CDRs without boxes do not have identifiable gene conversions, but all CDRs do show mutations compared to the germline VHH3 sequence. Somatic hypermutations and point mutations are not shown in the figures. Representative clones from different lineages are shown.
[0023] Figure 5 Immunogenicity plot. A computer simulation assessment of the immunogenicity of OMNIDAB® heavy-chain-only molecules in a randomized subgroup was performed, where antibody sequences were analyzed as overlapping 9-mer segments, and the presence of class II restricted HLA ligands and putative T-cell epitopes was screened using EpiVax software to calculate binding potential. A Tregitope-adjusted EpiMatrix score <-15 was considered low predictive immunogenicity, and a score <-30 was considered minimal immunogenicity. A JanusMatrix human homology score >5 for the putative T-cell epitope indicated reduced immunogenicity potential.
[0024] Figures 6A-6B Anti-PGRN and anti-NKp46 Omni dAb Cloning kinetics and affinity determination. Scatter plot showing affinity distribution ( Figure 6A The graph shows the highest, median, and lowest affinities. It also displays the high, intermediate, and weak affinities of selected NKp46 clones (reported on the graph as K0). D Multiple dynamic characteristic spectra of (value) Figure 6B The global fit is shown. The measured data is displayed in blue-green, and the global fit is overlaid in red.
[0025] Figures 7A-7CDevelopability assessment of antibody clones. For selected anti-PGRN ( ) present in sdAb-Fc form. Figure 7A ) and anti-NKp46 ( Figure 7B Omni dAb Differential scanning fluorescence analysis was performed on the antibody, which showed a high melting temperature (T0). m ) and aggregation temperature (T agg AC-SINS was performed to evaluate the self-association of selected anti-PGRN antibodies and anti-NKp46 clones. Figure 7C Positive controls (fenatoluzumab, vetuzumab, and trastuzumab) and negative controls (bercoxetine and dugoutuzumab) with known low and high AC-SINS values were used, respectively. 32,33 The FDA-approved VHH-Fc antibody caplacizumab was also included as a reference in the sdAb-Fc form.
[0026] Figure 8 Pseudogene sequence alignment. The VHH3 transgene contains a functionally expressed variable region (VHH3, top row) and 14 pseudogenes (P-VHH arranged below). Alignments include the human VH3-23 / D / JH4 variable region (second row) for comparison to indicate the location of stabilizing frame mutations. These mutations can be present in camel VHH domains and contribute to their overall stability and solubility. Changes relative to the VHH3 reference sequence are color-coded. The frames in the pseudogenes all match the functional VHH3 sequence, while the CDRs are diverse sequences derived from human germline VH3 family genes (for CDR1 and CDR2) or from human cell sequences (CDR3). Pseudogenes are arranged in the order they are found in the transgene, with P-VHH-15 closest to VHH3 and P-VHH-28 furthest. From top to bottom: SEQ ID NO 2196-2211.
[0027] Figure 9 The overall average hydrophilicity (GRAVY) values of FR and CDR in NKp46 HcAb were calculated. The GRAVY value of FR or CDR for each line is represented by a vertical dashed line. Negative and positive values represent the hydrophilicity and hydrophobicity values of FR, respectively. The GRAVY values of the VH region are plotted as a frequency map. CDR shows significantly more variability and a trend toward increased hydrophilicity, while FR shows less variability, consistent with the diversity pattern shown in Figure 3.
[0028] Figures 10A-10B CDR3 length. Anti-PGRN and anti-NKp46 Omni plotted. dAb CDR3 length of the antibody ( Figure 10AThe percentage of clones in each group with the length indicated on the X-axis is plotted. The germline length is 17 amino acids (AA), and approximately half of the antigen-specific clones retain this length, with variations towards shorter and longer lengths also present. For PGRN clones, a group of 10 clones contains a length of 9 AA. These clones all target the subdomain p and cluster together on the tree, with some exhibiting high affinity. For comparison, the CDR3 length in pseudogenes is plotted. Figure 10B The CDR3 length of most pseudogenes is longer than the 17 amino acids in the functional VHH3 gene.
[0029] Figure 11A and Figure 11B Analytical size exclusion chromatography (aSEC) chromatogram. Seventeen anti-NKp46 Omni antibodies were purified. dAb The antibody was subjected to aSEC, which confirmed the monomer peak and homogeneity peak. No aggregation peak was observed. In the aSEC curve, mAu on the y-axis corresponds to milliabsorbance units.
[0030] Figures 12A-12D The capture kinetics data for NKp46 are shown. Schematic diagrams of two capture methods are shown—one for NKp46-resistant Omni. dAb Standard anti-human Fc capture method for determining the affinity of bispecific antibodies co-cloned with OMNICLIC® light chain. Figure 12A ) and tethering (sandwich) method ( Figure 12B The standard anti-hFC capture method is used. Figure 12C or EGFR tethering (sandwich) method Figure 12D The product derived from anti-NKp46 Omni dAb The diversity kinetic profiles of selected bispecific antibodies from the OmniClic clone (K) are reported below the figure. D Global fitting of values. Measured data are shown in blue-green, and the global fit is overlaid in red. The data shows that simultaneous binding of EGFR and NKp46 does not affect NKp46 binding kinetics.
[0031] Figures 13A-13C The binding kinetics of the selected EGFR-NKp46 bispecific antibody are shown. A schematic diagram of the standard anti-human Fc capture assay is also shown. Figure 13A (This shows the results from two anti-NKp46 Omni) dAb Clones and an OmniClic clone ( Figure 13A and Figure 13BGlobal fitting of the diversity kinetic profiles of selected bispecific antibodies. Measured data are shown in blue-green, and the global fit is superimposed in red. The data show that reformatting into the NKp46 bispecific construct, whether for active or silent Fc, has no effect on EGFR binding kinetics.
[0032] Figure 14 The capture kinetics of selected NKp46 stem-knuckle (SK) IgG antibodies are shown. A schematic diagram containing both monospecific and bispecific forms of NKp46 knuckle is displayed. A global fit of the kinetic profiles of the selected monospecific and bispecific forms shows high affinity binding to either form. Measured data are shown in blue-green, and the global fit curves are superimposed in red. The data suggest that knuckle can be used as a universal building block for constructing custom molecular forms.
[0033] Detailed description
[0034] Before further describing the invention, it should be understood that the invention is not limited to the specific embodiments described, as these embodiments can certainly be varied. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting, as the scope of the invention will be defined only by the appended claims.
[0035] Where a numerical range is provided, it should be understood that, unless the context clearly specifies otherwise, every intermediate value between the upper and lower limits of the range (to one-tenth of the lower limit unit, unless the context clearly specifies otherwise), and any other said or intermediate values within the range, are included in this invention. The upper and lower limits of these smaller ranges may be independently included within that smaller range and are also included in this invention, subject to any specifically excluded limits within the range. When the range includes one or both of the upper and lower limits, the range excluding one or both of those included limits is also included in this invention.
[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods and materials similar to or equivalent to those described herein may also be used to practice or test the invention, preferred methods and materials are described hereafter. All publications mentioned herein are incorporated herein by reference to disclose and describe methods and / or materials relating to the cited publications.
[0037] It must be noted that, as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to “a combined structural domain” includes multiple combined structural domains. It should also be noted that claims may be drafted to exclude any optional elements. In this way, the statement is intended to serve as a prior basis for the combined use of such exclusive terms such as “solely,” “merely,” etc., or the use of “negative” limitations, in conjunction with the description of the claim elements.
[0038] The publications discussed herein are provided only for their disclosure prior to the filing date of this application. Nothing herein should be construed as an admission that the invention does not precede these publications by virtue of being an earlier invention. Furthermore, the provided disclosure date may differ from the actual disclosure date, which may require independent verification.
[0039] In the following description, CDR is defined by Lefranc's IMGT system (Dev.Comp.Immun.2003 27:55–77).
[0040] VHH domain peptide
[0041] VHH antibodies are known in the art and possess a heavy chain variable domain that can autonomously fold and bind to an epitope, i.e., they do not significantly aggregate in the absence of the associated light chain. These antibodies are referred to in other publications as “heavy chain only,” “HCO,” or single-domain antibodies (sdAbs), shark antibodies, camel antibodies, and nanobodies. VHH antibodies are naturally found in sharks, camels, and llamas. However, several strategies exist for generating such antibodies from VH antibodies. For example, see, for instance, Janssens et al. (Proc. Natl. Acad. Sci. 2006 103:15130-5), Brüggemann et al. (Crit. Rev. Immunol. 2006 26:377-90), Zou et al. (J. Immunol. 2005 175:3769-79), and Nguyen et al. (Immunology 2003 109:93-101). VHH variable regions can be prepared by introducing substitutions into the variable domains of VH antibodies. Such stabilized or “camelized” VH antibodies are referred to herein as VHH antibodies, and it is apparent that the term “VHH” can be replaced by the terms “heavy chain only,” “HCO,” “autonomous heavy chain,” or “single domain,” as these terms are intended to refer to the same thing. In this disclosure, VHH antibodies are prepared from chickens genetically engineered to produce VHH antibodies. Advantageous characteristics of VHH antibodies include their small size, high solubility, high stability, and excellent in vivo tissue penetration. VHH antibodies can be readily linked by genetic engineering to, for example, Fc-domains, other nanobodies or single-chain antibodies, peptide tags, or toxins, and can be chemically conjugated at specific sites to drugs, radionuclides, photosensitizers, and nanoparticles. The binding domains of VHH antibodies do not require light chains to fold correctly or bind to antigens. See, for example, Bever et al. (Anal Bioanal Chem. 2016 Sep; 408:5985–6002). Like conventional VH antibodies, VHH antibodies have three CDRs (CDR1, CDR2, and CDR3) flanked by a framework. The structure of the binding domain of the VHH antibody (which may be referred to as the "variable domain") is as follows: FW1-CDR1-FW2-CDR2-FW3-CDR3-FW4 (for a detailed description of the VHH structure, see, for example, Noel et al., Biochimie 2016 131:11-19).
[0042] Using Tables 1, 2, 10, and 11 as references, this disclosure provides polypeptides comprising a VHH domain comprising: (a) CDR1, CDR2, and CDR3 regions identical to those of VHH antibodies selected from Tables 1 and 10; or (b) CDR1, CDR2, and CDR3 regions identical to those of VHH antibodies selected from Tables 1 and 10, except for up to 10 amino acid substitutions (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) in all CDR regions, wherein the VHH domain binds to NKp46.
[0043] In some embodiments, the amino acid sequence of the VHH domain may have at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity with the variable domain of a selected VHH antibody. These sequences are shown in Tables 2 and 11.
[0044] In any embodiment, the polypeptide containing the VHH domain may contain at least the FR2 of the selected VHH antibody (i.e., the sequence between CDR1 and CDR2), or the same FR2 as the FR2 of the selected VHH antibody except that it has at most 10 (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1) amino acid substitutions.
[0045] In some implementations, the VHH can be humanized, i.e. modified to make it more like a human antibody and thus have lower immunogenicity, as is known in the methods described.
[0046] Common light chain antibodies
[0047] Common light chain antibodies are antibodies composed of a heavy chain and a light chain produced in animals with a “fixed” light chain (i.e., a light chain with reduced diversification capacity). Antibodies produced by such animals have a diversified heavy chain and a common light chain (i.e., a “common” light chain). In these animals, the heavy chain sequence is diversified and, when paired with the light chain (which in many cases would be the human light chain), enables high-affinity antigen-specific binding and broad epitope diversity. The light chain provides the correct structure for the assembly of the complete antibody molecule but is a passive partner for antigen binding. Transgenic animals that produce common light chain antibodies include rats (see, for example, Harris et al. (Front Immunol. 2018 24:9:889)) and chickens (Ching et al. (MAbs. 2021; 13(1):1862451)).
[0048] Common light chain antibodies are particularly useful in the production of multispecific antibodies because it is advantageous if the light chain is common in all branches of the multispecific antibody, while binding specificity is determined only by the heavy chain. For example, the expression of bispecific antibodies is simplified because it only requires two heavy chains and one common light chain.
[0049] Common light chain antibodies have a conventional "VH" structure and possess both heavy chain and light chain sequences. The heavy and light chains of common light chain antibodies have the following structure: FW1-CDR1-FW2-CDR2-FW3-CDR3-FW4.
[0050] Using Tables 3 and 4 (which describe rat common light chain antibodies) and Tables 6 and 7 (which describe chicken common light chain antibodies) as references, this disclosure provides polypeptides comprising antibody-binding domains comprising heavy chain variable domains and light chain variable domains (which may be in single-chain or two-chain form (e.g., in scFv or Fab form)), wherein the binding domain comprises: (i) a heavy chain variable domain comprising CDR1, CDR2, and CDR3 regions identical to those of the heavy chain CDR1, CDR2, and CDR3 regions selected from the common light chain antibodies of Tables 3 or 6, or up to 10 (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) amino acids from all CDR regions. In addition, the remaining CDR1, CDR2, and CDR3 regions are identical to those of the heavy chain CDR1, CDR2, and CDR3 regions of the common light chain antibodies selected from Table 3 or Table 6; and (ii) a light chain variable domain comprising the same CDR1, CDR2, and CDR3 regions as the light chain CDR1, CDR2, and CDR3 regions of the selected common light chain antibody, or the remaining CDR1, CDR2, and CDR3 regions are identical to those of the light chain CDR1, CDR2, and CDR3 regions of the selected common light chain antibody, except for up to 10 (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) amino acid substitutions in all CDR regions, wherein the antibody-binding domain binds to NKp46.
[0051] In some embodiments, the antibody-binding domain may include: (a) (i) a heavy chain variable domain containing the same CDR1, CDR2, and CDR3 regions as the heavy chain CDR1, CDR2, and CDR3 regions of common light chain antibodies selected from Table 3 or Table 6; and (ii) a light chain variable domain containing the same CDR1, CDR2, and CDR3 regions of the light chain of a selected common light chain antibody; or (b) (i) a heavy chain variable domain comprising CDR1, CDR2, and CDR3 regions identical to the heavy chain CDR1, CDR2, and CDR3 regions of a selected common light chain antibody, except for up to 10 amino acid substitutions (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) in all CDR regions; and (ii) a light chain variable domain comprising CDR1, CDR2, and CDR3 regions identical to the light chain CDR1, CDR2, and CDR3 regions of a selected common light chain antibody, except for up to 10 amino acid substitutions (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) in all CDR regions, wherein the antibody-binding structure binds to NKp46.
[0052] In some embodiments, the antibody-binding domain may have one chain with the same CDR as the antibodies from Tables 3 and 6, while the CDRs of the other chains are identical to another chain of the selected antibody, except for up to 10 amino acid substitutions (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) in all CDRs. In these embodiments, the binding domain may include: (a) (i) a heavy chain variable domain containing the same CDR1, CDR2, and CDR3 regions as the heavy chain CDR1, CDR2, and CDR3 regions of the common light chain antibodies selected from Table 3 or Table 6; and (ii) a light chain variable domain containing the same CDR1, CDR2, and CDR3 regions as the light chain CDR1, CDR2, and CDR3 regions of the selected common light chain antibodies, except for up to 10 amino acid substitutions (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) in all CDR regions; or (b)(i) a heavy chain variable domain containing the same CDR1, CDR2, and CDR3 regions as the heavy chain CDR1, CDR2, and CDR3 regions of the common light chain antibodies selected from Table 3 or Table 6, except for up to 10 amino acid substitutions (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) in all CDR regions. (ii) a light chain variable domain comprising the same CDR1, CDR2, and CDR3 regions as the light chain CDR1, CDR2, and CDR3 regions of a selected common light chain antibody; wherein the antibody-binding domain binds to NKp46.
[0053] In some embodiments, the antibody-binding domain comprises a heavy chain variable domain having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity with the heavy chain variable domain of the selected antibody and a light chain variable domain having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity with the light chain variable domain of the selected antibody. These sequences are shown in Tables 4 and 7.
[0054] In some implementations, the antibody-binding domain can be expedited (i.e. modified) to make it more like a human antibody, thereby theoretically having lower immunogenicity, and such methods are known.
[0055] pestle structural domain
[0056] Bovines (i.e., dairy cows or bovine animals) produce antibodies with an ultralong CDR H3 rich in cysteine (ranging from 30 to 70 amino acids in length) that folds into distinctive “stem and pestle” domains, with the pestle protruding far beyond the antibody surface (see, for example, Huang et al., Proc. Natl. Acad. Sci. 2023 120: e2303455120). When these pestles are expressed independently, i.e., independently of the rest of the antibody, they retain their ability to bind to the antigen. In these embodiments, the pestles can be expressed as a fusion protein, which is then cleaved to release the pestles (see, for example, Huang et al., Proc. Natl. Acad. Sci. 2023 120: e2303455120). Alternatively, the pestles can be cleaved from antibodies or Fab scaffolds (Macpherson et al., PLoS Biol 2020 18: e3000821) or chemically synthesized (Macpherson et al., ACS Chem. Biol. 2021 16, 9, 1757–1769). These pestles (referred to herein as "pebble domains," and elsewhere as PICOBODIES) TMA club-shaped domain is the smallest known antibody fragment capable of independently binding to an antigen. The club-shaped domain can be expressed alone or as a fusion with another protein (referred to herein as a "fusion partner"), wherein the club-shaped domain can be located at the N-terminus, C-terminus, or within the fusion partner. If the fusion partner is an antibody, the club-shaped domain can be fused to the N-terminus or C-terminus of the heavy or light chain (in which case the antibody may be bispecific because the variable domain may be intact), or it can be located within the variable domain of the antibody (e.g., in the heavy chain CDR3). In embodiments where the club-shaped domain is fused with another protein, in some cases, the club-shaped domain may additionally contain a stem and / or flexible linker connecting the club-shaped domain to the protein. For example, if the club-shaped domain is in the heavy chain CDR3, it may contain a stem to allow it to protrude from the rest of the antibody. If the club-shaped domain is expressed together with a stem, there is a virtually unlimited number of sequences available for the ascending and descending regions of the stem. Specifically, in the context of bovine antibodies, the stem has a purely structural function (i.e., it does not participate in binding). In bovine antibodies, the stem is a β-sheet (consisting of two antiparallel β-chains bonded by hydrogen). The stem sequences should be interchangeable between antibodies because, functionally, they serve only to keep the stem away from the rest of the antibody while keeping the ends of the stem close to each other. Since the sequences of thousands of bovine antibodies are publicly available or readily accessible, a large number of options are available. Furthermore, the method of de novo design of β-sheets (consisting of two antiparallel β-chains) is well known (see, for example, Hecht et al. (Proc Natl AcadSci US A. 1994 91:8729–8730), Marcos (Nat Struct Mol Biol. 2018 25:1028–1034), and Pan et al. (…). J. Biol. Chem. (2021 296, 100558, etc.), therefore, stems can be easily designed.
[0057] Therefore, the length of the clubbeam domain is typically in the range of 15 to 50 amino acids, rich in cysteine (i.e., it may contain 4–10 cysteines, such as 4, 6, 8, or 10 cysteines), and can be based on ultralong CDR3 antibodies (which may be produced, for example, by cattle or another species that naturally produces such antibodies, or by another species engineered to produce such antibodies (e.g., chickens)). The clubbeam domain has the potential to bind antigens with concave epitopes and may therefore be of particular value to certain targets. More details about the clubbeam domain can be found in, for example, the following literature: Svilenov et al. (Nature Com. 2021 12:6737), Huang et al. (Proc. Natl. Acad. Sci 2023 120 (39) e2303455120), and Passon et al. (Biotechnol Adv. 2023 :64:108120).
[0058] Table 9 of this disclosure provides a number of sequences of ultra-long CDR H3s from bovine antibodies that bind to NKp46. These sequences have a stem sequence at the end and an internal club domain. The club domains of the ultra-long CDR H3s are underlined in the sequences of Table 9. In some embodiments, the polypeptide may comprise the club domains underlined in this table, wherein the club domains may contain the same amino acid sequence as the club domains selected from the ultra-long CDR3 domains of Table 9, or contain an amino acid sequence with up to 10 (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) amino acid substitutions relative to the club domains selected from the ultra-long CDR3 domains of Table 9. In some embodiments, the club domain may be linked to a stem sequence (e.g., a sequence already linked to this domain in Table 9 or another pair of sequences forming an antiparallel β-chain). In some embodiments, the club domain may contain an amino acid sequence that has at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity with a club domain selected from Table 9 or an ultra-long CDR3.
[0059] In some embodiments, the club-shaped domain may be grafted together with the stem sequence into the heavy chain CDR3 region of the antibody, i.e., replacing the heavy chain CDR3 region of the antibody. In these embodiments, the antibody may be a human antibody, a humanized antibody, or a variant thereof, said variant having been modified to accommodate an ultralong heavy chain CDR. Thus, in some embodiments, some embodiments provide an antibody having a heavy chain CDR3 containing a club-shaped domain, wherein the club-shaped domain has been grafted onto said antibody.
[0060] Multispecific antibodies
[0061] In some embodiments, the peptide is a multispecific binding molecule comprising a VHH domain, an antibody-binding domain, or a ligand domain as described above, and at least one other binding domain. These domains are linked by suitable linkers, many of which are known in the art. The at least one other binding domain may be another VHH domain, scFv, a ligand for a cell surface receptor, or it may be based on an alternative scaffold. In these embodiments, at least one of the other binding domains can recognize a cancer antigen (i.e., an antigen found on the surface of cancer cells). Such antigens include, for example, CD19, CD20, BCMA, ALPP, CS1 (SLAMF7), CLDN18.2, AXL, ROR2, TM4SF1, ICAM-1, L1CAM (CD171), CD4, CD5, CD7, CD10, CD38, CEA, FLT3, CD70, CD30, CD37, or CD147, although many other antigens are also present. The cancer antigen may be a blood cell antigen or a solid tumor antigen, depending on how the peptide is used. In an alternative implementation, at least one additional binding domain can recognize viral antigens on cells infected with the virus.
[0062] In these embodiments, the peptide can be an NK cell conjugate (i.e., NKCE, or killer cell conjugate), wherein in some embodiments, the peptide can be a bispecific NK cell conjugate (referred to as “BiKE” in some publications) or a trispecific NK cell conjugate (referred to as “TriKE” in some publications). BiKE and TriKE are reviewed in Felices et al. (Methods Mol Biol. 2016; 1441:333–346). Such molecules tether NK cells to tumor cells and induce their activation at that site. BiKE and TriKE are molecules containing a single variable portion of an antibody, said single variable portion being linked to one (BiKE) or two (TriKE) variable portions from other antibodies with different specificities. Thus, in some embodiments, the peptide can be a bispecific binding molecule comprising (i) a VHH domain, an antibody-binding domain or a ferrule domain, and (ii) a binding domain that recognizes a first antigen found on the surface of cancer cells. In other embodiments, the peptide may be a bispecific binding molecule comprising (i) a VHH domain, an antibody-binding domain, or a ferrule domain, (ii) a binding domain that recognizes a first antigen on the surface of cancer cells, and (iii) a binding domain that recognizes a co-stimulatory receptor or a binding domain that recognizes a second antigen on the surface of cancer cells. In these later embodiments, it has been noted that NKp46 synergizes with other immune receptors (referred herein to as co-stimulatory receptors or co-receptors) (e.g., 2B4, DNAM1, and CD2 (see, for example, Zmai et al., Cells 2020 9:753)), and therefore, the bispecific binding molecule may bind to NKp46 as well as one or more of 2B4, DNAM1, or CD2. In some embodiments, NKp46 provides a better alternative to CD16 (another NK cell-specific stimulatory immune receptor) because CD16 levels are downregulated by NK cells in the tumor microenvironment.
[0063] Multispecific antibodies can exist in a variety of forms, including but not limited to IgG-like antibody forms (including Fc domains) and non-IgG-like antibody forms (without Fc domains). Multispecific antibodies with IgG-like antibody forms can exist in a variety of forms, including but not limited to knock-in-hole (KIH), trifunctional bispecific antibodies (TrioMab), controlled Fab arm exchange bispecific antibodies (Duobody), κλ body, cross-interchangeable domain bispecific antibodies (CrossMab), common light chain, chain exchange engineered domain body (SEED backbone bispecific antibodies (SEEDBody)), asymmetric heterodimer Fc, dual-action Fab (DAF), dual variable domain immunoglobulin (DVD-Ig), IgG-scFv, Fab-Fab-Fc, dual-site Fab-type IgG bispecific antibodies (DutaMab), and DutaFab.
[0064] Non-IgG-like antibody forms may completely lack the Fc region. For example, the Fab, Fv, and VHH antibody regions can be genetically engineered and combined in various orientations and pairings. Non-IgG-like multispecific antibodies can take many different forms, including but not limited to bivalent amphiphilic and retargeting proteins (DART), tetravalent DART, bispecific T cell conjugates with extended half-life (HLE-BiTE), bispecific T cell conjugates (BiTE), immune mobilization monoclonal T cell receptors (ImmTAC), tandem biantibodies (TandAb), bispecific cytotoxic T cell conjugates (BiKE), trispecific cytotoxic T cell conjugates (TRiKE), multispecific scFV single-chain variable fragments, trispecific T cell activation constructs (TriTAC), bispecific nanobodies, and cross-variable regions (CODV).
[0065] Multispecific antibodies can be bifunctional, trifunctional, or even tetrafunctional. Multispecific antibodies can be IgG fusion proteins. These antibody forms have been reviewed in various publications, including Elshiaty et al. (2021), International Journal of Molecular Science, 22(11):5632; Jin et al. (2022), Signal Transduction Targeted Therapy, 7(39); Weidle et al. (2013), CancerGenomics & Proteomics 10:1-18.
[0066] Modified Fc domain
[0067] The peptides disclosed herein may have a modified Fc domain (i.e., an Fc domain with enhancing or de-enhancing function) (see, for example, van der Horst et al. Cancers (Basel) 2020 12:3041 and Wilkinson et al. (PLoS One. 2021; 16: e0260954) or no Fc domain. In some embodiments, the peptide may have an Fc region modified to eliminate or reduce binding to the Fc receptor. Amino acid substitutions for eliminating or reducing Fc binding to the Fc receptor include, but are not limited to: L234A / L235A (LALA), L234F / L235E / P331S (FES), L234F / L235Q / K322Q (FQQ), L234A / G237A, L234A / L235A / G237A, L234A / L235A / G237A / P238S / H268A / A330sS / P330S, L234A / L235E, G236R / L328R, L234S / L235T / G236R (STR), and L234A / L235A / K322A. See, for example, Wilkinson et al. (PLoS One. 2021; 16: e0260954).
[0068] Antibody-drug conjugates (ADCs)
[0069] In any embodiment, the peptide of the present invention may be conjugated with a drug. In these embodiments, the peptide may be a component of an antibody-drug conjugate. An antibody-drug conjugate (ADC) is a targeted drug that delivers a therapeutic agent to cells (e.g., cancer cells). An ADC delivers the drug via a linker connecting a peptide (typically an antibody) to a specific target expressed on the cell. In some embodiments, upon binding to its target, the ADC releases the active agent into or onto the cell. In some embodiments, the active agent is not released, but rather the peptide holds the drug near a site where it is considered effective (e.g., close to its binding site on a receptor). Antibody-drug conjugates are reviewed in several publications, including Peters (Biosci Rep. 2015 35: e00225).
[0070] ADC payload
[0071] The ADCs disclosed herein comprise pharmacologically active agents, such as enzyme inhibitors, ion channel inhibitors, peptides, nucleic acids, small molecules, or cytotoxic and / or cellular inhibitors, which may be referred to as the "payload" of the ADC. The payload of the ADCs disclosed herein can be any pharmacologically active agent or drug suitable for achieving the desired physiological effect (e.g., regulating gene expression, regulating enzyme activity, regulating the activity of signal transduction pathways, inhibiting cell division). In various embodiments, the pharmacologically active agent can exert physiological effects associated with the treatment of, for example, cancer, cardiovascular disease, gastrointestinal disorders, genitourinary disorders, hematological disorders, hormonal disorders, infectious diseases, metabolic disorders, muscle disorders, neurological disorders, ophthalmic disorders, and respiratory disorders. The payload can be an anti-inflammatory agent, a receptor ligand (e.g., a growth factor or cytokine), or a nucleic acid (e.g., an oligonucleotide) that alters gene expression in cells to which the polypeptide binds.
[0072] In some embodiments, the payload of the ADC of this disclosure may be a cell inhibitor and / or a cytotoxic agent. A cytotoxic agent is a drug that causes cell death, while a cell inhibitor is a drug that inhibits cell proliferation. In practice, many drugs act as both cytotoxic agents and cell inhibitors depending on the dosage or biological context. Therefore, the terms "cytotoxic" and "cell-inhibiting" are used interchangeably herein. Both cytotoxic agents and cell inhibitors can be chemotherapeutic agents and can shrink and / or limit tumor growth. Cytotoxic agents and / or cell inhibitors suitable for use as payloads in ADCs have been reviewed in several publications, including: Theocharopoulos et al. 2021 (Theocharopoulos, Charalampos, et al. "Antibody-drug conjugates: Functional principles and applications in oncology and beyond ."Vaccines 9.10 (2021):1111) and Anand et al. 2023 (Anand, Uttpal, et al. "Cancer chemotherapy and beyond: Current status, drug candidates, associated risks and progress in targeted therapeutics." Genes & Diseases 10.4 (2023):1367-1401), the full content of each reference is incorporated into this paper by reference.
[0073] Microtubule inhibitors
[0074] In some embodiments, the cytotoxic payload of the ADC disclosed herein may be a microtubule inhibitor or a microtubule disruptor. Microtubule assembly plays a crucial role in cell division and cell transport, as well as other key cellular functions, and inhibition of microtubule assembly leads to cell division arrest and / or cell death. In some cases, the microtubule inhibitor may be auristatin or its analogues and derivatives. Auristatin is isolated from the sea hare (… Dolabella Auricularia Aurostatin is a synthetic analogue of the natural molecule, sea haretoxin 10. Suitable aurostatin and aurostatin derivatives used as payloads include, but are not limited to, monomethyl aurostatin E (MMAE; CAS Registry No. 474645-27-7), monomethyl aurostatin F (MMAF; CAS Registry No. 745017-94-1), and monomethyl aurostatin D (MMAD; CAS Registry No. 203849-91-6). For example, aurostatin MMAE has been used as a cytotoxic payload in clinically approved ADC drugs such as brentuximab vemetiximab, izumab oxozamicin, gemtuzumab oxozamicin, and vepertuzumab. In some cases, microtubule inhibitors maytansine alkaloids or derivatives thereof. Maytansine alkaloids are derived from the natural molecule maytansine (isolated from the ovary-leaved maytans). Suitable maytansine alkaloids and maytansine alkaloid derivatives for use as payloads include, but are not limited to, maytansine (CAS Registry No. 35846-53-8) and maytansine (DM1; CAS Registry No. 139504-50-0). For example, maytansine alkaloid DM1 has been used as a cytotoxic payload in the clinically approved ADC drug trastuzumab emtansine. Other suitable microtubule inhibitors include, for example, but not limited to, colchicine (CAS Registry No. 64868), sclerotinib B (CAS Registry No. 103614-76-2), rhizomycin (CAS Registry No. 90996-54-6), paclitaxel (CAS Registry No. 33069-62-4), and vinca alkaloids such as vindesine (CAS Registry No. 53643-48-4). Microtubule inhibitors / disruptors are known in the art and are described, for example, in the following literature: Wang et al. 2023 (Wang, Xingyu, et al. "Microtubule-targeting agents for cancer treatment: Seven binding sites and three strategies."). MMedComm–Oncology 2.3 (2023): e46) Its entire content is incorporated into this article through citation.
[0075] DNA damage agents
[0076] In some embodiments, the cytotoxic payload of the ADC disclosed herein may be a DNA damaging agent. DNA damaging agents act through a variety of mechanisms, including, for example, alkylating agents, DNA intercalating agents, and topoisomerase inhibitors.
[0077] In some cases, DNA damaging agents can be chachiin or its derivatives. Chachiin is derived from the actinomycete *Micromonospora echinococcus* subsp. *calichii*. Micromonospora echinospora spp. Calichensis Calicacin is an isolated anticancer antibiotic. Calicacin binds to the minor groove of DNA in a site-specific manner and generates reactive biradical species through reductive cleavage by thiols present in the cell, leading to DNA strand breaks and subsequently cell death. Suitable calicacin and calicacin derivatives for use as payloads include, but are not limited to, calicacin γ1 (CAS Registry No. 108212-75-5) and N-acetyl-γ calicacin 1,2-dimethylhydrazine. For example, calicacin has been used as a cytotoxic payload in the clinically approved ADC drugs izizumab ozomicin and gemtuzumab ozomicin. Calicacin and its derivatives are known in the art and described, for example, in the following literature: Maiese et al. 1989 (Maiese, William M., et al., "Calicheamicins, a novel family of antitumor antibiotics: taxonomy, fermentation and biological properties."). The Journal of antibiotics 42.4 (1989):558-563), the entire contents of which are incorporated herein by reference.
[0078] In some cases, DNA damaging agents can be pyrrolobenzodiazepines (PBDs) or derivatives thereof. PBDs can alkylate and crosslink opposing DNA strands, preventing strand separation and inducing cell death during genome replication. Suitable PBDs used as payloads include, but are not limited to, tesirine (SG3249; CAS Registry No. 1595275-62-9) and SJG-136 (CAS Registry No. 232931-57-6). For example, the PBD tesirine has been used as a cytotoxic payload in the clinically approved ADC drug loncastuximab tesirine. PBDs and their derivatives are known in the art and described, for example, in the following literature: Mantaj et al. 2017 (Mantaj, Julia, et al. "From anthramycin to pyrrolobenzodiazepine (PBD)-containing antibody-drug conjugates (ADCs)."). Angewandte Chemie International Edition 56.2 (2017):462-488), the entire contents of which are incorporated herein by reference.
[0079] In some cases, DNA damaging agents can be topoisomerase inhibitors, such as topoisomerase I or topoisomerase II inhibitors. Topoisomerases are essential for regulating DNA topology and torsional stress during DNA replication, repair, and transcription. In some embodiments, the topoisomerase inhibitor can be a topoisomerase I inhibitor, such as camptothecin or a derivative thereof. Camptothecin and its derivatives inhibit topoisomerase I, thereby inhibiting replication and leading to DNA cleavage. Suitable camptothecin and camptothecin derivatives used as payloads include, but are not limited to, camptothecin (CAS Registry No. 7689-03-4), topotecan (CAS Registry No. 123948-87-8), irinotecan (CAS Registry No. 97682-44-5), belotecone (CAS Registry No. 256411-32-2), ixotecan (CAS Registry No. 171335-80-1), delutecan (CAS Registry No. 1599440-13-7), and SN-38 (CAS Registry No. 86639-52-3). For example, the camptothecin analogue durutecan has been used as the payload in the clinically approved ADC drug trastuzumab deruxtecan. In some embodiments, the topoisomerase inhibitor can be a topoisomerase II inhibitor, such as anthracyclines, anthracene diones, acridines, epipodophyllotoxin, or derivatives thereof. Anthracyclines intercalate into DNA and poison the DNA-topoisomerase II complex, thereby inhibiting DNA replication and leading to cell death. Furthermore, anthracyclines generate free radicals in an iron-dependent manner, further enhancing their cytotoxic effects. Suitable anthracyclines and anthracycline antibiotic derivatives used as payloads include, but are not limited to, doxorubicin (CAS Registry No. 23214-92-8), epirubicin (CAS Registry No. 56420-45-2), pentorubicin (CAS Registry No. 56124-62-0), daunorubicin (CAS Registry No. 20830-81-3), idarubicin (CAS Registry No. 58957-92-9), and PNU-159682 (CAS Registry No. 202350-68-3). Anthraquinones, acridines, epipodophyllotoxins, and their derivatives intercalate into DNA and poison the DNA-topoisomerase II complex, thereby inhibiting DNA replication and leading to cell death. Suitable anthracyclines and anthracycline derivatives used as payloads include, but are not limited to, mitoxantrone (CAS Registry No. 65271-80-9) and picoantrone (CAS Registry No. 144510-96-3). Suitable epipodophyllotoxin and epipodophyllotoxin derivatives include, but are not limited to, etoposide (CAS Registry No. 33419-42-0) and teniposide (CAS Registry No. 29767-20-2).Various types of topoisomerase inhibitors are known in the art and described, for example, in the following literature: Yakkala et al. 2023 (Yakkala PA, Penumallu NR, Shafi S, Kamal A. “Prospects of Topoisomerase Inhibitors as Promising Anti-Cancer Agents”). Pharmaceuticals (Basel) October 13, 2023; 16(10):1456), the entire contents of which are incorporated herein by reference.
[0080] In some cases, DNA damaging agents can be alkylating agents. Alkylating agents interact with DNA to form covalent adducts, causing DNA cross-linking or DNA-protein cross-linking, leading to DNA cleavage, replication inhibition, and cell death. Suitable alkylating agents used as payloads include, but are not limited to, adolaxine (CAS Registry No. 110314-48-2), carboplatin (CAS Registry No. 41575-94-4), chlorambucil (CAS Registry No. 305-03-3), cisplatin (CAS Registry No. 15663-27-1), cyclophosphamide (CAS Registry No. 50-18-0), lomustine (CAS Registry No. 13010-47-4), melphalan (CAS Registry No. 148-82-3), mitomycin C (CAS Registry No. 50-07-7), and temozolomide (CAS Registry No. 85622-93-1).
[0081] Other cytotoxic / cell inhibitors
[0082] In some embodiments, the cytotoxic payload of the ADC of this disclosure may be an antimetabolite, a protein synthesis inhibitor, a mitochondrial inhibitor, a histone deacetylase (HDAC) inhibitor, or a cell cycle disruptor. Antimetabolites inhibit metabolic pathways essential for cell proliferation and survival, such as nucleic acid or amino acid synthesis. Exemplary antimetabolites include 5-fluorouracil (5-FU; CAS Registry No. 51-21-8) and fludarabine (CAS Registry No. 21679-14-1), etc. Various types of antimetabolites are known in the art and described, for example, in the following literature: Cole et al. 2005 (Cole, Peter D., John A. Zebala, and Barton A. Kamen. "Antimetabolites: A new perspective."). Drug Discovery Today: Therapeutic Strategies2.4 (2005):337-342), the entire contents of which are incorporated herein by reference. Protein synthesis inhibitors disrupt mRNA translation through various mechanisms. Exemplary protein synthesis inhibitors include tomivortebrate (eFT-508; CAS Registry No. 1849590-01-7), zotatifen (CAS Registry No. 2098191-53-6), and Silvestro (CAS Registry No. 697235-38-4). Various types of protein synthesis inhibitors are known in the art and described, for example, in the following literature: Kovalski et al. 2022 (Kovalski, Joanna R., Duygu Kuzuoglu‐Ozturk, and Davide Ruggero. "Protein synthesis control in cancer: selectivity and therapeutic targeting." The EMBO Journal 41.8 (2022):e109823), the entire contents of which are incorporated herein by reference. Mitochondrial inhibitors disrupt mitochondrial function and / or cellular respiration. Exemplary mitochondrial inhibitors include tamoxifen (CAS Registry No. 10540-29-1), gamitinib (CAS Registry No. 1131626-46-4), and tigecycline (CAS Registry No. 220620-09-7). HDAC inhibitors disrupt the regulation of gene expression through HDAC-mediated chromatin remodeling. Exemplary HDAC inhibitors include trichostatin A (CAS Registry No. 58880-19-6) and SK-7041 (CAS Registry No. 617690-98-9). Various types of HDAC inhibitors are known in the art and described, for example, in the following literature: Shanmugam et al. 2022 (Shanmugam, Geetha, Sudeshna Rakshit, and Koustav Sarkar. "HDAC inhibitors: Targets for tumor therapy, immune modulation, and lung diseases."). Translational Oncology16 (2022):101312), the entire contents of which are incorporated herein by reference. Cell cycle disruptors interfere with the regulation of cell division, such as interfering with the function of cyclin-CDK. Exemplary cell cycle disruptors include fulpindo (CAS Registry No. 146426-40-6), dinacicilib (CAS Registry No. 779353-01-4), and ronicilib (CAS Registry No. 1223498-69-8). Various types of cell cycle disruptors are known in the art and described, for example, in the following literature: Zhang et al. 2021 (Zhang, Mengna, et al. "CDK inhibitors in cancer therapy, an overview of recent development."). American journal of cancer research 11.5 (2021):1913) and Bai et al. 2017 (Bai, Jingwen, Yaochen Li and Guojun Zhang. Cell cycle regulation and anticancer drug discovery.) Cancer biology & medicine 14.4 (2017):348), the full content of each reference is incorporated into this paper by reference.
[0083] Nucleic acid payload
[0084] In some embodiments, the payload of the ADC disclosed herein can be a nucleic acid, such as an RNA or DNA oligonucleotide. A key feature of nucleic acid payloads is that by designing them to bind to the target nucleic acid via a relatively simple Worson-Crick base pairing mechanism, they provide the theoretically highly selective ability to regulate any target gene. Nucleic acid payloads can be used to regulate the expression of target genes, for example, through a variety of mechanisms, including base pairing with the target, such as base pairing with the complementary sequence of the target gene transcript. Pharmacologically active nucleic acids and their uses in antibody-drug conjugates (ADCs) are known in the art and described in, for example, the following literature: Dugal-Tessier et al. 2021 (Dugal-Tessier, Julien, Srinath Thirumalairajan and Nareshkumar Jain. "Antibody-oligonucleotide conjugates: a twist to antibody-drug conjugates." Journal of Clinical Medicine 10.4 (2021):838) and Moumné et al. 2022 (Moumné, Lara, Anne-Céline Marie and Nicolas Crouvezier. "Oligonucleotide therapeutics: from discovery and development to patentability." Pharmaceutics 14.2 (2022):260), the entire contents of which are incorporated herein by reference.
[0085] Antisense oligonucleotides (ASO)
[0086] In some embodiments, the nucleic acid payload of the ADC of this disclosure may be an antisense oligonucleotide (ASO). The ASO is programmed to be complementary (i.e., antisense) to a target nucleic acid RNA transcript (e.g., mRNA). In some cases, the ASO can regulate the expression of a desired gene (e.g., a disease-related gene) by triggering the degradation of the target gene transcript. For example, a DNA or DNA-like ASO may be programmed to be complementary to the target RNA transcript and hybridize with the transcript to form a DNA / RNA complex. The ASO / transcript complex is then sensitive to the activity of RNase H, which selectively degrades the RNA strand of the DNA / RNA complex, thereby degrading the hybridized target transcript.
[0087] In some cases, ASOs can be programmed to alter the expression of specific gene isoforms by modulating RNA splicing. For example, an ASO can be programmed to bind to the intron-exon junction of the pre-mRNA of a target gene and spatially interfere with spliceosome mechanisms, thereby altering splicing events.
[0088] Suitable ASOs used as payloads in the ADCs of this disclosure may, in principle, include ASOs specific to any conceivable target gene. In some embodiments, the ASO may be a known or clinically approved ASO specific to a known target. Exemplary known target gene expression repressive ASOs suitable for use as nucleic acid payloads include, but are not limited to: inotersen targeting TTR, eplontersen targeting TTR, mipomersen targeting APOB, volanesorsen targeting APOC3, olezarsen targeting APOC3, and CMV targeting... Fomivirsen for IE2, Aganirsen for IRS1, Alicaforsen for ICAM1, Pelacarsen for LPA, Tofersen for SOD1, Tominersen for HTT, Trabedersen for TGFB2, Zilganersen for GFAP, Atesidorsen for GHR, Cimderlirsen for GHR, Cepadacursen for PCSK9, Bepirovirsen for HBV, Danvatirsen for STAT3, Donidalorsen for KLKB1, Prexigebersen for GRB2, and Vupanorsen for ANGPTL3. Exemplary known splice-regulating ASOs suitable for use as nucleic acid payloads include, but are not limited to, sepofarsen targeting CEP290, eteplirsen targeting DMD, viltolarsen targeting DMD, casimersen targeting DMD, golodirsen targeting DMD, renadirsen targeting DMD, and nusinersen targeting SMN2.
[0089] Short interfering RNA (siRNA)
[0090] In some embodiments, the nucleic acid payload of the ADC of this disclosure may be a short interfering RNA (siRNA). siRNA is a double-stranded RNA molecule whose strands can hybridize with complementary target RNA, and it can induce the degradation of the target RNA by recruiting and incorporating an RNA-induced silencing complex (RISC) into the target cell. Suitable siRNAs used as payloads in the ADC of this disclosure may, in principle, be siRNAs specific to any conceivable target gene. In some embodiments, the siRNA may be a known or clinically approved siRNA. Exemplary known siRNAs suitable for use as nucleic acid payloads include, but are not limited to, patisiran targeting TTR, vutrisiran targeting TTR, givosiran targeting ALAS1, inclisiran targeting PCSK9, lumasiran targeting HAO1, fitusiran targeting SERPINA1, nedosiran targeting LDHA, teprasiran targeting TP53, tivanisiran targeting TRPV1, bamosiran targeting ADRB2, belcesiran targeting SERPINA1, fazisiran targeting SERPINA1, cemdisiran targeting C5, olpasiran targeting LPA, and zilebesiran targeting AGT.
[0091] Nucleic acid modification
[0092] In some embodiments, the nucleic acid payload of the ADC of this disclosure includes one or more modifications (e.g., nucleobase modifications, sugar modifications, backbone modifications) to improve, for example, the affinity or stability of the nucleic acid payload in circulating plasma. Suitable nucleic acid modifications include, for example, locked nucleic acid (LNA) modified nucleotides, peptide nucleic acid (PNA) modified nucleotides, 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, and phosphate thioester bonds, etc. Nucleic acid modifications useful for nucleic acids (e.g., RNA or DNA oligonucleotides) with therapeutic applications are known in the art and described in, for example, the following literature: WO 2007 / 047913, Ochoa et al. 2020 (Ochoa, Steven and Valeria T. Milam. "Modified nucleicacids: Expanding the capabilities of functional oligonucleotides."Molecules 25.20 (2020):4659), Kulkarni et al. 2021 (Kulkarni, Jayesh A. et al. "The current landscape of nucleic acid therapeutics."Nature nanotechnology 16.6 (2021):630-643), and Moumné et al. 2022 (Moumné, Lara, Anne-Céline Marie, and Nicolas Crouvezier. "Oligonucleotide therapeutics: from discovery and development to patentability."Pharmaceutics 14.2 (2022):260), which are incorporated herein by reference in their entirety.
[0093] G protein-coupled receptor (GPCR) modulators
[0094] In some embodiments, the payload of the ADC of this disclosure can be a regulator of G protein-coupled receptors (GPCRs). GPCRs encompass the largest family of proteins encoded in the human genome, involved in a wide range of physiological processes and associated with many diseases ranging from type 2 diabetes to schizophrenia. GPCRs transduce extracellular signals in the form of various ligands that induce conformational changes in the GPCR upon binding, subsequently leading to activation of G proteins and other downstream intracellular molecular pathways. GPCRs can be classified into four subfamilies based on their amino acid sequences: class A (rhodopsin type), class B (secretin / adhesion type), class C (glutamate type), and class F (coiled type) GPCRs. Class A GPCRs can be further subdivided into amino, peptide, lipid, protein, nucleotide, and steroid receptor GPCRs. Detailed studies of the structure and function of GPCR activation have led to the development of numerous molecular regulators targeting hundreds of GPCRs in each of the above classes.
[0095] Suitable amino-functional GPCR modulators used as payloads may include any known or clinically approved amino-functional GPCR modulator. Exemplary aminoeners suitable as payloads include, for example: acebutolol, acephenanol, acetylcholine, adecyl bromide, avastin, bensulfuron-methyl, benzphenamine, benztropine, betosine, betahistine, cabergoline, carbacholine, carbiprazine, carteolol, dapoxetine, dapiprazole, dafenapyridine, desipramine, desloratadine, dextrobromophenamine, eletriptan, emesine, ephedrine, epinastine, adrenaline, famotidine, fenodopam, fenoterol, fexofenadine, girritalinib, glycopyrronium bromide, guanethidine, guanifacin, haloperidol, hexanediol, histamine, methyl bromide homatropine, hydroxyzine, ipraridone, indacaterol, indolacrimine, ipratropium bromide. Ibutaline, ketotifen, labetalol, lamidutane, levobenolol, levocarbastine, levocetirizine, meclopramide, mefenamic acid, mesodarazine, osinaline, nadolol, naphazoline, natratriptan, nebivolol, nefazodone, olanzapine, olodaterol, olopatadine, oxenolol, paliperidone, pirimethasone, pentbuprofenolol, etc. Golitriol, Perphenazine, Quetiapine, Ranitidine, Remopride, Refenapyridine, Risperidone, Ritodrine, Salbutamol, Salmeterol, Scopolamine, Silodosin, Solifenacin, Tamsulosin, Tegaserod, Terazosin, Terfenadine, Umeprazole, Vilanterol, Verazordone, Vortioxetine, Xylometazoline, Ziprasidone, Zolmitriptan, and Zirconia.
[0096] Suitable peptide GPCR modulators used as payloads may include any known or clinically approved peptide GPCR modulator. Exemplary peptide GPCR modulators suitable as payloads include, for example: angiotensin II, azilsartan medoxomil, candesartan medoxomil, eprosartan, forrasartan, irbesartan, losartan, olmesartan medoxomil, telmisartan, valsartan, ilebant, ramipril, captopril, enalapril, zinc, zinc chloride, zinc acetate, zinc sulfate, pentagastrin, ambrisentan, bosentan, macitentan, sitassentan, acetylsalicylic acid, nedolomeli, macirelin, abalexil, busherin, cetrarelin, danazol, degarelix, ganirelin acetate, gonadorelin, goserelin, histamine, leuprorelin, nafarelin, triptorelin, ellagolix, afanotoxin, ticokine, bumenotoxin, erythromycin, cysteine. Levocabastine, alfentanil, avimopan, anilidine, buprenorphine, butorphanol, cocaine, codeine, dezocine, difenoxine, dihydrocodeine, difenoxate, eluxadoline, ethylmorphine, fentanyl, hydrocodone, hydromorphone, ketobemidone, levorpheneline, levorphene, levomethasone acetate, loperamide, meperidine, methadone, methadone acetate, methylnaltrexone, morphine, nalbuphine, naldemetonine, nalmefenoxate, naloxetine, naloxetine, naltrexone, oxycodone, oxymorphone, pentazocine, propoxyphene, remifentanil, sufentanil, tapentadone, tramadol, suvorexin, leboresen, vorapazol, thrombin, celecoxib, gallium-68 DOTATOC, lutetium 177 dotatate, parretoxin, lanretoxin, octreotide, valproate, aprepitant, netotitant, lorapitant, fonenetotitant and palonosetron, prorelin, atosiban, conivovatan, desmopressin, oxytocin, terlipressin, tolvaptan, vasopressin.
[0097] Suitable lipid GPCR modulators used as payloads may include any known or clinically approved lipid GPCR modulator. Exemplary lipid GPCR modulators suitable as payloads include, for example: drocannabinol, Marinol, Nabilone, tetrahydrocannabinol, cannabidiol, eicosapentaenoic acid, montelukast, nedolomi, premexetol, zafirlukast, asfotase alfa, fingolimod, sinimod, ozamod, rupatadine, prostaglandin E1, bupivacaine, bemexprost, carboprost tromethamine, dinoprost tromethamine, dinoprostone, eprostol, iloprost, latanoprost nitrate, latanoprost, misoprostol, lidogre, selexipag, tafluprost, travoprost, travoprost, gemcitabine, nedolomi, indomethacin, and sulindac.
[0098] Suitable nucleotide GPCR modulators for use as payloads may include any known or clinically approved nucleotide GPCR modulators. Exemplary nucleotide GPCR modulators suitable as payloads include, for example: adenosine, caffeine, regadesone, theophylline, pentoxifylline, defibrinolytic acid, itratheline, tramadol, gabapentin, aminophylline, oxtriphylline, mefloquine, lamotrigine, fantatinib, cangrelox, clopidogrel, prasugrel, suramin, ticagrelor, ticlopidine, treprostine, eprostol, and promethazine.
[0099] Suitable class B GPCR modulators for use as payloads may include any known or clinically approved class B GPCR modulators. For example, exemplary class B GPCR modulators suitable as payloads include: calcitonin, ubugipam, remdesivir, pramlintide acetate, secretin, sermorelin, temorelin, abiglutide, dulaglutide, exenatide, liraglutide, liximabide, smegglutide, terduglutide, glucagon, abalotene, and teriparatide.
[0100] Suitable class C GPCR modulators for use as payloads may include any known or clinically approved class C GPCR modulators. For example, exemplary class C GPCR modulators suitable as payloads include: acampolic acid, baclofen, cinacalcet, itcatide, γ-hydroxybutyric acid, progabi, and vigabatrin.
[0101] Suitable class F GPCR modulators for use as payloads may include any known or clinically approved class F GPCR modulators. For example, exemplary class F GPCR modulators suitable as payloads include: itraconazole, sonodazole, vemodazole, gladazole, halcinonide, and fluocinolone acetonide.
[0102] Hundreds of known and clinically approved GPCR modulators are known in the art and have been extensively reviewed in publications including Hauser et al. 2017 (Hauser, Alexander S., et al. "Trends in GPCR drug discovery: new agents, targets and indications." Nature reviews Drugdiscovery 16.12 (2017):829-842) and Yang et al. 2021 (Yang, Dehua, et al. "G protein-coupled receptors: structure-and function-based drug discovery." Signaltransduction and targeted therapy 6.1 (2021):7), the full contents of each of which are incorporated herein by reference.
[0103] Ion channel modulators
[0104] In some embodiments, the payload of the ADC of this disclosure can be a regulator of ion channels (e.g., an activator or inhibitor). Ion channels are pore-forming transmembrane proteins that allow ions to pass through cell membranes and organelle membranes. Ion channels play a crucial role in a variety of physiological processes, such as regulation of ion homeostasis, muscle contraction, nervous system signal transduction, and T cell activation. Ion channels can be grouped according to the types of ions they are permeable to, such as calcium channels, sodium channels, potassium channels, and proton channels. The ion permeability of many ion channels is conditionally dependent on surrounding physiological signals or conditions (i.e., ion channels are “gated”). Ion channels can be further or selectively grouped and classified by their gating mechanisms, such as voltage-gated ion channels, ligand-gated ion channels, and mechanosensitive ion channels.
[0105] In some cases, the payload of the ADC disclosed herein may be a calcium channel modulator. Calcium channels play important roles in a variety of physiological processes, including muscle contraction, hormone release, neurotransmitter release, and gene transcription. Suitable calcium channel modulators for use as payloads include any known or clinically approved calcium channel inhibitors. Exemplary calcium channel modulators suitable for use as payloads include, but are not limited to: isradipine, nimodipine, cilnidipine, gabapentin, pregabalin, lamotrigine, topiramate, zonisamide, ethosuximide, ziconopeptide, valproate, nifedipine, SNX-482, spider toxins (e.g., ω-arachidonic acid IVA), cone snail toxins (e.g., ω-conotoxin MVIIA), calciseptine, and calcicludine. Calcium channel modulators are known in the art and described in, for example, the following literature: Zamponi 2016 (Zamponi, Gerald W. "Targeting voltage-gated calcium channels in neurological and psychiatric diseases." Nature reviews Drug discovery 15.1(2016):19-34) and Pringos et al. 2011 (Pringos, Emilie et al. "Peptide neurotoxins that affect voltage-gated calcium channels: a close-up on ω-agatoxins." Toxins 3.1 (2011):17-42), the full contents of which are incorporated herein by reference.
[0106] In some cases, the payload of the ADC disclosed herein may be a potassium channel modulator. Potassium channels can repolarize or hyperpolarize the membrane of excitable cells after potential discharge, thereby working in conjunction with calcium and sodium channels in various physiological processes. Suitable potassium channel modulators for use as payloads include any known or clinically approved potassium channel modulators. Exemplary potassium channel modulators suitable for use as payloads include, but are not limited to, amiodarone, dofetilide, sotalol, azlilide, bromide, chlorfeminine, tedesamidine, smarilide, astemizole, imipramine, verapamil, sea anemone BDS toxin, and marrotoxin. Potassium channel modulators are known in the art and described, for example, in the following literature: Wolff et al. 2009 (Wolff, H., NA Castle and LA Pardo. "Voltage-gated potassium channels as therapeutic drug targets." Nat Rev Drug Discov 8 (2009):982-1001) and Hopkins et al. 1996 (Hopkins, WF, JL Miller and GP Miljanich. "Voltage-gated potassium channel inhibitors." Current Pharmaceutical Design 2.4 (1996):389-396).
[0107] In some cases, the payload of the ADC disclosed herein may be a sodium channel inhibitor. Sodium channels and calcium channels are essential for the propagation of action potentials in excitable cells and, like calcium channels, play a key role in a variety of physiological processes, such as nerve signal transduction, muscle contraction, melanin production, and immune cell maturation. Suitable sodium channel modulators for use as payloads include any known or clinically approved sodium channel modulators. Exemplary sodium channel modulators suitable for use as payloads include, but are not limited to, ciguatoxin, salicylic acid, sclerotoxicosin, poison dart frog toxin, tetrodotoxin, veratrine, aconitine, μ-conotoxin, μO-conotoxin, δ-conotoxin, ι-conotoxin, ProTx-I, ProTx-II, ProTx-III, HwTx-IV, ATX-II, and scorpion peptide toxins (ScTxs). Sodium channel modulators are known in the art and have been described, for example, in the following literature: Cardoso et al. 2018 (Cardoso, Fernanda C. and Richard J. Lewis. "Sodium channels and pain: From toxins to therapies." British Journal of Pharmacology 175.12 (2018):2138-2157), the entire contents of which are incorporated herein by reference.
[0108] ADC connector
[0109] The ADC disclosed herein comprises a polypeptide (e.g., an antibody) covalently linked to a payload via a linker. The linker connects the payload to the antibody by covalently bonding to the antibody at a first position and to the payload at a second position. Depending on the selection of the linker, payload, and antibody attachment site, various conjugation chemistry methods can be used to covalently link the linker to the payload and antibody.
[0110] Proximers can be broadly categorized into cleavable and non-cleavable proximers. Proximer stability during circulation is crucial for the controlled and targeted release of the payload to target cells and for preventing off-target activity. Non-cleavable proximers require antibody proteolysis to release the payload (e.g., lysosomal proteolysis of the antibody after internalization). Cleavable proximers allow the payload to be released from the ADC without antibody proteolysis; proximer cleavage is triggered by specific chemical or enzymatic signals (e.g., chemical or enzymatic signals characteristic of the tumor microenvironment), thereby releasing the payload at its intended site of action.
[0111] Suitable linkers can vary in length, hydrophilicity / hydrophobicity, and flexibility, or can be composed of different segments, each differing in one or more of the aforementioned properties. The properties of the linker can vary depending on the nature of the payload. For example, a hydrophilic linker can be paired with a hydrophobic payload to improve solubility and reduce ADC aggregation. Furthermore, linkers can be monovalent (i.e., attaching a single payload molecule to a single site on the antibody) or multivalent / branched (i.e., attaching more than one payload molecule to a single site on the antibody).
[0112] Several publications have reviewed ADC linkers, including: Jain et al. 2025 (Jain, Nareshkumar, et al. "Current ADC linker chemistry." Pharmaceutical Research 32.11(2015):3526-3540), and Maecker et al. 2023 (Maecker, Heather, et al. "Exploration of the antibody-drug conjugate clinical landscape"). MAbs Volume 15, Issue 1, Taylor & Francis, 2023; Sasso et al., 2023 (Sasso, Janet M. et al., "The Evolving Landscape of Antibody–Drug Conjugates: In Depth Analysis of Recent Research Progress"). Bioconjugate Chemistry 2021 (Theocharopoulos, Charalampos, et al. "Antibody-drug conjugates: Functional principles and applications in oncology and beyond." Vaccines9.10 (2021):1111), the full content of each reference is incorporated into this paper by reference.
[0113] Natural and nonspecific connection sites
[0114] In some embodiments, the payload can be chemically conjugated to native amino acid residues of the antibody (i.e., amino acid residues not engineered into the antibody for linking the adapter) via a linker site. In some embodiments, using native amino acid residues as linker sites eliminates the need for additional modifications to the antibody's amino acid sequence to achieve adapter linking. In some cases, the conjugation of the adapter and the payload to the native antibody residues is heterogeneous. In other words, the total number of linker sites and the total number of adapters with payload conjugations may vary from ADC to ADC in a given batch.
[0115] In some embodiments, the natural amino acid residue is lysine, wherein the linker is covalently linked via a primary amine of the lysine residue. In this case, the linker and payload can be reacted with lysine via amide coupling using a carboxylic acid ester activated in the linker. For example, the primary amine of lysine can react with an N-hydroxysuccinimide (NHS) ester introduced into the linker to form a stable amide bond. Exemplary linker types that can be conjugated with lysine residues include, but are not limited to, the N-succinimide-4-(2-pyridyl dithio)butyrate (SPDB) linker, the sulfonate-SPDB linker, maleimide methylcyclohexane-1-carboxylate (MCC), 4-(4-acetylphenoxy)butyric acid (AcBut) linker, and derivatives thereof.
[0116] In some embodiments, the native amino acid residue is cysteine, wherein the linker is covalently linked via a thiol group of the cysteine residue. In such cases, under controlled conditions, the interchain disulfide bonds of the antibody can be selectively reduced to generate a reactive thiol group in the surface cysteine residue, while the intrachain disulfide bonds remain intact. The free thiol group can then serve as a reactive linker site, binding to the linker through various chemical reactions. For example, the linker can react with the free thiol group via Michael addition, α-halocarbonyl alkylation, or disulfide formation. Exemplary linker types that can be conjugated to cysteine residues include, but are not limited to, maleimide hexanoyl (MC) linkers, maleimide methylcyclohexane-1-carboxylate (MCC) linkers, and derivatives thereof.
[0117] Available conjugation chemistry for linking linkers to lysine and cysteine residues of antibodies is known in the art and is reviewed in, for example, the following literature: Lu et al. 2016 (Lu, Jun, et al. "Linkers having acrucial role in antibody–drug conjugates." International journal of molecular sciences 17.4 (2016):561), McDonagh et al. 2006 (McDonagh, Charlotte F., et al. "Engineered antibody–drug conjugates with defined sites and stoichiometries of drug attachment." Protein Engineering, Design and Selection 19.7 (2006):299-307), and Sun et al. 2005 (Sun, Michael Mc, et al. "Reduction-alkylation strategies for the modification of specific monoclonal antibody disulfides." Bioconjugate chemistry 16.5 (2005):1282-1290). In addition, for example, a method for conjugating a linker to a cysteine residue of an antibody is described in WO 2014 / 197612.
[0118] Engineering modification and site-specific connectivity sites
[0119] In some embodiments, the payload can be conjugated to engineered amino acid residues via a linker. In some embodiments, the engineered amino acid can be a cysteine residue, which can be introduced into a specific site on the antibody via a recombination method. Site specificity can be achieved, for example, by specifically substituting the cysteine residue, ensuring that the cysteine is not paired (i.e., cannot form intra- or inter-chain disulfide bonds with spatially adjacent cysteine residues). Exemplary sites for inserting cysteine substitutions include the constant region and / or Fc region of the antibody. Methods of inserting cysteine substitutions into antibodies are known in the art and described, for example, in the following references: Lyons et al. 990 (Lyons, Alan, et al. "Site-specific attachment to recombinant antibodies via introduced surface cysteineresidues." Protein Engineering, Design and Selection 3.8 (1990):703-708), WO2011 / 005481, WO2014 / 124316 and WO 2015 / 138615, the entire contents of each of which are incorporated herein by reference.
[0120] In some embodiments, the engineered amino acid may be selenocysteine (a cysteine analogue), which can be introduced to a specific site on the antibody via recombination and / or co-translation. The selenoyl group is more nucleophilic than the thiol group and does not require antibody reduction. In such cases, the linker can be attached to the engineered cysteine or selenocysteine via the conjugation chemistry of the cysteine residues discussed above. In some embodiments, the engineered amino acid may be tyrosine.
[0121] In some implementation schemes, the engineered amino acid can be a non-natural or non-classical (NCAA) amino acid. Due to their orthogonal chemistry, non-natural amino acids can achieve site-specific conjugation to the linker. Non-natural amino acids include, but are not limited to, p-acetylphenylalanine (pAcF), p-azidomethyl-L-phenylalanine (pAMF), and azido-lysine (AzK). For example, pAcF residues can be specifically conjugated to linkers containing oxime moieties. As another example, azido-containing pAMF residues can be specifically conjugated to alkyne-containing linkers via click chemistry. Among other methods, the chemical conjugation of linkers to non-natural amino acids is known in the art and described, for example, in the following literature: Dennler et al. 2015 (Dennler, Patrick, Eliane Fischer, and Roger Schibli. "Antibody conjugates: from heterogeneous populations to defined reagents."). Antibodies 4.3 (2015):197-224) and Zimmerman et al. 2014 (Zimmerman ES, Heibeck TH, Gill A, Li X, Murray CJ, Madlansacay Mr, et al. Production of site-specific antibody-drug conjugates using optimized non-natural amino acids in a cell-free expression system. Bioconjug Chem .2014; 25:351–61).
[0122] Cuttable connector
[0123] In some implementations, the ADC adapter is selectively cleavable in vivo. A cleavable adapter comprises a selectively cleavable, unstable, or degradable portion that allows the payload to be released at its intended site of action in response to a specific stimulus or process (e.g., a characteristic stimulus or process of the tumor microenvironment or intracellular compartment). In some cases, adapter cleavage can be triggered by a chemical stimulus (e.g., a change in pH). In other cases, adapter cleavage can be triggered by an enzyme. Therefore, in addition to target-specific antibodies, cleavable adapters can be used to add another dimension of targeting selectivity. Cleavable adapters typically incorporate one or more chemically or enzymatically cleavable portions, while the remainder of the adapter may remain cleavable.
[0124] In some embodiments, the cleavable adapter may be a pH-sensitive (i.e., acid-labile) adapter or contain a pH-sensitive moiety. Both pH-sensitive cleavable adapters and pH-sensitive cleavable moieties are stable under alkaline conditions but sensitive to hydrolysis under acidic conditions. For example, the acidic conditions encountered by endosomes and lysosomes after ADC internalization via endocytosis promote the release of the payload from the acid-labile adapter. Furthermore, the tumor microenvironment is typically acidic, and the pH-sensitive moieties can provide additional targeting selectivity for delivering cytotoxic payloads to tumors. Suitable pH-sensitive moieties for incorporating acid-labile adapters include hydrazone moieties, which hydrolyze under acidic conditions. Other acid-labile moieties that can be incorporated into pH-sensitive adapters include carbonate and cis-aconityl moieties. Exemplary cleavable adapter types incorporating pH-sensitive moieties include, but are not limited to, AcBut-like adapters incorporating hydrazone moieties, MC-like adapters incorporating hydrazone moieties, and MCC-like adapters incorporating hydrazone moieties. For example, suitable acid-instable linkers incorporated into the acid-instable hydrazone moiety include those used in gemtuzumab oczomidin, izumab oczomidin, PF-06647263, CMD-193, CMB-401, SGN-15, and mirazolidinab doxorubicin.
[0125] In some embodiments, the cleavable adapter may be a reducible adapter or a glutathione-sensitive adapter, or may contain a reducible portion or a glutathione-sensitive portion. For example, the reducing environment of the cytosol and high glutathione concentration encountered after ADC internalization into the cell promotes the release of the payload from the reducible adapter into the cell's cytosol. Glutathione concentrations within cells are much higher than in plasma, thus the reduction potential within cells differs significantly from that in circulating plasma. Furthermore, glutathione is released during cell replication, therefore proliferating cancer cells exhibit high concentrations of glutathione, providing another dimension of targeting selectivity for delivering cytotoxic payloads to proliferating cancer cells. A suitable glutathione-sensitive portion for incorporating the reducible adapter is a disulfide bond portion. Exemplary types of cleavable adapters incorporating a glutathione-sensitive portion include, but are not limited to, AcBut-like adapters incorporating a disulfide bond portion, MC-like adapters incorporating a disulfide bond portion, SPDB-like adapters, and sulfonated SPDB-like adapters. For example, suitable reducible linkers incorporating reducible moieties include those used in gemtuzumab oxazomicin, izumab oxazomicin, cantuzumab metansine, bivalizumab metansine, lovotuzumab metansine, MLN2704, SAR566658, cantuzumab ravtansine, IMGN388, HKT288, BIIB015, LY3076226, SAR428926, coutuximab anti-ravtansine, AVE9633, DHES0815A, PF-06647263, CMD-193, and CMB-401.
[0126] In some embodiments, the cleavable linker may be a proteolytically cleavable linker or contain a proteolytically cleavable portion. The proteolytically cleavable linker contains a peptide motif that is specifically targeted and hydrolyzed by intracellular proteases (e.g., proteases). Notably, intracellular proteases, such as lysosomal proteases, typically exhibit poorer activity under the unfavorable alkaline conditions of circulating plasma compared to their activity under acidic conditions in endosomes and lysosomes. For example, high concentrations of proteases (e.g., cathepsin B) encountered in the acidic endosome and lysosomal compartments after ADC internalization via endocytosis facilitate the release of the payload from the proteolytically cleavable linker. Furthermore, proteases, such as cathepsin B, are typically overexpressed or secreted by tumor cells, providing another dimension of targeting selectivity for delivering cytotoxic payloads to cancer cells. In some embodiments, the proteolytically cleavable portion is a dipeptide motif. Suitable dipeptide moieties for incorporation into proteolytically cleavable linkers include, but are not limited to, valine-citrulline (Val-Cit), valine-alanine (Val-Ala), phenylalanine-valine (Phe-Val), and phenylalanine-lysine (Phe-Lys) dipeptide moieties. For example, the Val-Cit dipeptide moieties can be hydrolyzed by cathepsin B. In some embodiments, the proteolytically cleavable peptide motif is a tetrapeptide. Suitable tetrapeptide moieties for incorporation into proteolytically cleavable linkers include glycine-phenylalanine-leucine-glycine (Gly-Phe-Leu-Gly) and alanine-leucine-alanine-leucine (Ala-Lue-Ala-Leu) tetrapeptide moieties.For example, suitable linkers for incorporating hydrolyzable portions of proteases include, but are not limited to, dipeptide-incorporated linkers used in the following substances: brentuximab vedotin, polatuzumab vedotin, tarantuximab, enapotamab vedotin, BAY79-4620, losatuxizumab vedotin, indusatumab vedotin, glembatumumab vedotin, samrotamab vedotin, DLYE5953A, sofituzumab vedotin, DMOT4039A, DMUC4064A, and lifastuzumab vedotin. vedotin), sirtratumab vedotin, vandortuzumab vedotin, CDX-014, pinatuzumab vedotin, AGS67E, iladatuzumab vedotin, DFRF4539A, azintuxizumab vedotin, AbGn-107, PF-06650808, PF-06664178, BMS-986183, SC-004, rovalpituzumab tesirine, SC-002, tamrintamab pamozirine, ADCT-502, rolinsatamab Tadalafil (talirine), ADCT-401, SC-006, SGN-CD70A, SGN-CD19B, MEDI7247, MEDI2228, vadastuximab talirine, SGN-CD123A, SGN-CD352A, BMS-986148, and MDX-1203, etc.
[0127] In some embodiments, the cleavable linker may be a glycosidase-cleavable linker or contain a glycosidase-cleavable portion. Various glycosidases, such as β-glucuronidase or β-galactosidase, are localized to acidic lysosomal compartments of cells. For example, glycosidases such as β-glucuronidase or β-galactosidase present in lysosomal compartments encountered after ADC internalization via endocytosis facilitate the release of the payload from the glycosidase-cleavable linker. Furthermore, glycosidases are typically overexpressed or secreted by tumor cells, providing another dimension of targeting selectivity for delivering cytotoxic payloads to cancer cells. In some embodiments, the glycosidase-cleavable linker is a β-glucuronidase-cleavable linker or contains a β-glucuronidase-cleavable portion. The β-glucuronidase-cleavable portion includes a β-glucuronide moiety that is specifically targeted and hydrolyzed by β-glucuronidase. For example, suitable adapters incorporating a β-glucuronidase-cleavable portion include, but are not limited to, the β-glucuronidase-cleavable adapter used in the ADC SGN-CD48A. In some embodiments, the glycosidase-cleavable adapter is a β-galactosidase-cleavable adapter or contains a β-galactosidase-cleavable portion. β-galactosidase-cleavable adapters are similar to β-glucuronidase-cleavable adapters, but utilize a β-galactosidase-hydrolyzed β-galactoside portion instead of the β-glucuronide portion.
[0128] In some embodiments, the cleavable linker is a phosphatase-cleavable linker or contains a phosphatase-cleavable portion. Acid pyrophosphatase and acid phosphatase are present in lysosomes and hydrolyze pyrophosphate and terminal phosphate to alcohols, respectively. For example, pyrophosphatase and phosphatase present in the lysosomal compartment of a cell encountered after ADC internalization via endocytosis facilitate the release of the payload from the phosphatase-cleavable linker. In some embodiments, the phosphatase-cleavable portion is a pyrophosphate or phosphate portion. In some cases, a suitable phosphatase-cleavable linker may be covalently linked to the payload via a pyrophosphate or phosphate portion.
[0129] In some embodiments, the cleavable linker may incorporate two or more cleavable moieties that are cleaved in response to different stimuli. For example, the cleavable linker may incorporate an acid-labile moiety and a glutathione-sensitive moiety (e.g., hydrazone and disulfide bond). As another example, the cleavable linker may incorporate a proteolytically cleavable moiety and a phosphatase-cleavable moiety (e.g., Val-Cit dipeptide and phosphate moiety). Cleavable linkers are known in the art and described in, for example, the following references: Bargh et al. 2019 (Bargh, Jonathan D., et al. "Cleavable linkers in antibody–drug conjugates." Chemical Society Reviews 48.16 (2019):4361-4374), Sheyi et al. 2022 (Sheyi, Rotimi, Beatriz G. de la Torre, and Fernando Albericio. "Linkers: An assurance for controlled delivery of antibody-drug conjugate." Pharmaceutics 14.2 (2022):396), and Jain et al. 2025 (Jain, Nareshkumar, et al. "Current ADC linker chemistry." Pharmaceutical research 32.11 (2015):3526-3540), the entire contents of which are incorporated herein by reference.
[0130] Non-cuttable connector
[0131] In some embodiments, the ADC is non-cleavable or substantially non-cleavable in vivo. Non-cleavable linkers contain a stable portion that prevents enzymatic or chemical degradation and ensures greater stability in circulating plasma than cleavable linker counterparts. Release of the payload from the ADC using a non-cleavable linker depends on lysosomal degradation of the antibody after ADC internalization. Exemplary non-cleavable linkers include maleimide hexanoyl (MC) linkers, maleimide methylcyclohexane-1-carboxylate (MCC) linkers, N-succinimidyl-4-(maleimide methyl)cyclohexane-1-carboxylate (SMCC) linkers, and derivatives thereof. For example, suitable adapters for incorporating non-cuttable portions include, but are not limited to, those for trastuzumab emtansine, PF-06263507, deperazine malfodotin, AGS16F, MEDI-547, vorsutuzumab malfodotin, denizumab malfodotin, rupatuzumab amadodine, aprotuzumab ethadodine, AMG 172, LOP628, lapituzumab entansin, AMG 595, PCA062, AMG 224, BAT8001, and BAT8003. Non-cleavable linkers are known in the art and described in, for example, the following references: Sheyi et al. 2022 (Sheyi, Rotimi, Beatriz G. de la Torre, and Fernando Albericio. Linkers: An assurance for controlled delivery of antibody-drug conjugate. Pharmaceutics 14.2 (2022):396), and Jain et al. 2025 (Jain, Nareshkumar, et al.. Current ADC linker chemistry. Pharmaceutical research 32.11 (2015):3526-3540), the entire contents of which are incorporated herein by reference.
[0132] Interval
[0133] In some embodiments, the adapter (e.g., a cleavable or non-cleavable adapter) may include one or more spacer regions. In some cases, due to the size and / or structure of the payload, a spacer region may be needed to prevent the payload from spatially interfering with the function of the cleavable portion in the adapter (e.g., a cleavable adapter), where the enzymatically cleavable portion must remain accessible to the corresponding enzyme. Exemplary spacer regions for adapters include polyethylene glycol (PEG) polymer portions. In some cases, cleaving of the cleavable adapter may result in the release of undesirable payload adducts when the payload is directly attached to the adapter. In such cases, a self-igniting spacer region portion may be used to attach the payload to the cleavable adapter. The self-igniting spacer region spontaneously decomposes after destroying adjacent connected cleavable portions, thereby allowing the release of a chemically unmodified (i.e., without undesirable adducts) payload. An exemplary self-igniting spacer region for the adapter described herein is a para-aminobenzylcarbamate (PABC) spacer region. For example, the PABC adapter may be attached to an adjacent cleavable dipeptide portion via an amide bond. After the amide bond is cleaved by protein hydrolysis, the PABC linker spontaneously decomposes through a 1,6-elimination reaction, releasing CO2, aza-quinone methylate, and the desired payload. Self-immolative spacers are known in the art and are reviewed in the following literature: Alouane et al. 2015 (Alouane, Ahmed, et al. "Self-immolative spacers: kinetic aspects, structure-property relations, and applications." Angewandte Chemie International Edition 54.26 (2015):7492-7509), Bargh et al. 2019 (Bargh, Jonathan D., et al. "Cleavable linkers in antibody-drug conjugates." Chemical Society Reviews 48.16 (2019):4361-4374), Sheyi et al. 2022 (Sheyi, Rotimi, Beatriz G. de la Torre, and Fernando Albericio. "Linkers: An assurance for controlled delivery of antibody-drug conjugate." Pharmaceutics 14.2 (2022):396), which are incorporated herein by reference in their entirety.
[0134] Branch / Multi-valent connector
[0135] In some implementations, the adapter is a branched or multivalent adapter (i.e., attaching more than one payload molecule to a single site on the antibody). In some cases, the multivalent adapter may be selectively cleavable in vivo. Methods for manufacturing and using various multivalent and branched connectors in ADCs are known in the art and are described in, for example, WO 2009 / 073445, WO2010 / 068795, WO 2010 / 138719, WO 2011 / 120053, WO 2011 / 171020, WO 2013 / 096901, WO2014 / 008375, WO 2014 / 093379, WO 2014 / 093394, WO 2014 / 093640, WO / 2015 / 054659, WO2018 / 098269, WO 2018 / 237262, WO 2021 / 142199 (the entire contents of which are incorporated herein by reference).
[0136] Non-covalent connector
[0137] In some embodiments, the linker may be a non-covalent linker. For example, in some cases, the non-covalent linker may include a first member of a specific binding pair that is capable of non-covalently binding to a second member of the specific binding pair, which is linked to or incorporated therein into the payload molecule. An exemplary linker comprising the first and second members of a specific binding pair suitable for the ADC of this disclosure is an avidin-biotin linker. The avidin linker comprises an avidin polypeptide (e.g., avidin, streptoavidin, neutral avidin) that may have high affinity (e.g., K+). D ≈ 10 -10 Up to 10 -15M) binds to or incorporates a biotin moiety linked to or incorporated into a payload molecule (i.e., a biotinylated payload molecule). Avidin-based linkers for attaching biotinylated payloads to antibodies are known in the art and described, for example, in the following literature: Xia et al. 2009 (Xia, Chun-Fang, Ruben J. Boado and William M. Pardridge. "Antibody-mediated targeting of siRNA via the human insulin receptor using avidin-biotin technology." Molecular pharmaceutics 6.3 (2009):747-751), the entire contents of which are incorporated herein by reference.
[0138] In some cases, the connector can be an ionic or electrostatic connector. For example, when the payload molecule exhibits sufficient charge under relevant physiological conditions, a connector with the opposite charge can be used to attach a charged payload to an antibody. For example, when the payload molecule is negatively charged (e.g., in the case of a nucleic acid), the connector can be a positively charged connector. Exemplary positively charged connectors for attaching negatively charged payload molecules (e.g., nucleic acid payloads) include, but are not limited to, polyarginine connectors, polylysine connectors, and protamine connectors. Ionic and electrostatic connectors for attaching negatively charged payloads (e.g., nucleic acids) to antibodies are known in the art and described, for example, in the following literature: Song et al. 2005 (Song, Erwei, et al. "Antibody mediated in vivo delivery of small interfering RNAs via cell-surface receptors."). Nature biotechnology 23.6(2005):709-717), Chandela et al. 2019 (Chandela, Akash and Yoshihito Ueno. "Systemic delivery of small interfering RNA therapeutics: Obstacles and advances." Reviews in Agricultural Science7 (2019):10-28), Shi et al. 2019 (Shi, Sheng-Jia, et al. "Therapeutic effects of human monoclonal PSMA antibody-mediated TRIM24 siRNA delivery in PSMA-positive castration-resistant prostate cancer." Theranostics 9.5 (2019):1247) and Lu et al. 2013 (Lu, Hua, et al. "Site-specific antibody–polymer conjugates for siRNA delivery." Journal of the American Chemical Society 135.37 (2013):13885-13891), the full contents of each of these articles are incorporated herein by reference.
[0139] In some cases, when the payload is a nucleic acid (e.g., RNA or DNA oligonucleotide), the linker can be an oligonucleotide designed to specifically hybridize with all or part of the nucleic acid payload, thereby non-covalently linking the nucleic acid payload to the antibody. Oligonucleotide linkers for linking nucleic acid payloads to antibodies via hybridization are known in the art and described in, for example, the following literature: Hsu et al. 2020 (Hsu, Nai-Shu, et al. "Development of aversatile and modular linker for antibody–drug conjugates based on oligonucleotide strand pairing." Bioconjugate Chemistry 31.7 (2020):1804-1811) and Dovgan et al. 2020 (Dovgan, Igor, et al. "On the use of DNA as a linker in antibody-drug conjugates: synthesis, stability and in vitro potency." Scientific Reports 10.1 (2020):7691), the entire contents of each of which are incorporated herein by reference.
[0140] Masked / prodrug ADC
[0141] In some embodiments, the ADC of this disclosure may comprise a masking (i.e., prodrug) antibody. While the antibody in the ADC provides target specificity for the associated payload, there remains a potential risk of off-target delivery of the payload, for example, in cases where the antigen targeted by the antibody in the ADC is also expressed in non-target cells or non-target tissues (e.g., non-cancer cells). In such cases, additional selectivity of the ADC can be achieved by masking, blocking, or otherwise preventing the binding of the antibody's complementary site to its antigenic target (i.e., the inactive prodrug form) upon administration, and by exposing, unblocking, or otherwise allowing the antibody's complementary site to bind to its associated antigen (i.e., the active pharmaceutical form) upon proximity to a target tissue region (e.g., a tumor). In some embodiments, the masking ADC may comprise an antibody having an anti-idiotype masking agent (e.g., an epitope mimic). In some embodiments, the masking ADC may comprise an antibody having a spatial masking agent. Demasking of the antibody (i.e., conversion from the prodrug form to the pharmaceutical form) can be triggered by any suitable stimulus capable of distinguishing the target tissue from the target tissue.
[0142] Masking and / or prodrug antibodies used in the ADCs of this disclosure are known in the art and are reviewed, for example, in the following literature: Lucci et al. 2021 (Lucchi, Roberta, Jordi Bentanachs and Benjamí Oller-Salvia. "The masking game: design of activatable antibodies and mimetics for selective therapeutics and cell control." ACS central science 7.5 (2021):724-738), the entire contents of which are incorporated herein by reference.
[0143] Shielded connector
[0144] In some embodiments, antibody demasking can be triggered by a proteolytic enzyme that acts on a cleavable linker peptide that binds the masking agent to the antibody. In some cases, the cleavable peptide linker is a proteolytically cleavable peptide. When encountering a target tissue environment characterized by high levels of proteolytic enzyme activity (such as the tumor microenvironment), the proteolytically cleavable linker is cleaved and releases the masking agent, allowing the antibody to bind to its target antigen. The proteolytically cleavable peptide linker may contain any suitable proteolytic enzyme substrate sequence. Suitable amino acid sequences for proteolytically cleavable linkers include substrates of matrix metalloproteinases (MMPs) (such as MMP-2 or MMP-9). Cancer-associated proteolytic enzyme substrates are known in the art and described, for example, in the following literature: Vasiljeva et al. 2019 (Vasiljeva, Olga, et al. "The multifaceted roles of tumor-associated proteases and harnessing their activity for prodrug activation."). Biological Chemistry 400.8 (2019):965-977) and Sevenich et al. 2014 (Sevenich, Lisa, and Johanna A. Joyce. "Pericellular proteolysis in cancer." Genes & development 28.21 (2014):2331-2347), the full content of each of the references is incorporated into this paper by reference.
[0145] Anti-unique masking agent
[0146] In some embodiments, the masked ADC of this disclosure comprises an antibody having an anti-idiotype masking agent. The anti-idiotype masking agent is specific to the complementarity of the antibody and interacts specifically with the complementary site of the antibody, thereby preventing the antibody from binding to its homologous epitope.
[0147] In some implementations, the anti-idiotypic masking agent is an epitope mimicry peptide, also known as a mimicry epitope, which is tethered to the N-terminus of the antibody via a cleavable peptide linker and specifically binds to the antibody's complementary site. The mimicry epitope or epitope mimicry peptide structurally mimics the associated epitope, thereby competing with the associated epitope for binding to the antibody's complementary site. In some cases, the cleavable peptide linker is a proteolytically cleavable peptide as described above. Upon encountering a target tissue environment characterized by high levels of active proteases, the proteolytically cleavable linker is cleaved, releasing the mimicry epitope peptide, thereby enabling the antibody to bind to its target antigen. Mimicry epitope peptides for masking antibodies are known in the art and described, for example, in the following publications: WO 2009 / 025846, WO 2010 / 081173, WO 2013 / 163631 and Kavanaugh 2020 (Kavanaugh, W. Michael. "Antibody prodrugs for cancer." Expert opinion on biological therapy 20.2 (2020):163-171), the full contents of which are incorporated herein by reference.
[0148] In some embodiments, the anti-idiotypic masking agent is an antigen-binding peptide, or may comprise an antigen-binding fragment peptide that is specific to the complementary site or variable fragment region of the antibody in such a way that the homologous epitope is blocked and cannot bind to the complementary site of the antibody. In some cases, the antigen-binding peptide masking agent is bispecific to large serum proteins (e.g., albumin) and ADC antibodies, which adds additional steric hindrance to the binding of the ADC antibody to its homologous epitope. In some embodiments, the antigen-binding peptide masking agent is tethered to the N-terminus of the antibody via a cleavable peptide linker. In some cases, the cleavable peptide linker is a proteolytically cleavable peptide as described above. Upon encountering a target tissue environment characterized by high levels of active proteases, the proteolytically cleavable linker is cleaved, and the antigen-binding peptide masking agent is released, allowing the antibody to bind to its target antigen. Antigen-binding peptide masking agents are known in the art and described in, for example, the following publications: WO 2019 / 222282, WO 2019 / 222283, WO 2023 / 064945 and Borras et al. 2023 (Borras, Anna Mestre, et al. "Generation of an anti-idiotypic affibody-based masking domain for conditional activation of EGFR-targeting." New Biotechnology 73 (2023):9-18), the full contents of each of which are incorporated herein by reference.
[0149] Spatial steric masking agent
[0150] In some embodiments, the masked ADC of this disclosure comprises an antibody having a steric hindrance masking agent. The steric hindrance masking is antibody-specific (e.g., not specific to epitopes of the antibody's variable domains) and prevents the antibody from binding to its homologous epitopes by steric hindrance and physical blocking of the antibody's complementary site. In some embodiments, the steric hindrance masking agent is a polypeptide that specifically binds to a large serum protein, such that the binding of the large serum protein sterically inhibits the binding of the antibody to its target antigen, wherein the steric hindrance masking agent itself does not bind to the antibody's complementary site or variable domain. The large serum protein can be any suitable large protein present in high abundance in serum. Exemplary large serum proteins that the steric hindrance masking polypeptide can specifically bind include, but are not limited to, albumin, fibrinogen, fibronectin, hemoglobin, transferrin, and immunoglobulins. In some embodiments, the steric hindrance masking polypeptide is tethered to the N-terminus of the antibody via a cleavable polypeptide linker. In some cases, the cleavable polypeptide linker is a proteolytically cleavable polypeptide as described above. When encountering a target tissue environment characterized by high levels of active proteolytic enzymes, the proteolytically bound linkers are blocked, and sterically blocked masking peptides are released, allowing antibodies to bind to their target antigens. Stericly blocked masking peptides are known in the art and described, for example, in the following documents: WO 2013 / 192546 and WO 2014 / 197612A1, the entire contents of which are incorporated herein by reference.
[0151] Nucleic acid
[0152] Nucleic acids (e.g., expression vectors) containing nucleotide sequences encoding the polypeptides of the present invention are also provided. The nucleic acids of the present invention can be produced by any method. Since the genetic code for manipulating nucleic acids and recombination techniques are known, the design and production of nucleic acids encoding the fusion proteins of the present invention are entirely within the skill of those skilled in the art. In some embodiments, standard recombinant DNA techniques are used (Ausubel et al., Short Protocols in Molecular Biology, 3rd edition, Wiley & Sons, 1995; Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition, (1989) Cold Spring Harbor, NY).
[0153] Purification methods
[0154] This disclosure provides a method for generating the polypeptides of the present invention. The method generally includes culturing host cells genetically modified with one or more nucleic acids (e.g., one or more recombinant expression vectors) in a culture medium, said nucleic acids containing a nucleotide sequence encoding the polypeptide; and isolating said polypeptide from the genetically modified host cells and / or the culture medium. Host cells genetically modified with one or more nucleic acids containing a nucleotide sequence encoding the polypeptide (e.g., one or more recombinant expression vectors) are also referred to as “expression hosts.” As described above, in some cases, the polypeptide may be encoded in separate nucleic acids (e.g., separate recombinant expression vectors). In some cases, the polypeptide may be encoded in a single nucleic acid (e.g., a single recombinant expression vector).
[0155] Peptides can be isolated from expression host cells (e.g., from lysates of expression host cells) and / or from the culture medium in which host cells are cultured, using standard methods for protein purification.
[0156] For example, lysates of the expressed host can be prepared and purified using high-performance liquid chromatography (HPLC), size exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification techniques. Alternatively, when the peptide is secreted from the expression host cell into the culture medium, the peptide can be purified from the culture medium using HPLC, size exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification techniques. In some cases, the composition used will contain at least 80% by weight, at least about 85% by weight, at least about 95% by weight, or at least about 99.5% by weight of the desired product (peptide) relative to contaminants associated with the product preparation and purification methods. Percentages may be based on total protein.
[0157] Pharmaceutical Composition
[0158] Pharmaceutical compositions are also provided comprising a polypeptide or a polynucleotide (e.g., RNA) encoding the polypeptide as described above and a pharmaceutically acceptable carrier. In any of these embodiments, the polypeptide in the composition may be a multispecific binding molecule comprising a domain that binds to a cancer antigen and at least one other binding domain. In some embodiments, the polypeptide may be BiKE or TriKE, as described above.
[0159] Many pharmaceutically acceptable ingredients are known in the art and therefore will not be discussed in detail herein. Furthermore, pharmaceutically acceptable ingredients and compositions have been well described in numerous publications, including but not limited to A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) HC Ansel et al., editors, 7th edition, Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) AH Kibbe et al., editors, 3rd edition, Amer. Pharmaceutical Assoc. Many of its comprehensive publications describing the preparation of biopharmaceutical compositions can be consulted.
[0160] The composition can be formulated according to the various routes of administration described below. Generally, the polypeptide of this disclosure will be an aqueous liquid and will typically be administered by intravenous infusion. In some cases, the pharmaceutical composition containing the polypeptide may be mixed with saline (e.g., 0.9% NaCl) prior to intravenous administration. Therefore, this disclosure provides a sterile composition comprising: a) the polypeptide of this disclosure; and b) saline (e.g., 0.9% NaCl). Alternatively, it may be administered directly by intravenous infusion, i.e., without further dilution. Alternatively, the pharmaceutical composition may be formulated for administration by injection.
[0161] method
[0162] This article also provides several other methods.
[0163] In some embodiments, the method can increase the binding between NK cells (e.g., CD3- / CD56+ cells, which are also CD7+ / CD127- / NKp46+ / T-bet+ / Eomes+) and cancer cells. These embodiments may include incubating NK cells and cancer cells with the polypeptide of the present invention, wherein said polypeptide is a multispecific binding molecule comprising a VHH domain, an antibody-binding domain or a ferrule domain, and at least one other binding domain that binds to cancer antigens on cancer cells. As described above, in these embodiments, the polypeptide can bind to NK cells and cancer cells, which can lead to NK cell activation and subsequent cancer cell death. This reaction can occur in vitro, in vivo, or ex vivo.
[0164] A method for increasing the binding between NK cells and virus-infected cells is also provided. This method may include incubating NK cells and virus-infected cells with a polypeptide of the present invention, wherein the polypeptide is a multispecific binding molecule comprising a VHH domain, an antibody-binding domain or a ferrule domain, and at least one other binding domain that binds to viral antigens on virus-infected cells. In these embodiments, the polypeptide can bind to NK cells and virus-infected cells, which can induce NK cell activation and subsequent cell death in the virus-infected cells. This reaction can occur in vitro, in vivo, or ex vivo.
[0165] In relevant embodiments, the method may include contacting cancer cells with NK cells (e.g., CD3- / CD56+, which are also CD7+ / CD127- / NKp46+ / T-bet+ / Eomes+) and the polypeptide of the present invention, wherein the polypeptide is a multispecific binding molecule comprising a VHH domain, an antibody-binding domain or a ferrule domain, and at least one other binding domain that binds to cancer antigens on cancer cells. As described above, in these embodiments, the polypeptide can bind to NK cells and cancer cells, which can lead to NK cell activation and subsequent cancer cell death. This reaction can occur in vitro, in vivo, or ex vivo.
[0166] Methods for killing virus-infected cells are also provided. In these embodiments, the method may include contacting virus-infected cells with NK cells and a polypeptide of the present invention, wherein the polypeptide is a multispecific binding molecule comprising a VHH domain, an antibody-binding domain or a ferrule domain, and at least one other binding domain that binds to viral antigens on virus-infected cells. In these embodiments, the polypeptide may bind to both NK cells and virus-infected cells simultaneously, which may lead to NK cell activation and subsequent death of virus-infected cells. This reaction may occur in vitro, in vivo, or ex vivo.
[0167] Treatment methods are also provided. In these embodiments, the method may include administering the polypeptide of the present invention or a polynucleotide (e.g., RNA) encoding said polypeptide to a subject suffering from cancer, wherein said polypeptide is a multispecific binding molecule comprising a VHH domain, an antibody-binding domain or a ferrule domain, and at least one other binding domain that binds to a cancer antigen on cancer cells. The cancer antigen may be selected based on the cancer being treated. Suitable cancer antigens / cancers include: CD19, CD20, or BCMA (for B-cell malignancies, including acute myeloid leukemia (AML), multiple myeloma (MM), B-cell acute lymphoblastic leukemia (B-ALL), lymphoma, etc.), ALPP (e.g., for ovarian cancer and endometrial cancer), CS1 (SLAMF7) (e.g., for R / R multiple myeloma), CLDN18.2 (e.g., for pancreatic cancer and gastric adenocarcinoma, gastric cancer), AXL (e.g., for renal cell carcinoma), ROR2 (e.g., for renal cell carcinoma), TM4SF1 (e.g., for advanced solid tumors), ICAM-1 (e.g., for anaplastic thyroid cancer), L1CAM (CD171) (e.g., for neuroblastoma, ganglioneuroma), CD4 (e.g., for T-cell lymphoma, T-cell leukemia), CD5 (T-cell acute lymphoblastic lymphoma, non-Hodgkin's T-cell lymphoma), CD7 (e.g., for T-cell acute lymphoblastic lymphoma, T-cell acute lymphoblastic leukemia, non-Hodgkin's T-cell lymphoma), CD10 (e.g., for CD19-negative B-cell malignancies), CD38 (e.g., for CD19-negative B-cell malignancies), CEA (e.g., for lung cancer, colorectal cancer, liver cancer, pancreatic cancer, gastric cancer, and breast cancer), FLT3 (e.g., for R / R acute myeloid leukemia), CD70 (e.g., for pancreatic cancer, renal cell carcinoma, ovarian cancer, breast cancer, and melanoma), CD30 (e.g., for Hodgkin's lymphoma), CD37 (e.g., for leukemia and B-cell, T-cell, and non-Hodgkin's lymphoma), CD147 (e.g., for glioblastoma).
[0168] Alternatively, the treatment method may include administering the polypeptide of the present invention or a polynucleotide (e.g., RNA) encoding the polypeptide to a subject suffering from a viral infection, wherein the polypeptide is a multispecific binding molecule comprising a VHH domain, an antibody-binding domain or a sclerotium domain, and at least one other binding domain that binds to viral antigens on viral-infected cells.
[0169] Subjects suitable for treatment with the methods of the present invention include individuals with cancer, including individuals who have been diagnosed with cancer, individuals who have received cancer treatment but are unresponsive to treatment, and individuals who have received cancer treatment but initially responded but subsequently became refractory to treatment and / or whose disease progressed during previous treatment.
[0170] Cancers treatable with this method include any cancer that can be targeted by the peptides of this invention. Cancers treatable with this method include carcinoma, sarcoma, melanoma, leukemia, lymphoma, and multiple myeloma. Cancers treatable with this method include solid tumors and cancers originating in hematopoietic tissue, i.e., blood cancers, such as leukemia, lymphoma, and multiple myeloma. Cancers treatable with this method include metastatic cancers. Cancers that can be treated using the methods disclosed herein include, but are not limited to, esophageal cancer, hepatocellular carcinoma, basal cell carcinoma (a form of skin cancer), squamous cell carcinoma (various tissues), bladder cancer (including transitional cell carcinoma (a malignant tumor of the bladder)), bronchogenic carcinoma, colon cancer, colorectal cancer, gastric cancer, lung cancer (including small cell lung cancer and non-small cell lung cancer), adrenocortical carcinoma, thyroid cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, adenocarcinoma, sweat gland cancer, sebaceous gland cancer, papillary carcinoma, papillary adenocarcinoma, cystic adenocarcinoma, medullary carcinoma, renal cell carcinoma, ductal carcinoma in situ or bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, uterine cancer, testicular cancer, osteoblastic carcinoma, epithelial carcinoma, and nasopharyngeal carcinoma. Sarcomas treatable using the methods disclosed herein include, but are not limited to, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, chordoma, osteosarcoma, osteosarcoma, angiosarcoma, endothelial sarcoma, lymphangiosarcoma, lymphangioendothelial sarcoma, synovoma, mesothelioma, Ewing sarcoma, leiomyosarcoma, rhabdomyosarcoma, and other soft tissue sarcomas. Other solid tumors treatable using the methods disclosed herein include, but are not limited to, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pineal tumor, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma.
[0171] Leukemias treatable using the methods disclosed herein include, but are not limited to: a) chronic myeloproliferative syndromes (neoplastic diseases of pluripotent hematopoietic stem cells); b) acute myeloid leukemia (neoplastic transformation of pluripotent hematopoietic stem cells or hematopoietic cells of restricted lineage potential); c) chronic lymphocytic leukemia (CLL; clonal proliferation of immunologically immature and dysfunctional small lymphocytes), including B-cell CLL, T-cell CLL, prolymphocytic leukemia, and hairy cell leukemia; and d) acute lymphoblastic leukemia (characterized by the accumulation of lymphoblasts). Lymphomas treatable using the methods of this invention include, but are not limited to, B-cell lymphomas (e.g., Burkitt lymphoma); Hodgkin lymphoma; and non-Hodgkin lymphoma.
[0172] Other cancers treatable according to the methods disclosed herein include atypical meningioma, pancreatic islet cell carcinoma, medullary thyroid carcinoma, mesenchymal tumor, hepatocellular carcinoma, hepatoblastoma, clear cell renal cell carcinoma, and mediastinal neurofibroma. In some cases, the “effective amount” of the polypeptide or the polynucleotide (e.g., RNA) encoding the polypeptide is the amount by which the number of cancer cells in an individual is reduced when administered to an individual in need at one or more doses. For example, in some cases, the “effective amount” of the polypeptide or the polynucleotide (e.g., RNA) encoding the polypeptide is the amount by which the number of cancer cells in an individual is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% when administered to an individual in need at one or more doses, compared to the number of cancer cells in the individual before or without the administration of the polypeptide. In some cases, the “effective amount” of a polypeptide or a polynucleotide (e.g., RNA) encoding a polypeptide is the amount that, when administered to an individual in need at one or more doses, reduces the number of cancer cells in that individual to an undetectable level.
[0173] In some cases, the “effective amount” of a polypeptide or a polynucleotide (e.g., RNA) encoding said polypeptide is the amount by which the tumor mass / tumor volume of an individual is reduced when administered to an individual in need at one or more doses. In some cases, the “effective amount” of a polypeptide is the amount by which the survival time of an individual is increased when administered to an individual in need at one or more doses. For example, in some cases, the “effective amount” of a polypeptide or a polynucleotide (e.g., RNA) encoding said polypeptide is an amount that, when administered to an individual in need at one or more doses, increases the individual’s survival time by at least 1 month, at least 2 months, at least 3 months, 3 months to 6 months, 6 months to 1 year, 1 to 2 years, 2 to 5 years, 5 to 10 years, or more than 10 years compared to the individual’s expected survival time without the administration of said polypeptide or polynucleotide (e.g., RNA).
[0174] Conventional and pharmaceutically acceptable routes of administration include intratumoral, peritumoral, intramuscular, intralymphatic, intratracheal, intracranial, intraventricular, subcutaneous, intradermal, topical application, intravenous, intra-arterial, rectal, nasal, oral, and other enteral and parenteral routes. As mentioned above, pharmaceutical compositions comprising polypeptides or polynucleotides (e.g., RNA) encoding said polypeptides are typically administered intravenously, but may also be administered via other routes including injection.
[0175] In any implementation, the polypeptide can be administered to the subject by administering a polynucleotide (e.g., RNA) encoding the polypeptide to the patient. For reviews of such therapeutics, see, for example, van Hoecke et al. (Journal of Translational Medicine 2019 17: 54), Deal et al. (Vaccines 2021 9:108), Tai et al. (Nature Communications 2023 14:8042), and Schlake et al. (Molecular Therapy 2019 27:P773-784).
[0176] Combination therapy
[0177] In some cases, a polypeptide or a polynucleotide (e.g., RNA) encoding said polypeptide may be administered (together or sequentially) with at least one additional therapeutic agent or therapeutic treatment. Suitable additional therapeutic agents include, but are not limited to, small molecule cancer chemotherapeutic agents and immune checkpoint inhibitors. Suitable additional therapeutic treatments include, for example, irradiation, surgery (e.g., surgical resection of a tumor), etc.
[0178] The treatment methods disclosed herein may include the co-administration of a polypeptide or a polynucleotide (e.g., RNA) encoding said polypeptide and at least one additional therapeutic agent. "Co-administration" means administering both the polypeptide and at least one additional therapeutic agent to an individual, although not necessarily simultaneously, to achieve the therapeutic effect produced by simultaneous administration of the polypeptide and at least one additional therapeutic agent. The administration of the polypeptide and at least one additional therapeutic agent may be substantially simultaneous; for example, the polypeptide may be administered to the individual from about 1 minute to about 24 hours after administration of at least one additional therapeutic agent (e.g., within about 1 minute, about 5 minutes, about 15 minutes, about 30 minutes, about 1 hour, about 4 hours, about 8 hours, about 12 hours, or about 24 hours). In some cases, the polypeptide of this disclosure is administered to an individual who is receiving or has received said at least one additional therapeutic agent. The administration of the polypeptide may be performed at different times and / or at different frequencies.
[0179] In some cases, the subject is an individual receiving immune checkpoint inhibitor therapy. In some cases, the subject is an individual who has already received immune checkpoint inhibitor therapy, but whose disease is still progressing despite this treatment. In some cases, the subject is an individual who is receiving or has received cancer chemotherapy. In some cases, the subject is an individual who is preparing to receive, is receiving, or has received immune checkpoint inhibitor therapy. In some cases, the subject is an individual who is preparing to receive, is receiving, or has received cancer chemotherapy, radiation therapy, surgery, and / or another therapeutic agent. In some cases, a pharmaceutical composition comprising a peptide is administered in adjuvant or neoadjuvant therapy settings.
[0180] Exemplary immune checkpoint inhibitors include inhibitors that target immune checkpoint peptides such as CD27, CD28, CD40, CD122, CD96, CD73, CD47, OX40, GITR, CSF1R, JAK, PI3Kδ, PI3Kγ, TAM, arginase, CD137 (also known as 4-1BB), ICOS, A2AR, B7-H3, B7-H4, BTLA, CTLA-4, LAG3, TIM3, VISTA, CD96, TIGIT, CD122, PD-1, PD-L1, and PD-L2. In some cases, the immune checkpoint peptide is a stimulatory checkpoint molecule selected from CD27, CD28, CD40, ICOS, OX40, GITR, CD122, and CD137. In some cases, immune checkpoint peptides are inhibitory checkpoint molecules selected from A2AR, B7-H3, B7-H4, BTLA, CTLA-4, IDO, KIR, LAG3, PD-1, TIM3, CD96, TIGIT, and VISTA.
[0181] Combination therapies include, for example, (a) anthracycline therapy (e.g., by administration of daunorubicin, doxorubicin, or mitoxantrone); (b) alkylating agent therapy (e.g., by administration of nitrogen mustard, cyclophosphamide, ifosfamide, melphalan, cisplatin, carboplatin, nitrosourea, dacarbazine, and procarbazine or busulfan); (c) topoisomerase II inhibitor therapy (e.g., by administration of etoposide or teniposide); (d) bleomycin therapy; (e) antimetabolite therapy (e.g., by administration of methotrexate, 5-fluorouracil, cytarabine, 6-mercaptopurine, or 6-thioguanine); (f) vinca alkaloid therapy (e.g., by administration of vincristine or vinblastine); (g) steroid therapy (e.g., by administration of prednisone or dexamethasone); and (h) radiation therapy, etc. Alternative therapies include targeted and non-targeted chemotherapy. Targeted therapies include treatment with erlotinib (Tarceva), afatinib (Gilotrif), gefitinib (Iressa), or osimertinib (Tagrisso) (which can be administered to patients with activating mutations in EGFR); treatment with crizotinib (Xalkori), ceritinib (Zykadia), alectinib (Alecensa), or brigatinib (Alunbrig) (which can be administered to patients with ALK fusions); and treatment with crizotinib (Xalkori). Treatment options include entrectinib (RXDX-101), lorlatinib (PF-06463922), crizotinib (Xalkori), entrectinib (RXDX-101), lorlatinib (PF-06463922), loprotinib (TPX-0005), DS-6051b, ceritinib, ensartinib, or cabozantinib (available for patients with ROS1 fusions); or dabrafenib (Tafinlar) or trametinib (Mekinist) (available for patients with activating mutations in BRAF). Many other operable mutations are known. If the patient is to be switched to non-targeted chemotherapy, the therapy may be, for example, platinum-based doublet chemotherapy (which may contain a platinum-based drug selected from cisplatin (CDDP), carboplatin (CBDCA) and nedaplatin (CDGP)) and a third-generation drug (selected from docetaxel (DTX), paclitaxel (PTX), vinorelbine (VNR), gemcitabine (GEM), irinotecan (CPT-11), pemetrexed (PEM) and tegafur gimeracil oteracil (S1)).
[0182] Sequences and Data Tables
[0183] The appendix to this disclosure provides sequences and data that are mentioned in other parts of this disclosure. Brief descriptions of the tables in the appendix are provided below.
[0184] Table 1 provides information on engineered chickens (called Omni) dAb CDR sequences of 96 VHH domain antibodies produced in chickens that bind to NKp46.
[0185] Table 2 provides the full sequences of the variable domains of the antibodies listed in Table 1.
[0186] Table 3 provides the data from fixed light chain rats (i.e., OMNIFLIC). ® The heavy chain CDR sequences of 245 antibodies produced by rats (OmniAb, Inc., where the light chain has limited diversity) were analyzed.
[0187] Table 4 provides the full sequence of the heavy chain variable domain of the rat antibodies listed in Table 3.
[0188] The heavy chains whose sequences are listed in Tables 3 and 4 are paired with the same light chains (“common” light chains) to produce antibodies that bind to NKp46. The light chain CDRs of the antibodies listed in Tables 3 and 4 have the following sequences: CDRL1: QSVSSN (SEQ ID NO: 2212), CDRL2: GAS, and CDRL3: QQYNNWPWT (SEQ ID NO: 2213).
[0189] The full sequences of the variable light chain domains of the antibodies listed in Tables 3 and 4 are as follows:
[0190] EIVMTQSPATLSVSPGERATLSCRASQSVSSNLAWYQQKPGQAPRLLIYGASTRATGIPARFSGSGSGTEFTLTISSLQSEDFAVYYCQQYNNWPWTFGQGTKVEIK (SEQ ID NO: 2214).
[0191] Table 5 provides the dissociation constants of the NKp46 antibody as listed in Tables 3 and 4, as measured by surface plasmon resonance (SPR).
[0192] Table 6 provides the heavy chain CDR sequences of 170 antibodies produced from fixed light chain chickens (chickens known as "OmniClic chickens," where the light chain has limited diversity).
[0193] Table 7 provides the full sequences of the heavy chain variable domains of the chicken antibodies listed in Table 6.
[0194] The heavy chains listed in Tables 6 and 7 all pair with the same light chain (“common” light chain) to produce antibodies that bind to NKp46. The light chain CDRs of the antibodies listed in Tables 6 and 7 have the following sequences: CDRL1: QSVSSN (SEQ ID NO:2215), CDRL2: GAS, and CDRL3: QQYNNWPPWT (SEQ ID NO:2216).
[0195] The full sequences of the variable light chain domains of the antibodies listed in Tables 6 and 7 are as follows:
[0196] EIVMTQSPATLSVSPGERATLSCRASQSVSSNLAWYQQKPGQAPRLLIYGASTRATGIPARFSGSGSGTEFTLTISSLQSEDFAVYYCQQYNNWPPWTFGQGTKVEIK (SEQ ID NO: 2217).
[0197] Table 8 provides the dissociation constants of the antibodies listed in Tables 6 and 7 as measured by SPR (for binding to NKp46).
[0198] Table 9 provides the sequences of the ultralong heavy chain CDR3 of nine bovine antibodies that bind to NKp46. In this table, sequences corresponding to the spheroidal domain are underlined.
[0199] Table 10 provides information on engineered chickens (called "Omni"). dAb "Chicken"; CDR sequences of 35 other VHH domain antibodies that bind to NKp46, produced in Crystal Bioscience, Inc.
[0200] Table 11 provides the full sequences of the variable domains of the antibodies listed in Table 10.
[0201] Antibodies CL-2491, CL-27978, CL-27965, CL-2486, CL-27182, CL-25178, CL-25092, CL-25992, CL-25883, CL-25880, CL-26579, CL-8869, CL-8953, CL-8855, CL-8909, CL-28043, CL-2425, NGS-03 (antibody SK5 in Table 9), NGS-02 (antibody SK7 in Table 9), NGS-118, and NGS-145 were selected for subsequent studies based on their ability to induce ADDC as EGFR bispecific antibodies, the epitopes they bind to, or other properties (e.g., affinity). Other antibodies may be selected in addition to any of these, or alternative antibodies may be chosen to replace any of these antibodies.
[0202] Table 12 below is a lookup table that maps the antibody names described in the Embodiments section of this disclosure to clone IDs (as listed in Tables 1-11).
[0203]
[0204]
[0205] Example
[0206] The following embodiments are provided to provide a complete disclosure and description of how to make and use the invention to those skilled in the art, and are not intended to limit the scope of what the inventors consider to be their invention, nor to represent that the following experiments are all or only the experiments conducted. Efforts have been made to ensure the accuracy of the figures used (e.g., quantities, temperatures, etc.), but some experimental errors and deviations should be taken into account. Unless otherwise stated, parts are parts by weight, molecular weight is average molecular weight, temperature is degrees Celsius, and pressure is atmospheric pressure or close to atmospheric pressure. Standard abbreviations can be used, for example: AA = amino acid, AC-SINS = affinity capture of self-interacting nanoparticles, aSEC = analytical size exclusion chromatography, BiP = immunoglobulin-binding protein, bp = base pair, BRL = buffalo liver, BSA = bovine serum albumin, CDR = complementarity-determining region, CH = heavy chain constant domain, CHO = Chinese hamster ovary, cJH = chicken JH gene, CL = light chain constant domain, cVH = chicken VH gene, ELISA = enzyme-linked immunosorbent assay, FACS = fluorescence-activated cell sorting, Fc = crystallizable fragment, FCS = fetal bovine serum, FD = final blood collection, FDA = U.S. Food and Drug Administration, FR = frame region, GC = gene conversion, GEM = gel encapsulation microenvironment, GFP = green fluorescent protein, GRAVY = total average hydrophilicity, GRN = particulate protein domain, HcAb = Heavy chain antibodies only, HLA = Human leukocyte antigen, HPLC = High performance liquid chromatography, HRP = Horseradish peroxidase, ID = Identifier number, IFNγ = Interferon γ, IgG = Immunoglobulin G, IgH = Immunoglobulin heavy chain, IgL = Immunoglobulin light chain, IgM = Immunoglobulin M, Ig NAR = Immunoglobulin neoantigen receptor, IgY = Immunoglobulin Y, IMGT = International Immunogenetic Information System, K D= Equilibrium dissociation constant, KO = Knockout, mAb = Monoclonal antibody, MFI = Mean fluorescence intensity, MHC = Major histocompatibility complex, mRNA = Messenger ribonucleic acid, n / d = Undetermined, NK = Natural killer cells, PBMC = Peripheral blood mononuclear cells, PBS = Phosphate-buffered saline, PGC = Primordial germ cells, PGRN = Granulin precursor, PI = Pre-immunization, P-VHH = Heavy chain omega-3 dAb Pseudogenes with variable recombinant domains in transgenic organisms; qPCR = quantitative polymerase chain reaction; RT-PCR = reverse transcription polymerase chain reaction; scFv = single-stranded variable fragment; sdAb = single-domain antibody; SDS-PAGE = sodium dodecyl sulfate polyacrylamide gel electrophoresis; SHM = somatic high-frequency mutation; T agg = Accumulation temperature, TCR = T cell receptor, tLCi = truncated light chain transgene, T m = Demosis temperature, VH = Variable domain of heavy chain, VHH = Variable heavy chain domain of heavy chain only antibody, VHH3 = Heavy chain Omni dAb The variable heavy domain of the transgenic chain, VL = variable heavy domain of the light chain, WT = wild type.
[0207] Example 1
[0208] Production and characterization of anti-NKp46 VHH antibodies
[0209] Anti-NKp46 monoclonal antibodies were produced using transgenic chickens engineered to express VHH antibodies. These chickens had been genetically modified with a transgene expressing a human single-domain VH based on VH3-23, which was inserted into a chicken heavy chain immunoglobulin locus and spliced into an endogenous chicken constant region. Upstream of the single pre-rearranged VH gene was an array of 14 pseudogenes, whose frames 1-3 were identical in DNA sequence to frames 1-3 of the functional VH.
[0210] Immunization
[0211] Three transgenic chickens (bird numbers 72766, 72767, and 72773) were immunized with 100 μg of NKp46 ECD protein (fused to T-cell epitope tags and His tag boxes). These birds were given an initial dose (in complete Freund's adjuvant), followed by two intramuscular (IM) boosters (in incomplete Freund's adjuvant), and finally an IV booster without adjuvant (a total of four injections, each containing 100 μg of protein).
[0212] Plasma immunoglobulin titers in immunized birds were monitored using ELISA. NKp46-His protein (and the negative control protein, particle protein precursor-His) was coated onto PBS in ELISA plates at a concentration of 2 μg / mL, 50 μL / well, and incubated overnight at 4°C.
[0213] At room temperature, seal wells with 150 μL / well of 3% skim milk in PBS blocking buffer (BB) for 1 hour.
[0214] Wash the plate with PBS + 0.5% Tween 20 (PBST) using a plate washer (5 washes).
[0215] Dilute the serum in blocking buffer (1:500 dilution, then serially 5-fold dilution). Apply serum samples at 50 μL / well to the plate and incubate at room temperature for 1 hour.
[0216] The plate was washed with PBST using a plate washer.
[0217] Dilute the anti-chicken IgM-HRP to 1:5000 in blocking buffer and apply 50 μL / well to the plate. Incubate the secondary antibody at room temperature for 1 hour.
[0218] The plate was washed with PBST using a plate washer.
[0219] Apply 50 μL of TMB substrate to each well and develop the substrate at room temperature for 10 minutes.
[0220] Stop the color development with 50 μL / well of 1N hydrochloric acid.
[0221] The board was read at 450nm using a BioTek flatbed reader.
[0222] filter
[0223] Monoclonal antibodies against sdAb from avian cells 72773 and 72766 were screened using GEM technology (Mettler-Izquierdo, S. Microscopy (Oxf). 2016;65:341–52). Cells 72766 and 72767 were screened using the xPloration® high-throughput B-cell screening platform (OmniAb, Inc.). Beads were coated with NKp46 ECD protein and used to screen for monoclonal B cells that secrete antibodies that bind to the beads. Positive cells were selected for downstream cloning of the sdAb antibodies.
[0224] Antibody cloning
[0225] Single B cells (from GEM or xPloration) were placed in individual wells of a 96-well plate, and the sdAb heavy chain variable region was amplified by one-step reverse transcription-PCR. The RT-PCR reaction was performed using the Qiagen One-Step Kit. Reverse transcription is...
[0226] chVH-F9 (in the 5'UTR of the heavy chain transcript) CACCAGTCGGCTCCGCAACCATG (SEQ ID NO:2218)
[0227] cIgM-CH2-R (in the CH2 domain of the IgM constant region) GGGGTGCATGGTGACGAAAAG (SEQ IDNO:2219)
[0228] PCR conditions for amplifying the V region:
[0229] Initial denaturation: 95℃, 2 min
[0230] Denaturation: 95℃, 15 sec
[0231] Annealing: 58℃ for 30 seconds
[0232] Extension: 68℃, 1 min
[0233] 39 cycles
[0234] Final extension: 68°C, 10 min
[0235] Following amplification, PCR was performed on an agarose gel to collect and purify the variable region amplicons. The amplicons were then cloned into a modified pcDNA3.4 vector containing the human Fc sequence. The variable region of the sdAb was cloned into the vector using In-Fusion, and the cloning reaction was transformed into competent *E. coli*. Single colonies were selected, and miniprep DNA was prepared in 96-well plate arrays. Depending on the number of original B cells amplified, one or two colonies from each 96-well plate were selected for DNA preparation.
[0236] Small amounts of extracted DNA were transfected into HEK293 cells using deep-well plates. Several days later, cell supernatants containing the expressed sdAb-Fc antibody were collected and binding was tested in an ELISA. Positive clones were sequenced using Sanger sequencing, with three primers covering the entire sdAb-Fc insert, and the sdAb sequences of each clone were assembled into contigs. The unique clones were then retested in an ELISA (confirmatory assay), as described below.
[0237] The VHH CDR sequences of 96 of these antibodies are shown in Table 1. The full-length variable domains of these antibodies are shown in Table 2.
[0238] The selected antibody was tested by ELISA. In this assay, the antibody was standardized at a concentration of 1 μg / ml and then serially diluted 5-fold to 0.2, 0.04, and 0.008 μl / ml (dilutions 1 to 4).
[0239] 2 μg / mL NKp46-His protein diluted in PBS was coated onto plates at 50 μL / well and incubated at room temperature for 1 hour.
[0240] The coated plates were blocked at room temperature with 150 μL / well of milk in 3% PBS for 1 hour.
[0241] As described above, the sample supernatant was diluted in blocking buffer and applied at 50 μL / well to the blocked plate and incubated at room temperature for 1 hour.
[0242] The plate was washed 5 times with an AquaMax plate washer at 350 µL / well.
[0243] Apply secondary antibody (rabbit anti-human Fc-HRP diluted to 1:5,000 in blocking buffer) at 50 μL / well and incubate at room temperature for 1 hour.
[0244] Washing board as described above.
[0245] Apply TMB substrate at 50 μL / well and develop at room temperature for 10 minutes.
[0246] The reaction was terminated by applying 50 μL / well of 1N HCl.
[0247] The absorbance of the plate was read at 450 nm using a BioTek plate reader.
[0248] The data is shown below:
[0249]
[0250]
[0251] The binding affinity of the antibody to NKp46 ECD was determined by surface plasmon resonance (SPR) using an LSA instrument (Carterra, Inc.) in “capture kinetics” assay using an HC30M chip (Carterra) (whose surface was cross-linked with rabbit anti-human IgG Fc-specific polyclonal antibody (Rockland) as a capture reagent). Using a 96-printhead, the antibody, diluted up to 100-fold in 10 mM HEPES pH 7.4, 150 mM NaCl, 3 mM EDTA, and 0.05% Tween-20 (HBSTE), was captured onto the anti-human IgG Fc chip surface as a ligand. The chip surface was then blocked with an isotype control, followed by multiple injections of run buffer (HBSTE + 0.5 mg / mL BSA) prior to the kinetic assay. Recombinant human NKp46 ECDs were prepared in a 3-fold dilution series ranging from 0.4 nM to 300 nM. Samples were injected sequentially at increasing concentrations, each lasting 10 minutes, followed by a 15-minute dissociation phase in a non-regenerating manner after each binding phase. Data for each antibody were globally processed and analyzed using Carterra Kinetics software by fitting sensor maps with a Langmuir 1:1 binding model. The affinity or equilibrium dissociation constant (K0) of the interaction between NKp46 ECD and each captured mAb was also determined. D K is determined by the ratio of the kinetic rate constants. D =k d / k a .
[0252] The results of the measurement are shown below:
[0253]
[0254]
[0255] The selected antibody was then purified using Protein A PhyTips on a Hamilton Nimbus apparatus. The sample was eluted with 50 mM citrate buffer and 150 mM NaCl, and neutralized with 500 mM Na₂HPO₄ pH 9 buffer at a 1:5 ratio. The sample was then desalted into PBS.
[0256] The purified material was centrifuged at 10,000 rpm for 3 minutes to precipitate any insoluble substances. The sample was then run on an Unchained Labs Uncle instrument using full-spectrum fluorescence, static light scattering, and dynamic light scattering to determine T0. m T aggMonodispersity was assessed. Samples were heated from 25°C to 95°C at a rate of 0.3°C / min, and the change in the absorbance ratio at 350 / 330 nm was monitored. DLS samples were collected at 25°C for 180 seconds, with a total of 10 collections, each lasting 10 seconds.
[0257] The results of the measurement are shown below.
[0258]
[0259] Example 2
[0260] Production and identification of human anti-NKp46 antibodies in transgenic rats
[0261] Anti-NKp46 monoclonal antibodies were generated using immobilized light chain human transgenic rats (OmniFlic rats); see, for example, Harris et al. (Front Immunol. 2018 24:9:889), which expressed human antibodies containing a diverse heavy chain library with a single common rearranged κ light chain (IgKV3-15-JK1).
[0262] The sequences of 245 of these antibodies are shown in Tables 3 and 4. Antibody binding data are shown in Table 5.
[0263] Example 3
[0264] Production and identification of human anti-NKp46 antibodies in transgenic chickens
[0265] Anti-NKp46 monoclonal antibodies were generated using fixed light chain human transgenic chickens (OmniClic chickens; see, for example, Ching et al. (MAbs. 2021; 13(1):1862451)) that expressed diverse human heavy chain variable regions, which enabled high-affinity antigen-specific binding and broad epitope diversity when paired with germline human κ light chains (VK3-15 light chains).
[0266] The sequences of 170 of these antibodies are shown in Tables 6 and 7. Antibody binding data are shown in Table 8.
[0267] Example 4
[0268] Generation and identification of bovine ultra-long HC CDR3 bound to NKp46
[0269] Bovines were immunized with NKp46 using standard methods. A cDNA sequence encoding an ultralong H3 heavy chain was amplified from the bovines, expressed, and tested for binding to NKp46. The heavy chain CDR3 sequences of nine antibodies that bind to NKp46 are shown in Table 9.
[0270] Example 5
[0271] Production and identification of other anti-NKp46 VHH antibodies
[0272] Other anti-NKp46 VHH antibodies were identified and analyzed using the method described in Example 1 above.
[0273] The VHH CDR sequences of 35 of these antibodies are shown in Table 10. The full-length variable domains of these antibodies are shown in Table 11.
[0274] The initial data for these antibodies are shown below:
[0275]
[0276] Materials and methods
[0277] Genetically modified design and development: The design and development of truncated light chains (tLCi) have been previously published (Leighton et al. J Immunol 2024; 212:1744–53). Omni dAb The transgene (designated VHH3) was engineered to have a pre-rearranged V region consisting of human VH3-23 and JH4, along with an artificial CDR3 of 17 residues (primarily composed of Gly and Ser residues). Figure 1 This germline-encoded CDR3 is expected to undergo somatic mutations in chicken B cells to generate a novel library. The variable region framework (FR) contains stabilizing mutations. The VHH3 transgene contains this single functional V region and non-coding sequences from chicken heavy chain loci (V gene promoter, leader intron, and 5' and 3' untranslated regions). Upstream of the single expressed VHH3 germline gene, a series of designed pseudogenes (P-VHHs) with diverse CDR sequences were cloned for gene conversion to mutate the functional V gene expressed in B cells. CDR1 and CDR2 in the pseudogenes are derived from germline human VH3 family members, while CDR3 is derived from the expressed human library and selected based on a range of lengths and sequence diversity. These pseudogenes contain the same FR as the functional VHH3 gene to preserve the embedded stabilizing mutations. In the case of FR4, the sequence encoding the last 5 residues was omitted from the pseudogene to remove potential primer binding sites from the genome. To insert into the genome of chicken primordial germ cells and produce transgenic birds, the vector contains a β-actin promoter and an attB site for integration via phiC31 integrase into the attP site, which previously targeted the chicken heavy chain locus. It also contains a loxP site for removing all selectable markers and plasmid backbone elements via Cre recombination. 36 .
[0278] As previously mentioned, in irradiated BRL feeder cells 36 Chicken primordial germ cells (PGCs) were derived and cultured on KO-DMEM (ThermoFisher, 0829018) medium containing 40% rat hepatocyte (BRL) conditioned medium, 7.5% fetal bovine serum (FCS) (Hyclone, SH30088.03), 2.5% chicken serum (ThermoFisher, 16110082), 2 mM Glutamax (ThermoFisher, 35050-061), 1 mM pyruvate (ThermoFisher, 11360-070), 1X non-essential amino acids (ThermoFisher, 11140-050), 0.1 mM β-mercaptoethanol (ThermoFisher, 21985-023), 6 ng / ml recombinant mouse stem cell factor (R&D Systems, 455-MC), and 4 ng / ml recombinant human FGF basic (R&D Systems, 234-FSE). Cells are passaged every 2-3 days. The reproductive crescent region of transgenic birds carrying IgH knockout and loxP sites flanking the VDJ region was re-derived into the PGC line VDJ10-9, and these cells were used for transfection. 5 x 10⁻⁶ cells were placed in a container... 6 The cells were resuspended in Nucleofector V buffer (Lonza, Walkersville, MD, VCA-1003) containing 15 µg of linearized VHH3 insert vector and 15 µg of CMV-phiC31 integrase vector. 39 The total volume was 100 µl, and the cells were transfected in 2 mm cuvettes using a BMX ECM830 square-wave pulsed electroporator (BTX, Holliston, MA) at 350 V, 100 µsec, and 8 pulses. The cells were then resuspended in complete growth medium and transferred to irradiated BRL feeder cells containing G418 resistance. 36The medium was added to 48-well plates. Three days after transfection, 350 μg / ml of G418 (Teknova, Hollister, CA, G5005) was added, and the medium was changed every 2-3 days. G418 resistant clones were amplified and quantitative PCR (qPCR) assays were performed using primers targeting the 5' insert (B-act-F2, 5'-CTCTGCTAACCATGTTCATGCCTTC-3' (SEQ ID NO:2220) and neo-R1, 5'-AGTGACAACGTCGAGCACAGCT-3' (SEQ ID NO:2221)) and the 3' insert (huJH4-F2, 5'-TTTGACTACTGGGGCCAAGG-3' (SEQ ID NO:2222) and chJC-R45, 5'-GCCCAAAATGGCCCCAAAAC-3' (SEQ ID NO:2223)) and the VHH3 gene (using primers VHH3-F (5'-GTGAACGTCGGTCCAGGATT-3' (SEQ ID NO:2224)) and VHH3-R (5'-CTCGACCGTCAGCTGGTATC-3' (SEQ ID NO:2223)). PCR analysis of NO:2225 confirmed that it carried the correct VHH3 insertion into the heavy chain locus. As previously described, three independent PGC clones and a fusion of three other clones were injected into day 3.5 embryos to generate germline chimeras. Male chimeras were propagated into Cre-expressing hens, and selectable markers and GFP were removed, resulting in fully transgenic birds containing VHH3. Twenty of the 25 chimeras were germline transmissible, with six chimeras exhibiting >50% transmissibility.
[0279] GMO chicken evaluation
[0280] Genotyping: Genotyping was performed by lysing either comb tissue (collected during incubation) or blood samples (collected at any later time point). Tissue lysis was completed by incubating overnight at 56°C with shaking in 0.5 mL of ATL buffer containing 0.5% proteinase K. DNA was then precipitated with alcohol on the lysed samples and used for downstream genotyping qPCR. For blood samples, lysis was completed by adding 0.25 μL of whole blood to 1 mL of TEN buffer containing 0.005% streptomycin E and incubating overnight at 37°C with shaking. The lysis reaction was inactivated by incubation at 65°C for 10 minutes, and the samples were used directly for genotyping qPCR. Birds were confirmed twice by genotyping qPCR before evaluation.
[0281] Sample collection and pretreatment:B cell development in birds was assessed at 11 weeks of age, with n=1 chicken serving as a wild-type reference control, n=3 from the IgL KO / VHH3 genotype, and n=6 from the tLCi / VHH3 transgenic genotype. These samples were analyzed by flow cytometry, Western blotting, RT-PCR, and ELISA. For each bird, 2 mL of whole blood was collected in EDTA anticoagulant for plasma or PBMC separation. A 200 μL aliquot of whole blood was centrifuged at 600 x g for 10 min at 4°C to precipitate red blood cells and collect plasma samples. The remaining whole blood was plated onto 5 mL Histopaque-1077 (Sigma-Aldrich, 10771) vials for PBMC separation, following the manufacturer's instructions. The erythrocyte sedimentation rate (ESR) layer containing PBMCs was collected from the interface and washed once in PBS supplemented with 0.1% bovine serum albumin (BSA) (PBS + 0.1% BSA). The ESR layer was then aliquoted into 96-well U-shaped plates for direct downstream flow cytometry, or precipitated and stored at -80°C for RT-PCR processing.
[0282] Flow cytometry:Incubate the plated PBMCs with the primary antibody diluted in PBS + 0.1% BSA buffer on ice for 1 hour. The following anti-chicken primary antibodies were used: 5 µg / mL of monoclonal mouse anti-Bu1 against the chicken B cell marker Bu1 (Southern Biotech, Birmingham, AL, 8395-01); 5 µg / mL of monoclonal mouse anti-IgM against IgM CH1 (Southern Biotech, 8310-01); 5 µg / mL of monoclonal mouse anti-IgL (Southern Biotech, 8340-01); 1:800 dilution of monoclonal anti-TCR1 (TCRδγ) (Southern Biotech, 8230-01); a mixture of monoclonal anti-TCR2 (TCRαβ / Vβ1) and anti-TCR3 (TCRαβ / Vβ2) diluted 1:200 (Southern Biotech, 8240-01 and 8250-01); and 4 µg / mL of polyclonal goat anti-IgM (Bethyl Laboratories, Montgomery, TX, (A30-102A). In addition, polyclonal serum targeting the VHH3 variable domain, incorporated into the transgene design, was generated by hyperimmunization of rabbits for transgene-specific antibody detection, used at a 1:100 dilution. After primary antibody incubation, cells were washed three times in 200 μL / well PBS (Fluorescence Activated Cell Sorting (FACS) buffer) containing 1% BSA and 0.1% sodium azide, and then incubated on ice for 1 hour with a secondary antibody conjugated with AlexaFluor647. The secondary antibodies used were: 5 μg / mL donkey anti-mouse (ThermoFisher, A31571), 4 μg / mL donkey anti-goat (Abcam, Waltham, MA, AB150131), or 4 μg / mL goat anti-rabbit (ThermoFisher, A21244). After incubation with secondary antibody, cells were washed three times with PBS + 0.1% BSA and reads were taken on an Attune NxT flow cytometer (Thermo Scientific) for analysis of 10,000 cells per sample. Data were processed in FlowJo software (version 10.8.1). Figures were created in Prism software (version 9).
[0283] ELISA:High-binding ELISA plates (Greiner Bio-One, 655061) were coated with 50 μL / well of 2 μg / mL anti-chicken IgY (Sigma-Aldrich, C2288) or IgM (Sigma-Aldrich, SAB3700236) diluted in PBS. The plates were coated at room temperature for 1 hour or overnight at 4°C, then blocked at room temperature with 150 μL / well of 3% skim milk in PBS blocking buffer for 1 hour. Plasma samples were diluted to a starting dilution of 1:1,000 (5-fold serial dilution) in blocking buffer and added to the plates at 50 μL / well. The samples were incubated on the plates at room temperature for 1 hour. The plates were washed 5 times with 300 μL / well of PBST wash buffer (PBS containing 0.05% Tween 20), then the secondary antibody was added, and the plates were incubated at room temperature for 1 hour. Goat anti-chicken IgM-horseradish peroxidase (HRP) (Bethyl, A30-120P) or rabbit anti-chicken IgY-HRP (Sigma, A90406) were diluted 1:5,000 in blocking buffer and added to the plates at 50 μL / well. After incubation, the plates were washed 5 times with PBST. 3,3′,5,5′-tetramethylbenzidine substrate (ThermoFisher, 002023) was added at 50 μL / well and incubated for 10 min. The color development was stopped with 50 μL / well of 1 N HCl, and the absorbance of the plates was read at 450 nm using a BioTek Synergy H1 plate reader.
[0284] Protein blot:Plasma samples were diluted 1:100 in PBS to a final concentration containing 1X sample loading buffer and 1.5 mM tris-carboxy-ethyl-phosphine reducing buffer, and heated to 98°C for 10 minutes. The samples were loaded onto bis-tris NuPage SDS-PAGE gels (ThermoFisher, NP0321) in 4-12% sodium dodecyl 2-(N-morpholino)ethanesulfonate running buffer at a constant 200V. The gels were transferred to 0.2 μM nitrocellulose membranes using an iBlot2 7-minute dry transfer system (ThermoFisher). The membranes were immediately blocked for 1 hour in 3% skim milk blocking buffer in PBS with shaking at room temperature. After blocking, the membranes were incubated with primary antibody diluted in blocking buffer for 1 hour. Primary antibodies included polyclonal goat anti-chicken IgM diluted 1:5,000 (Sigma, SAB3700236) or rabbit anti-VHH polyclonal serum diluted 1:500. After primary antibody incubation, the membrane was washed 5 times with PBST buffer, 5 minutes each time. Then, mouse anti-goat-HRP (Rockland, 18-8814-31) or goat anti-rabbit-HRP (Jackson ImmunoResearch, 111-035-144) secondary antibodies were added to blocking buffer at dilutions of 1:10,000 or 1:5,000, and incubated with vortexing for 30 minutes. After secondary antibody incubation, the membrane was washed as described above. Developing was performed for 15 minutes using West Pico PLUS chemiluminescent substrate (ThermoFisher, 34580), and the membrane was then imaged on a BioRad ChemiDoc XRS+ gel imaging system under a chemiluminescent filter.
[0285] Reverse transcription PCR: Total RNA was extracted from precipitated PBMC samples using the RNAeasy Plus kit (Qiagen 74034), with 10 μL of RNA extracted from each sample. 7Cells were used for RNA extraction, following the manufacturer's protocol. The extracted RNA was resuspended in 30 μL of water and quantified using a Nano UV-Vis spectrophotometer. The quantification was used for sample standardization. Then, 2 μL of RNA was used for reverse transcription / amplification using a Qiagen One-Step RT-PCR kit (Qiagen 210212). The primers used in these reactions targeted IgM (chVH-F9:5'-CACCAGTCGGCTCCGCAACCATG-3' (SEQ ID NO:2226) and cIgM-CH2-R5:5'-GGGATGGGAATCGGGGGACC-3' (SEQ ID NO:2227)) or IgL (cVL-5'UTR-F:5'-GACAACACAGCTGCTGGGATTC-3' (SEQ ID NO:2228) and chIgL-CR:5'-CCTGCAGGTGTAGGTCTCGT-3' (SEQ ID NO:2229)). The RT-PCR parameters consisted of the following: reverse transcription at 50°C for 30 minutes, followed by 40 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 1 minute, extension at 72°C for 45 seconds, and a final extension for 10 minutes. The RT-PCR products were loaded onto a 1% agarose-ethidium bromide-ethylenediaminetetraacetic acid gel and imaged using a BioRad ChemiDoc XRS+ gel imaging system.
[0286] Antibody discovery
[0287] Immunization and sample collection: After confirming B cell development in PBMCs by flow cytometry and plasma immunoglobulin titers by ELISA (as described above), Omni was selected. dAbTransgenic chickens were immunized. Birds were immunized intramuscularly with either 100 μg protein / dose / ornid-specific soluble NKp46 extracellular domain protein (internal production) or soluble human particulate protein precursor (Acro Biosystems PGN-H52H3). The primary immunization contained 1:1 v / v complete Freund's adjuvant (Thermo Fisher, 77140), while the booster contained 1:1 v / v incomplete Freund's adjuvant (Thermo Fisher, 77145). The immunization protocol followed a bi-weekly pattern: blood samples were collected the week after immunization. After hyperimmunization and obtaining a high-titer response (based on ELISA, procedure described below), a final adjuvant-free booster was administered intravenously. Four days after the final intravenous booster, final plasma samples and spleen cells were collected. The spleen outer membrane was removed, and the parenchymal tissue was processed into PBS + 0.1 BSA buffer using a 40 μM cell filter. Single-cell spleen cell samples were then plated on a Histopaque-1077 (Sigma-Aldrich, 10771) polysucrose gradient to collect an erythrocyte sedimentation rate (ESR) layer containing lymphocytes and monocytes from the total spleen cell sample. The collected cells were cryopreserved in a medium containing 10% FCS and 10% dimethyl sulfoxide, and aliquots were stored in liquid nitrogen until used for screening.
[0288] Screening and cloning of single B cells: GEM assay 41 (US Patents: 8,030,095 and 8,415,173) or xPloration method 42(US Patents: 10,227,583; 11,085,039; 11,473,081 and 12,024,705) Single B cell screening was performed on cryopreserved cells. For the GEM method, 5 μM latex-aldehyde beads (Thermo Fisher, A37306) were coated with 37.6 μg of soluble protein per 100 μL of bead solution in PBS and rotated overnight at 4°C. After overnight coating, the beads were washed with 3% skim milk in PBS and blocked for 1 hour, then washed 5 times with PBS, and finally restored to the original bead volume. The coated beads were stored at 4°C until used for gel encapsulation microenvironment (GEM) screening. The GEM method facilitates single B cell screening by encapsulating single B cells together with antigen-coated beads in agarose gel microdroplets. B cells secreting antigen-specific antibodies were detected using fluorophore-labeled secondary antibodies and manually screened / extracted under a microscope. GEMs containing B cells and antigen-coated beads were prepared by premixing 2 μL / mL goat anti-chicken IgM-DyLight 594 secondary antibody (NovusBiologicals, NBP2-60690DL594) in RPMI medium supplemented with 10% FCS and Glutamax and incubating at 37°C for 3 hours. Before microscopic observation, the GEMs were washed three times in CO2-free medium containing 10% FCS and Glutamax. GEMs containing single B cells and showing positive staining on the beads were extracted for cloning. For the xPloration screening method, the antigen target protein was coated onto M450 Dynabeads (Thermo Scientific, 14044) according to the manufacturer's coating procedure. Cells were washed in PBS supplemented with 0.1% BSA and mixed with coated beads at a ratio of 4800 cells per 1 μL of coated beads in RPMI basal medium containing 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid and glutamine, supplemented with 10% FCS, and premixed with goat anti-chicken IgM-DyLight 650 secondary antibody (Novus Biologicals, NBP2-60690DL650) diluted 1:1000. The cell-bead-secondary antibody mixture was seeded onto a microcapillary chip containing 1.5 million capillaries, covered with a 1% agarose capping layer, and incubated at 37°C for 2 hours. After incubation, the chip was loaded into an xPloration instrument, and binding to antigen-coated beads in each capillary well was screened. The contents of each positive well were extracted from the chip using laser for cloning.After extracting antigen-specific single B cells (via GEM or xPloration), cells were lysed using the TurboCapture mRNA kit (Qiagen, 72251) according to the manufacturer's instructions for single-cell mRNA preparation. The samples were then subjected to reverse transcription PCR to amplify the entire heavy chain variable region using primers from the 5' UTR: 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCACCAGTCGGCTCCGCAACCATG (SEQ ID NO: 2230) and IgM CH2 exon: 5'-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGGTGCATGGTG ACGAAAAG-3' (SEQ ID No: 2231) region. Nested PCR was then performed using primers with dangling ligatures in the VH leader sequence: 5'-TCGAACCCTTGCTAGCCGCCATGGAGTTTGGGCTTAGCTGGATC (SEQ ID NO:2232) and the JH region: 5'-TGAGGAGACGGTGACCTGGGT (SEQ ID NO:2233). These amplified VH regions were then inserted into a mammalian expression vector containing the IgG1 CH2-CH3 human Fc domain using the In-Fusion method (Takada Bio, 638911), producing the sdAb-Fc form (also known as HcAb). The clone was transfected into Expi293 cells for protein expression and downstream analysis. A control antibody against PGRN (represented by wild-type chickens) was also used. 21 And genetically modified OmniChicken ® and OmniClic ™ animal 27-29 Internal clones of NKp46 (NKp46-1, NKp46-2, NKp46-3, and NKp46-4; US Patent Application US20240034816 and PDB ID6IAP) and control antibodies against NKp46 were generated as scFv-Fc (PGRN) or whole IgG (NKp46) constructs with human IgG1-Fc and purified by standard protein A chromatography, such as those against OmniClic and OmniFlic. dAb As described by the antibody.
[0289] Antigen-specific ELISA:The ELISA for antigen-specific binding followed the same standard procedure as described above, but with the modifications mentioned. Plates were coated with the target antigen at 2 μg / mL. Antigen-specific binding antibodies were detected using goat anti-chicken IgM-HRP (Bethyl, A30-120P) during the immunization phase, or rabbit anti-human Fc-HRP (Rockland, 609-4303) during the monoclonal screening phase. During the screening for immune responses to the antigen in the immunization phase, plasma samples were initially diluted 1 / 100 (for PGRN immunization) or 1 / 500 (for NKp46 immunization) in blocking buffer, followed by seven rounds of 5-fold serial dilutions. In the monoclonal screening phase, antigen binding in transfected Expi293 supernatant was initially screened using a 1 / 50 sample dilution. After the initial qualitative screening, these clones were sequenced to sort clones with unique sequences. Representative clones from each unique sequence group were then selected for standardized ELISA analysis and downstream flow cytometry, kinetics, epitope binning, and functional assays. Representative unique sequence clones were subjected to a naturalized ELISA at an initial dilution of 1 μg / mL, followed by three rounds of 5-fold serial dilutions to observe dose-response binding curves. Selected unique sequence clones that maintained strong binding were chosen for further evaluation.
[0290] Antigen-specific flow cytometry of NKp46 clone: A randomly selected subgroup of NKp46-binding HcAbs was screened to determine their ability to bind to the native NKp46 protein on transfected CHO-K1 cells (KYinno Bio, KC-1789). CHO-K1 cells (parental and NKp46-expressing) were cultured in Ham's F12K medium (Gibco, 21127022) supplemented with 10% FBS. NKp46-expressing CHO-K1 cells were grown under 10 μg / mL puromycin selection. On the day of flow cytometry, cells were detached from the adherent surface for 10 min at 37°C with cell dissociation buffer (Corning, 25-066-CI), washed with FACS buffer (400 x g, 4°C for 10 min), and counted using a hemocytometer. For each cell type, the washed cells were resuspended in 250 μL of human Fc inhibitor (BD, 564220) and incubated at room temperature in the dark for 10 minutes. Cells were then cultured at 1.5 x 10⁻⁶ cells / mL. 5Cells / well, 200 μL / well, were seeded in FACS buffer and precipitated before adding primary antibody. NKp46 binding antibody was started at a 10 μg / mL dilution, serially diluted three times to 5-fold, and added to wells at 50 μL / well. The cells were incubated on ice for 45 minutes. NK-binding mouse anti-CD335 monoclonal positive control antibody was also included in the assay at the same working concentration (Invitrogen, 16-3359-82). After primary antibody incubation, the cell plate was washed twice with FACS buffer, and secondary antibody was added at 50 μL / well. The cells were incubated on ice in the dark for 45 minutes. The secondary antibody used was either goat anti-human IgG-Alexa Fluor 647 (Thermo, A21445) or goat anti-mouse IgG-Alexa Fluor 647 (Thermo, A21235), diluted 1:500. After incubation with the secondary antibody, the cell plate was washed twice and resuspended in 200 μL of FACS buffer, and then analyzed on an Attune NxT flow cytometer (Thermo Scientific).
[0291] IFNγ release assay:CD56 / CD16-positive human primary NK cells (Lonza, 2W-502) were cultured in ImmunoCult NK cell expansion medium (Stemcell Technologies, 100-0711) for 10–14 days at 37°C and 5% CO2, according to the manufacturer's recommended protocol. On the day of testing, cells were collected and seeded at a density of 150,000 cells / well in 50 μL of medium in sterile 96-well microplates. A randomly selected subgroup of NKp46-binding clones (the same clone as described above) were tested at a concentration of 30 nM, with controls applied at concentrations of 100 nM, 30 nM, 10 nM, 3 nM, 1 nM, 0.3 nM, and 0.1 nM. Reference antibodies from patent literature (NKp46-1, NKp46-2, and NKp46-3; US20240034816) were included. Isomycin (Sigma-Aldrich, I0634) was used as a positive control and applied at a final concentration of 1 μM. A human IgG antibody isotype control (ThermoFisher, 02-7102) was also included and applied at a final concentration of 30 nM (matching the concentration used in the experimental samples). Samples were run in four replicates in two independent assays, for a total of eight replicates per sample. The treatments were prepared to twice the final test concentration in culture medium, and 50 μL of each twice-concentration sample was added to wells containing 50 μL of cells (1:1 v / v) and incubated for 24 hours. After incubation, the plates were briefly centrifuged at 500 x g for 10 minutes, and 50 μL of the supernatant was collected into new 96-well microplates for ELISA processing. The IFNγ concentration of the samples was determined using a commercially available human IFNγ ELISA kit (Abcam, AB300323) according to the manufacturer's protocol and including a standard curve control. Sample supernatant was diluted 1:20 for ELISA. Results were measured on a BMG Clariostar plate reader, and absorbance values were converted to concentrations using an IFNγ standard curve calculated from a linearly fitted regression equation. Statistical significance was calculated compared to a culture medium-only control.
[0292] Evaluation and Developability of Antigen-Specific Antibody Clones
[0293] Sequence analysis: Amino acid sequence diversity analysis of antigen-specific HcAbs was performed using multiple sequence alignment of heavy chain variable regions and germline sequences via the IMGT numbering system to identify CDR regions (CDR1: 27-38, CDR2: 56-65, and CDR3: 105-117). At each position, the incidence of all non-germline amino acids was calculated and analyzed using Logomaker, dmslogo, funcgroup, and ANARCI. 45Pseudogene use identification of antigen-specific clones is performed by first locating the gene conversion region on the DNA sequence. CDR sequences with 4 bp or more identity matches to the germline pseudogene sequence are considered to be the result of gene conversion. A 100% match between the sequence fragment and the germline pseudogene sequence under consideration is required. Sequences of 3 bp or shorter are considered too short to definitively confirm gene conversion and may be the result of somatic hypermutation. Some germline pseudogenes have matching sequence segments; in these cases, the specific pseudogene origin of the gene conversion event cannot be determined, and it is considered an undefined gene conversion with multiple potential pseudogene origins. Gene conversion use and pseudogene origin analysis are performed using the Biopython SequenceMatcher tool. The phylogenetic tree is generated by first aligning sequences using Clustal Omega (ClustalO), calculating pairing distances based on sequence identity across the entire variable heavy chain region, and then constructing the tree using the UPGMA algorithm in the BiopythonPhylo TreeConstruction package. The tree is displayed in a circular format, with the cloning colors on the leaves matching the bin colors used in the binning experiment. A sequence lineage is defined as a group of antibody sequences with a maximum edit distance of 2 amino acids in the tandem CDR1 and CDR2 regions and a maximum edit distance of 2 amino acids in the CDR3 region. Lineage IDs are sorted, with the lineage containing the largest number of unique sequences at the top, designated as lineage ID 1.
[0294] Immunogenicity analysis: To investigate immunogenicity potential, an antigen-specific Omni assay was performed on a subgroup of selected individuals, encompassing diverse sequences targeting four different targets. dAb The antibodies were evaluated using computer science. Antibody sequences were analyzed into overlapping 9-mer segments, and class II (HLA-DR) restricted human leukocyte antigen (HLA) ligands and putative T-cell epitopes were screened using EpiVax software. 47-48 The software calculates the binding potential with the most common HLA molecules within the HLA “supertype.” The total number of putative T cell epitopes is used to generate an EpiMatrix score, which is further adjusted for T regulatory (Tregitope) binding sites. Binding to regulatory T cells may reduce immunogenicity, thus offsetting the original EpiMatrix score. An EpiMatrix score <-15 after Tregitope adjustment is considered low immunogenicity, and a score <-30 is considered very low immunogenicity. (Using JanusMatrix software) 49Further characterization of the putative T-cell epitopes identified in the EpiVax screening was performed. T-cell activation requires peptide binding to the HLA-binding cleft on antigen-presenting cells, presenting the MHC:peptide complex to the T-cell receptor (TCR). Simultaneous binding results in two “faces”: AA residues facing the TCR and AA residues facing the major histocompatibility complex (MHC). TCR-facing residues, which are highly conserved in the human proteome, are unlikely to elicit an immune response, while novel sequences may be recognized as foreign and activate the T-cell response. The JanusMatrix algorithm matched the predicted T-cell epitopes with human proteins. A high JanusMatrix human homology score (>5) indicates reduced immunogenic potential. 50 .
[0295] Antibody purification: HcAb was purified from Expi 293 supernatant using a Hamilton Nimbus high-throughput filtration system equipped with a PhyTip Protein A column (Biotage, PTH-91-40-07). The column was equilibrated in PBS at pH 7.4 before capturing sdAb-Fc antibodies. The column was then washed twice in PBS at pH 7.4. The sample was eluted from the column in 50 mM sodium citrate (pH 3.0) and 150 mM sodium chloride, and immediately neutralized by adding 0.5 M sodium phosphate (pH 9). The neutralized solution was buffer-exchanged in a high-throughput 96-well desalting plate (Thermo Fisher, #89807) to PBS at pH 7.4.
[0296] Thermal stability and aggregation: The melting temperature (T0) of selected sdAb-Fc form NKp46 and PGRN antibody clones was assessed using differential scanning fluorometry (UNCLE-0330, Unchained Labs, Pleasanton, CA). m ) and aggregation temperature (T agg Samples in PBS pH 7.4 were loaded onto a microcup array at low injection volumes (9 μL) and a wide concentration range of 0.05–5 mg / ml. A temperature gradient from 20 °C to 95 °C was applied in increments of 1.0 °C / min, with an incubation time of 180 seconds and a plate holding time of 60 seconds. The T value was analyzed using the change in the 350 / 330 nm absorbance ratio. m and T agg Monitoring intrinsic protein fluorescence (excitation: 266 nm, emission: 280–450 nm) to measure T m Aggregation curves were generated by measuring the temperature-dependent intensity of static light scattering (excitation: 266 nm). Static light scattering at 473 nm was monitored to measure T. aggAll data were analyzed directly using Unclear analysis software (V.6.0), and the T values were determined using either the 350 / 330 nm absorbance ratio or the SLS473 (count.nm) versus temperature (°C) curves. m and T agg .
[0297] AC-SINS: Polyclonal goat anti-human IgG Fc (Jackson ImmunoResearch, #109-005-098) (capture) and whole goat IgG (Jackson ImmunoResearch, #005-000-003) (non-capture) antibody buffers were exchanged in 20 mM potassium acetate (pH 4.3) buffer and normalized to 0.4 mg / mL. The two antibodies were mixed at a 4:1 capture:non-capture ratio. The antibodies were incubated with gold nanoparticles (Ted Pella Inc. #15705) at a 9:1 ratio of gold nanoparticles to antibody at room temperature for 2 hours. Void sites were then blocked by adding 0.1 μM (final concentration) polyethylene glycol methyl ether thiol (2000 MW, Sigma-Aldrich #729140). The coated and blocked particles were passed through a 0.22 μm polyvinylidene fluoride membrane (Millipore Sigma #SLGVV255F) and eluted with 10% of the starting volume of PBS. To assess self-association, 10 μL of nanoparticles were mixed with 100 μL of 50 μg / mL purified antibody (in PBS, pH 7.4) in a 96-well polypropylene plate. As a control, buffer was mixed with coated and blocked gold nanoparticles. Absorbance was measured in 1 nm increments from 510 nm to 570 nm using a BioTek Synergy H1 plate reader. Peak absorption wavelengths were manually calculated using Excel. The peak absorption wavelengths of the control buffer were subtracted from the peak absorption wavelengths of the samples, and these data were plotted.
[0298] Analytical SEC: Omni was analyzed using a Superdex 200 Increase 5 / 150 GL column (Cytiva, GE28-9909-45) on an UltiMate 3000 HPLC (Thermo Scientific). dAb Samples were subjected to analytical SEC-HPLC. Antibody concentrations ranged from 0.2 to 1 mg / mL, with a few outliers below 0.1 mg / mL and above 1.5 mg / mL. Both sample and run buffer formulations were PBS pH 7.4, and the run was performed at a flow rate of 0.25 mL / min for 15 minutes at room temperature.
[0299] Biosensor Analysis: Epitope mapping and epitope binning experiments were performed using high-throughput surface plasmon resonance on Carterra's LSA platform equipped with an HC-30 M sensor chip. This method has been described in detail elsewhere. To calculate binding affinity, a capture kinetics approach was used on a chip coupled with a goat anti-human IgG Fc-specific polyclonal (SouthernBiotech, 2047–01) capture reagent. Purified His-tagged recombinant PGRN (R&D systems) and NKp46 (in-house prepared) were used as monovalent analytes and prepared in 3-fold dilution series, up to 300 nM or 1 μM. Epitope mapping of anti-PGRN HcAb to specific particle protein subdomains was performed using the chimeric exchange strategy described above. Epitope binning experiments were performed using the classic sandwich method described above, combined with a small set of curated antibody standards (dispensed via a guide box). For the PGRN binning, the standards represented a small group of previously characterized clones with known specificity, while for the NKp46 binning, the standards represented so-called “anchored” clones from internal, unpublished OmniFlic and OmniClic libraries generated by standard protein-based immunization, as well as literature references (NKp46-1, NKp46-2, NKp46-3, and NKp46-4; see the “Screening and Cloning of Single B Cells” section above). Anti-His mAb was used as a universal sandwich control for all epitope binning experiments. For the NKp46 binning, a “many-to-few” approach was used, in which a large group of HcAb analytes (in solution) were tested for blocking a small group of curated ligands (on-chip), including anchored clones and a limited group of HcAbs resistant to multiple acid regeneration cycles. Since a comprehensive pairwise analysis of NKp46 HcAbs was not performed, their competition with each other was not tested, and they were assigned to a “blocking spectrum” (referred to herein as a “bin”). In this definition, HcAbs belonging to the same blocking spectrum do not necessarily block each other, but they show the same blocking pattern when tested against ligand groups.
[0300] Example 6
[0301] Production of OmnidAb genetically modified chickens
[0302] To express heavy chain variable regions lacking light chains in transgenic animals, two challenges related to light chain removal need to be addressed: exposure of the VH / VL interface on the VH region, and the lack of a mate for the CH1 domain of the heavy chain constant region, which is typically paired with CL. Heavy chain variable regions based on human VH3-23 and JH4 germline sequences were designed, containing 10 stabilizing mutations that enable autonomous VH expression. Figure 8These stabilizing mutations were found in camel VHH and stabilized the overall structure of individual unpaired domains by remodeling the contact regions with VL and CH1 and increasing the hydrophilicity of sites exposed to the solvent when VL and CH1 are removed. 25 The variable region was inserted into the chicken heavy chain locus, where the endogenous V, D, and J gene segments had been deleted. Figure 1 This construct contains regulatory elements of the chicken IgH locus for appropriate timing and tissue-specific expression. In wild-type chickens, single VH and JH genes, along with a small number of highly correlated D genes, were used for VDJ recombination. 26 Because VDJ recombination provides minimal diversity to the antibody library in chickens, a pre-rearranged VH region of the OmnidAb antibody was used to bypass the recombination step. This germline variable region and the transgene carrying it are termed "VHH3". Diversity in the chicken immunoglobulin library is typically generated through gene conversion from upstream pseudogenes; this process is replicated by incorporating a series of designed human pseudogenes available in developing B cells for gene conversion of the single expressed VHH3 gene. Figure 8 Stabilization mutations are present in the FR of the pseudogene to maintain its presence in the somatic cell library. Any random mutations in the FR will revert to the original sequence via gene conversion. Conversely, the complementarity-determining region (CDR) contains diverse sequences for generating a diverse antibody sequence library. As for the CH1 domain in the constant region, which typically needs to pair with the light chain to replace BiP and allow for continuation via the secretory pathway, a second transgene was designed in the light chain: a truncated light chain (tLCi) consisting only of the constant region and without the variable region. This transgene was inserted into the light chain locus, where the endogenous V, J, and C regions have been deleted.
[0303] These transgenes were inserted into primordial germ cells to produce chimeras, which were then bred to establish fully transgenic strains. In addition to birds with homozygous IgL knockout (KO) VHH3, birds possessing both VHH3 and tLCi transgenes were also produced. At the heavy chain locus, the genotype was heterozygous VHH3 / IgH KO, while at the light chain locus, the genotypes were heterozygous tLCi / IgL KO or homozygous IgL KO / IgL KO. For simplicity, these transgenic genotypes will be referred to here as VHH3-tLCi (for the tLCi / IgL KO light chain allele with the VHH3 / IgH KO heavy chain) or VHH3-IgL KO (for the homozygous IgL KO / IgL KO light chain allele with the VHH3 / IgH KO heavy chain).
[0304] Example 7
[0305] OmnidAb: B cell development and antibody expression in chickens
[0306] Analysis of B cell development in these heavy chain chickens based on enzyme-linked immunosorbent assay (ELISA) showed that their circulating IgM titers were similar, but the isotype conversion to IgY was extremely limited. Figure 2A This is related to the limited class switching observed in previously developed heavy-chain chickens expressing wild-type chicken HcAb. 24 Flow cytometry analysis of VHH3-tLCi transgenic chicken peripheral blood mononuclear cells (PBMCs) Figure 2B The results showed that, based on Bu-1 staining, B cell development was normal, with the B cell population averaging approximately 30-60% of normal levels (3% of total PBMCs, compared to 5-10% in wild-type chickens). Polyclonal staining of surface IgM also confirmed antibody expression on these B cells, but monoclonal IgM staining specific for the CH1 domain was not detected in either the VHH3-tLCi or VHH3-IgL KO transgenic genotypes. Monoclonal IgL staining was also negative in both transgenic genotypes, consistent with the lack of the CH1 domain for CL binding, but remained positive for wild-type controls. Furthermore, polyclonal rabbit serum targeting the transgenic VHH3 domain was generated for use as an additional VHH3 transgenic-specific detection method during B cell development analysis. In flow cytometry, this anti-VHH3 antibody was used to detect cells only in transgenic birds, without staining any cells in wild-type chickens. T cell receptor (TCR) sample control staining was comparable between wild-type controls and transgenic birds. Reverse transcription (RT)-PCR was also performed on PBMC samples to detect IgL or IgM messenger RNA (mRNA). Figure 2C For IgL transcription, as expected, the VHH3-IgL KO genotype lacked a light chain, while the VHH3-tLCi genotype contained a truncated light chain, smaller than the full-length light chain exhibited in wild-type chickens. For IgM transcription, both transgenic genotypes contained a heavy chain approximately 300 base pairs (bp) smaller than the wild-type heavy chain, consistent with the deletion of CH1 in the heavy chain. Western blot analysis of plasma samples used to detect IgM antibodies (…) Figure 2D Consistent with flow cytometry and RT-PCR data. Figure 2B and Figure 2C This is because, compared to the wild type, the heavy chain protein exhibits smaller bands. , Confirmed Omni dAb Transgenic chickens – both VHH3-IgLKO and VHH3-tLCi genotypes – do not express the CH1 domain.
[0307] Example 8
[0308] Discovery of antibodies in OmnidAb transgenic chickens
[0309] Immunization of Omni with human granulin precursor (PGRN) or the extracellular domain NKp46 of the human natural killer (NK) cell receptor. dAb Genetically modified chickens. PGRN is a multi-domain protein that has been used as an antigenic target in the evaluation of various genetically modified chickens, and its epitope segmentation... 21 Each granule protein domain has a well-established reference control. NKp46 was also selected as a target due to its potential to develop bispecific NK cell conjugate antibodies as therapeutic agents. Strong antigen-specific plasma titers were observed in these birds, with no background binding to nonspecific proteins detected. Figure 2E After reaching sufficient titers, spleen cells were collected and screened for antigen-specific antibody secretion using GEM and xPloration techniques. Both GEM and xPloration are single-B cell screening techniques; GEM utilizes an agarose gel microenvironment for microscopic screening and manual removal of selected cells, while xPloration utilizes a microcapillary chip to extract selected wells via laser. After antigen-specific binding was screened by single-B cells, the variable region was amplified and cloned into an expression vector carrying human Fc. The recombinant sdAb-Fc antibody was the form tested in all downstream assays. A total of 38 anti-PGRN clones and 128 anti-NKp46 clones were identified and confirmed in ELISA. Binding was specific, as no binding to irrelevant proteins or His tags was observed.
[0310] The ability of 12 randomly selected antibody subgroups to bind to native NKp46 protein expressed on the surface of Chinese hamster ovary (CHO) cells was screened by flow cytometry. Figure 2F The antibodies all exhibited binding to cells expressing NKp46, with minimal or no binding to the background of parental CHO cells. Therefore, binding to the immobilized protein (data not shown) in the ELISA correlated well with binding to the native protein targeting NKp46. The ability of most antibodies in this subgroup to activate primary human NK cells in cell culture to release interferon-γ (IFNγ) was also tested. Of the 11 clones tested, two clones significantly induced IFNγ release compared to the negative control containing only culture medium, and were comparable to the positive reference control antibody included in the assay. Figure 2G As expected in antibody discovery, not all antigen-binding antibodies (NKp46 in this case) have the ability to activate target receptors, but if functional activity is a desired feature of the antibody, it can be easily incorporated into the process during antibody discovery.
[0311] Anti-PGRN and anti-NKp46 Omni dAbSequence analysis of the clones showed that FR1, FR3, and FR4 remained largely unchanged, and stabilization mutations were still present in most clones (anti-NKp46 data such as...). Figure 3A (As shown). This is expected because the VHH3 pseudogene contains the same FR sequence as the functional gene, so gene conversion in the FR would be used to maintain the original sequence rather than mutate it. An exception is FR2, where a considerable level of mutation was observed, despite the pseudogene containing the same sequence. These mutations must have occurred via random somatic hypermutation (SHM) and were not reversed or eliminated by gene conversion (GC). These changes primarily occurred on the signature FR2 stabilization residues defined as frames by the International Immunogenetic Information System (IMGT), but other affected residues are also considered CDR1 or CDR2 in the Kabat definition, suggesting they may be antigen-contact residues. One stabilization change is located at Vernier residue W52 (IMGT) and shows diverse mutations, suggesting it may affect the CDR structure in these clones. In a few clones, W118 (the first residue of FR4) is mutated to arginine, as observed in some camelid VHHs. Given that other FRs do not show similar levels of mutation, these FR2 and FR4 changes are likely undergoing positive selection. The overall hydrophobicity of FR2, as measured by GRAVY, remained within the hydrophilic range, with some clones showing higher scores than the germline (preferring hydrophobicity), while others showed lower scores (more hydrophilic). Figure 9 Therefore, the mutations in FR2 are not the result of consistent selection to increase hydrophilicity, although selection for other biophysical properties (such as stability) may have occurred. CDR also showed high levels of variation in this group of clones. The CDR3 length in the PGRN and NKp46 clone groups was concentrated around 17 residues, which is the length of the germline VHH3 gene (…). Figure 10A and Figure 10B However, for both targets, some shorter or longer CDR3s were observed, indicating that gene conversion and / or SHM can lead to insertions or deletions in the avian library. For PGRN clones, a dominant lineage with a CDR3 length of only 9 residues was evident.
[0312] Genetic transitions caused by designed pseudogenes were analyzed in the PGRN and NKp46 clones using algorithms that detect sequence fragments traceable to pseudogenes. Genetic transitions were detected in most sequences (Table 1), while some clones contained mutations that could not be attributed to gene transitions by the algorithm, such as point mutations or fragments shorter than four base pairs. Most gene transition events were attributable to specific pseudogenes, while some events were ambiguous and had sequence matches in more than one pseudogene.
[0313] Table 13. Gene conversion frequency.
[0314]
[0315] Table 13: NKp46 (128 clones) or PGRN (38 clones) specific HcAb VH sequences were analyzed to look for evidence of gene conversion (GC) of upstream-designed pseudogenes in the VHH3 constructs. For most CDRs, gene conversion was attributable, with only a few sequences showing mutations that could not be traced back to pseudogenes (GC not found). Germline VHH3 sequences were not shown in any of the CDRs. For GC events, most were traced back to a specific pseudogene (GC defined), while in some cases, it was ambiguous because more than one pseudogene may have provided the sequence (GC undefined).
[0316] All pseudogenes were found to be involved in gene conversion and to provide sequence diversity for cloning. Figure 3B The localization of gene conversion events revealed that up to six events within the CDR involved mutated sequences. Figure 4 CDRs show a range in terms of the number of gene conversion events and the length of the sequence provided by pseudogenes in each case.
[0317] Omni was evaluated through computer simulation. dAb The potential immunogenicity of the antibody sequences was assessed and compared with baseline controls and clinical-stage VHH molecules. Tregitope-adjusted EpiMatrix scores were calculated and plotted against JanusMatrix human homology scores. Figure 5 This figure can be divided into quadrants based on high / low T cell epitope density (EpiMatrix score) and high / low human homology (JanusMatrix score). Sequences with the lowest immunogenic potential have low T cell epitope density and the putative epitopes present have high homology with the human proteome. Conversely, high T cell epitope density and low homology with human proteins predict a high risk of immunogenic response. All Omni dAb All sequences showed high JanusMatrix human homology scores. The Tregitope-adjusted EpiMatrix scores were variable but primarily fell into low to very low risk categories. Therefore, most of the analyzed sequences fell into the lowest risk quadrant, and no Omni sequences were observed in any of the highest risk quadrants. dAb Sequences. A few sequences have high (>-15) EpiMatrix scores, but this may be offset by high human homology. Omni dAb The immunogenic potential of the sequence is comparable to that of VHH molecules in other clinical stages.
[0318] Example 9
[0319] OmnidAb antibody shows broad epitope coverage
[0320] In order to evaluate the Omni dAb The epitope coverage of antibodies produced by engineered animal immunization, for Omni dAb Detailed epitope binning studies were conducted on the clonal group. Epitope binning studies were used to confirm and extend the results determined by our chimeric exchange epitope mapping strategy, which (by design) was limited to human-specific clones, not mouse cross-reactive clones. Although only 38 Omni... dAb The antibody sample size was small, but its epitope coverage not only overlapped with but also exceeded the coverage of our standards, which represented planned clones from previous PGRN immunization activities in wild-type chickens (Abdiche et al., mAbs 2016; 8:264–77), OmniChicken (Ching et al., PLoS One 2020; 15:e0228164 and Ching et al., mAbs 2018; 10:71–80), and OmniClic (Ching et al., mAbs 2021; 13). A total of 11 blocking spectra or “boxes” were identified, covering all seven granule protein subdomains (A, B, C, D, E, F, and G), including small N-terminal paragranules (p). Some newly identified epitopes not represented by our standards include: CD epitopes bridging two non-overlapping epitopes (CD+CD') represented by our standards; E-box epitopes (E') that do not block our E-box standards; E-box epitopes bridging E+E'; novel G-box epitopes (G'); and B epitopes (chimera-2 binders) that block our B standards but do not show binding to any chimeras, thus deviating from the localization results specific to B-box clones. The most densely populated boxes are p and F, with 16 and 7 members respectively, while the other boxes each have 1–3 clones. Epitope box assignment is correlated with the antibody sequence of the anti-PGRN antibody. As expected, clones with highly similar sequences target the same boxes, but it was also observed that different clonal lineages converge on the same boxes, as shown by the p and F conjugates, each represented by 3 different clonal lineages.
[0321] Epitope coverage against a small subset of 102 unique sequences of anti-NKp46 antibodies was also analyzed. Binary bin assignments were derived from a merged analysis of three heatmaps generated from a series of epitope binning experiments using a set of crossover but not identical clones. A total of 12 blocking spectra were identified, representing five non-overlapping bins (1, 2, 3, 4, and 5), where subtle blocking behavior subdivides bins 1 through 4 into sub-bins: 1b / c / d, 2a / b / c, 3a / b, and 4a / b / c. In contrast, the four literature references used (NKp46-1, NKp46-2, NKp46-3, and NKp46-4) were assigned to bins 1a, 2c, 3b, and 1e, respectively. Therefore, Omni... dAb The antibody not only closely reproduced the blocking spectra of all the reference materials used, but also showed an expanded epitope coverage, generating new and unique epitopes, namely box 4 (containing sub-boxes 4a / b / c) and box 5.
[0322] Anti-NKp46 clones were clustered according to their antibody sequences. As observed in our PGRN instance, clones with highly similar sequences targeted the same bins, while for some bins, multiple distinct clonal lineages clustered into the same bin. Fine epitope differences defined by sub-bins were also highly correlated with antibody sequences, demonstrating the superior discriminative power of our binning method. Affinities for antibodies generated against two model targets were also determined, revealing that they exhibited a range of kinetic characteristics, with some of the highest-affinity clones reaching single-digit nM K0. D value( Figure 6A and Figure 6B Table 14 below provides the complete kinetics and bin allocation for the NKp46 antibody.
[0323]
[0324]
[0325]
[0326] Table 14: Anti-NKp46 Omni combined with box allocation and clonal lineage ID dAb Cloning kinetics and affinity determination results. Results for 102 unique sequences against NKp46 HcAb. n / d = undetermined.
[0327] Example 10
[0328] Developmentability assessment
[0329] PGRN and NKp46-specific Omni were evaluated in sdAb-Fc form. dAbVarious development metrics for antibodies, such as thermal stability, analytical size exclusion chromatography (aSEC), and self-interactions using affinity-capture self-interacting nanoparticle spectroscopy (AC-SINS), were evaluated. As determined by thermal stability analysis, all NKp46-specific antibodies exhibited high Tg. m and T agg ( Figure 7A and Figure 7B aSEC analysis confirmed that all antibody hits showed uniform monomer peaks, corresponding to a size of approximately 70 kDa based on elution time (i.e., the expected size for this form). Figure 11A and Figure 11B This indicates that the antibody preparation did not aggregate.
[0330] AC-SINS is an assay developed to monitor antibody self-association tendency. High concentrations of self-association can lead to developmental challenges such as poor solubility, aggregation, and high viscosity. Δλmax < 5 nm is defined as a rather stringent limitation for selecting only high-performing monoclonal antibodies (mAbs) for downstream development. AC-SINS studies have revealed that most identified monoclonal antibodies... dAb The antibody exhibited extremely small plasmonic shift (Δλmax < 5 nm), supporting its potential for development. For reference, eight human and humanized antibodies in late-stage clinical trials and one FDA-approved humanized VHH-Fc (capsulesizumab) were included. Figure 7C All of these clinical antibodies had Δλmax values less than 5 nm, confirming their potential for development. A group of antibodies with poor AC-SINS scores identified in previous literature were analyzed, and all showed Δλmax values greater than 5 nm, indicating strong self-association in phosphate-buffered saline (PBS) at pH 7.4.
[0331] discuss
[0332] This article discloses the expression of human variable regions by only heavy chain chickens (called Omni). dAb (Chicken). Expressing HcAb in a complete immune system requires engineering the variable region lacking a VL chaperone and addressing the CH1 domain lacking a CL chaperone. Our engineered single-domain variable region framework in the VHH3 transgene was able to express the autonomous VH region well, and for the CH1 domain, it provided a light chain consisting only of the constant region, namely the tLCi transgene. However, in Omni... dAb When expressing the VHH3 transgene, it was found that the tLCi chaperone light chain was not essential for B cell development or antibody expression in these birds. However, the tLCi transgene did have some effect, as slightly higher antibody expression was observed in tLCi birds. Figure 2AHowever, homozygous IgL knockout birds were still able to produce sufficient levels of functional B cells and antibodies. The mechanism is unclear, but this suggests that tLCi assists in B cell development or heavy chain expression, but this is not essential when the variable region is engineered for single-domain expression. Previous studies in heavy chain-only wild-type chickens have shown that tLCi expression is essential for normal B cell development and heavy chain expression. Somewhat surprisingly, the wild-type unengineered chicken VH region, which is typically paired with VL, can be readily expressed as HcAb both in vivo and as a recombinant antibody. Conversely, when an unengineered fully human VH transgene was combined with the tLCi transgene in birds, no expression or B cell development was observed. Therefore, Omni dAb The engineered framework in birds is crucial for the expression of human HcAb in transgenic chickens, support for B cell development, and subsequent antibody discovery. The introduction of VHH3 did not solve the problem of birds' inability to classify into IgY, but it was observed that the resulting antigen-specific IgM antibodies underwent affinity maturation and exhibited diverse epitope coverage.
[0333] Omni dAb In birds, optimized single VH scaffolds are designed to be maintained via a gene conversion process, where a pseudogene upstream of a single functional gene in the transgene contains the same stabilizing changes. In most cases, the stabilizing changes engineered into the VH scaffold are retained, and biophysical characterization of the antibodies indicates that these changes provide important stability and solubility. A notable exception is the signature “tetrad” in FR2, where random mutations still occur despite the gene conversion tending to delete it. It is speculated that high levels of mutations in multiple different amino acids (AAs) rather than just one type suggest that these residues may be involved in antigen contact. Another possibility is that the elongated CDR3 in HcAbs may fold down and contact FR2, producing changes in these contacts. Therefore, these FR2 mutations would be selected to improve the biophysical properties of the variable region, such as stability or non-aggregation, rather than being involved in antigen binding. Structural studies are necessary to further investigate these ideas. As designed, high levels of diversity are introduced through gene conversion in the CDR. CDR3 lengths are concentrated around a germline length of 17 residues, although most pseudogenes have longer CDR3s, consistent with the fact that most gene conversion events involve partial sequence substitutions rather than complete CDR substitutions. Despite Omni dAb The antibodies exhibited high levels of sequence variation from both gene conversion and somatic hypermutation, but they had low predictive immunogenicity. The natural in vivo B-cell selection process for these different sequences likely underscores the viability of these variations due to its preference for favorable biophysical properties, such as high levels of expression, stability, and solubility.
[0334] One subgroup of NKp46-specific antibodies activated IFNγ release. For multispecificity, receptor activation may be unfavorable if the aim is to utilize the receptor as a ligand for targeting tumors with NK or T cells. Therefore, in antibody discovery activities, a cohort of antibodies exhibiting functional diversity may be advantageous to provide options compatible with custom molecular forms and geometries designed to achieve the intended mechanism of action. In self-interaction studies, anti-NKp46 antibodies appeared to have slightly increased self-association compared to anti-PGRN clones, although they remain within acceptable limits of developability. The different target specificities may be due to these differences based on complementary sites evolved for the NKp46 clone. No correlation was observed with GRAVY.
[0335] Like other genetically modified chicken platforms such as OmniChicken and OmniClic, Omni... dAb Chickens recognize a wide range of epitopes, which is consistent with their excellent ability to recognize human targets due to their phylogenetic divergence as a host-immunized species. 22 Omni dAb Chickens also produce a range of affinities (including K, which is shown in the single-digit nM range). D Clones with high affinity for the target protein (PGRN) were observed. Kinetic diversity is an advantage when designing bispecific antibodies, as moderate affinity may be sufficient to achieve therapeutic effects, and the affinity effect of 2+2 bispecific antibodies may produce unwanted or excessive activation if the binding affinity is too high. For PGRN, a relatively large number of clones targeting small paragranular protein (p) domains were observed, many of which have short CDR3s of only 9 residues. PGRN consists of seven highly disulfide-bridged granular protein domains (GRNs) of approximately 55 amino acids, separated by linker regions (P1-P7) of 10 to 26 amino acids. At the N-terminus is a 25-amino acid p domain, which is linked to the first granular protein domain GRN-G via a 15-amino acid linker. Based on chimeric experiments, p binders may also bind to this linker. No structural information is available for PGRN, so it is unclear whether the linker provides antibody binding accessibility. For NKp46, extensive epitope coverage was observed that overlapped with four literature benchmark clones and extended beyond four literature benchmark clones, with each clone targeting non-overlapping epitopes. Five distinct non-overlapping epitope boxes were identified, three of which (boxes 1, 2, and 3) overlapped with reference objects (assigned to boxes 1a, 1e, 2c, and 3b), while two (boxes 4 and 5) were not represented by reference objects. This indicates that Omni dAb The HcAb form in chickens allows for the targeting of epitopes that are inaccessible to other chicken strains that express conventional heavy and light chain paired antibodies.
[0336] In conclusion, these two case studies on unrelated model antigens demonstrate that Omni dAb Chickens can produce clones with broad epitope coverage, a range of affinities (including high affinity in the low nM range), and favorable exploitability indicators.
[0337] While the invention has been described with reference to specific embodiments thereof, those skilled in the art will understand that various changes and equivalents may be made without departing from the true spirit and scope of the invention. Furthermore, numerous modifications may be made to adapt particular circumstances, materials, composition, processes, and steps to the purpose, spirit, and scope of the invention. All such modifications are intended to be within the scope of the appended claims.
[0338]
[0339]
[0340]
[0341]
[0342]
[0343]
[0344]
[0345]
[0346]
[0347]
[0348]
[0349]
[0350]
[0351]
[0352]
[0353]
[0354]
[0355]
[0356]
[0357]
[0358]
[0359]
[0360]
[0361]
[0362]
[0363]
[0364]
[0365]
[0366]
[0367]
[0368]
[0369]
[0370]
[0371]
[0372]
[0373]
[0374]
[0375]
[0376]
[0377]
[0378]
[0379]
[0380]
[0381]
[0382]
[0383]
[0384]
[0385]
[0386]
[0387]
[0388]
[0389]
[0390]
[0391]
[0392]
[0393]
[0394]
Claims
1. A polypeptide comprising: The VHH struct contains: (a) CDR1, CDR2, and CDR3 regions identical to those of VHH antibodies selected from Tables 1 and 10; or (b) Except for a maximum of 10 amino acid substitutions in all CDR regions, the remaining CDR1, CDR2 and CDR3 regions are identical to the CDR1, CDR2 and CDR3 regions of the VHH antibodies selected from Tables 1 and 10. The VHH domain is combined with NKp46.
2. A polypeptide comprising: Antibody-binding domain, which includes: (i) Heavy chain variable domains comprising CDR1, CDR2, and CDR3 regions identical to those of the heavy chain CDR1, CDR2, and CDR3 regions of the common light chain antibodies selected from Table 3 or Table 6, or CDR1, CDR2, and CDR3 regions identical to those of the heavy chain CDR1, CDR2, and CDR3 regions of the common light chain antibodies selected from Table 3 or Table 6, except for up to 10 amino acid substitutions in all CDR regions; and (ii) Light chain variable domains comprising CDR1, CDR2, and CDR3 regions identical to those of the selected common light chain antibody, or CDR1, CDR2, and CDR3 regions identical to those of the selected common light chain antibody, except for up to 10 amino acid substitutions in all CDR regions. The antibody-binding domain binds to NKp46.
3. A polypeptide comprising: The pestle domain contains the same amino acid sequence as the pestle domain selected from the ultra-long CDR3 domains in Table 9, or contains an amino acid sequence with up to 10 amino acid substitutions relative to the pestle domain.
4. The polypeptide according to claim 1, 2 or 3, wherein: The amino acid sequence of the VHH domain has at least 90% identity with the variable domain of the selected VHH antibody; or The antibody-binding domain includes a heavy chain variable domain having at least 90% identity with the heavy chain variable domain of the selected common light chain antibody, and a light chain variable domain having at least 90% identity with the light chain variable domain of the selected common light chain antibody; or The pestle domain contains an amino acid sequence that is at least 90% identical to the sequence selected from the ultra-long CDR3 domains in Table 9.
5. The polypeptide according to any one of claims 1-4, wherein: The amino acid sequence of the VHH domain has at least 95% identity with the variable domain of the selected VHH antibody; The antibody-binding domain includes a heavy chain variable domain having at least 95% identity with the heavy chain variable domain of the selected common light chain antibody, and a light chain variable domain having at least 95% identity with the light chain variable domain of the selected common light chain antibody; and The pestle domain contains an amino acid sequence that has at least 95% identity with the sequence selected from the ultra-long CDR3 domains in Table 9.
6. The polypeptide according to any one of the preceding claims, wherein the VHH domain or antibody-binding domain is humanized.
7. The polypeptide according to any one of the preceding claims, wherein the antibody-binding domain is scFv or Fab.
8. The polypeptide according to any one of the preceding claims, wherein the polypeptide is a multispecific binding molecule comprising the VHH domain, the antibody-binding domain or the valence domain and at least one other binding domain.
9. The polypeptide of claim 8, wherein the at least one other binding domain recognizes a cancer antigen or a viral antigen.
10. The polypeptide of claim 9, wherein the cancer antigen is CD19, CD20, BCMA, ALPP, CS1 (SLAMF7), CLDN18.2, AXL, ROR2, TM4SF1, ICAM-1, L1CAM (CD171), CD4, CD5, CD7, CD10, CD38, CEA, FLT3, CD70, CD30, CD37, or CD147.
11. The polypeptide according to any one of the preceding claims, wherein the polypeptide is a bispecific binding molecule comprising (i) the VHH domain, the antibody-binding domain or the valence domain, and (ii) a binding domain that recognizes a cancer antigen or a viral antigen.
12. The polypeptide according to any one of the preceding claims, wherein the polypeptide is a bispecific binding molecule comprising (i) the VHH domain, the antibody-binding domain, or the valence domain, (ii) a binding domain that recognizes a cancer antigen, and (iii) a binding domain that recognizes a co-stimulatory receptor on NK cells or a binding domain that recognizes a second cancer antigen or a second viral antigen.
13. The polypeptide of claim 12, wherein the co-stimulatory receptor is 2B4, DNAM1, or CD2.
14. The polypeptide according to any one of claims 9-13, wherein the cancer antigen is a leukemia antigen.
15. The polypeptide according to claims 9-13, wherein the cancer antigen is a solid tumor antigen.
16. The polypeptide according to any one of the preceding claims, wherein the polypeptide is conjugated with a pharmacologically active agent.
17. A pharmaceutical composition comprising: a) a polypeptide or a polynucleotide encoding said polypeptide, such as RNA, according to any one of the preceding claims; and b) Pharmaceutically acceptable carriers.
18. The pharmaceutical composition of claim 17, wherein the polypeptide is a multispecific binding molecule comprising the VHH domain, the antibody-binding domain or the valence domain and at least one other binding domain that binds to a cancer antigen.
19. A method for increasing the binding between NK cells and cancer cells, the method comprising incubating the NK cells and cancer cells together with a polypeptide of any one of claims 1-16, wherein the polypeptide is a multispecific binding molecule comprising the VHH domain, the antibody-binding domain or the acetylene domain and at least one other binding domain that binds to cancer antigens on the cancer cells.
20. A method for killing cancer cells, the method comprising contacting the cancer cells with NK cells and a polypeptide of any one of claims 1-16, wherein the polypeptide is a multispecific binding molecule comprising the VHH domain, the antibody-binding domain or the acetylene domain and at least one other binding domain that binds to cancer antigens on the cancer cells.
21. A treatment method comprising administering to a subject suffering from cancer a polypeptide of any one of claims 1-16 or a polynucleotide (e.g., RNA) encoding said polypeptide, wherein said polypeptide is a multispecific binding molecule comprising said VHH domain, said antibody-binding domain or said valence domain and at least one other binding domain binding to cancer antigens on said cancer cells.
22. A method for increasing the binding between NK cells and virus-infected cells, the method comprising incubating the NK cells and virus-infected cells together with a polypeptide of any one of claims 1-16, wherein the polypeptide is a multispecific binding molecule comprising the VHH domain, the antibody-binding domain or the spherical domain, and at least one other binding domain that binds to a viral antigen on the virus-infected cells.
23. A method for killing virus-infected cells, the method comprising contacting the virus-infected cells with NK cells and a polypeptide of any one of claims 1-16, wherein the polypeptide is a multispecific binding molecule comprising the VHH domain, the antibody-binding domain or the acetylene domain, and at least one other binding domain that binds to a viral antigen on the virus-infected cells.
24. A treatment method comprising administering to a subject suffering from a viral infection a polypeptide of any one of claims 1-16 or a polynucleotide (e.g., RNA) encoding said polypeptide, wherein said polypeptide is a multispecific binding molecule comprising said VHH domain, said antibody-binding domain or said valence domain and at least one other binding domain binding to a viral antigen on a cell infected with said virus.