Non-viral nanoparticle formulations for ocular gene delivery

By using non-viral nanoparticle formulations for suprachoroidal injection, the problems of low viral vector delivery efficiency and safety have been solved, achieving efficient and safe gene delivery and expression, which is suitable for the treatment of eye diseases.

CN122497708APending Publication Date: 2026-07-31JOHNS HOPKINS UNIVERSITY
View PDF 17 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JOHNS HOPKINS UNIVERSITY
Filing Date
2024-12-19
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

Existing viral vector gene transfer methods, such as intravitreal injection of AAV and lentiviral vectors, are highly invasive, carry the risk of retinal detachment, have low transduction efficiency, limited payload capacity, are difficult and expensive to manufacture, and repeated administration may lead to immune responses, making them ineffective in delivering large genomic materials.

Method used

The non-viral nanoparticle formulation, comprising a poly(β-amino ester) polymer and a gene composition, is delivered via suprachoroidal injection. The biodegradable polymer nanoparticles penetrate the retina to achieve efficient, broad, and long-lasting gene expression.

Benefits of technology

It achieves high-level exogenous gene expression, wide biological distribution, long-term efficacy and safety, avoids the invasiveness and immune response of viral vectors, and provides feasibility for repeated dosing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

Methods for treating eye diseases or conditions include administering a particulate composition comprising a poly(β-amino ester) (PBAE) polymer and DNA containing at least one target gene into the suprachoroidal space of the eyeball, wherein the mass ratio of polymer to DNA is between about 10:1 and about 50:1.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross - Reference to Related Applications This application claims the benefit of U.S. Provisional Application No. 63 / 611,804, filed on December 19, 2023, which is hereby incorporated by reference in its entirety.

[0002] Statement of Government Interests This invention was made with government support under Grant No. EY031097 awarded by the National Institute of Health. The U.S. government has certain rights in this invention.

[0003] Sequence Listing The text of the computer - readable sequence listing, submitted herewith and entitled "JHU_40111_601_SequenceListing.xml", created on December 19, 2024, having a file size of 1,996 bytes, is hereby incorporated by reference in its entirety.

[0004] Background[[ID=1 / / 17]] Ocular gene transfer can be achieved by subretinal injection of an expression construct packaged in an adeno - associated virus (AAV) vector or a lentiviral vector. This method requires a surgical procedure that includes vitrectomy and subretinal injection of the vector, which is invasive and has a 1% risk of retinal detachment. Campochiaro et al., 2016. However, intravitreal injection of lentiviral vectors is not feasible because of poor lentiviral infection of the cells lining the vitreous cavity. Intravitreal injection of AAV vectors results in transduction of ganglion cells only in the thinner parts of the inner limiting membrane (ILM) of the retina, Vandenberghe et al., 2011, which results in transgene expression that is several orders of magnitude lower than that achieved by subretinal injection of the same amount of AAV vector. Changes in the vector capsid can improve transduction after intravitreal injection of AAV vectors, but it is not clear whether the expression is sufficient for clinical applications. Pre - existing serum antibodies against AAV serotypes injected into the vitreous may reduce expression, but not if the AAV vector is injected into the subretinal space. Heier et al., 2017; Li et al., 2008; Kotterman et al., 2014. Limitations of using viral ocular gene transfer also include limited cargo size capacity for delivering large genes, difficult and expensive manufacturing, and ineffective repeated administration due to immunogenicity.

[0005] Summary In some respects, the subject matter disclosed herein provides a method for treating ocular diseases or conditions in subjects requiring appropriate treatment, the method comprising administering a particulate composition into the suprachoroidal space of the eyeball, the particulate composition comprising: (a) a poly(β-amino ester) (PBAE) of formula (I) or (II) and a pharmaceutically acceptable salt thereof: (I); or (II); Where: m and n are each independent integers from 1 to 10,000; m1 is an integer selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; m2 is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20; q is an integer selected from 0 or 1; where -(CH2) m1 -(C=C) q -(CH2) m2 -CH3 contains a hydrophobic side chain; R contains a divalent group comprising a biodegradable ester bond and / or a bioreducible disulfide bond; R' is a hydrophilic side chain containing a monovalent group derived from a hydrophilic amine monomer; R” is a monovalent group derived from an amine-terminated group; and (b) contains DNA containing at least one gene selected from: ABCA4, MYO7A, USH1C, CDH23, PCDH15, SANS, CIB2, USH2A, GPR98, WHRN, CLRN1, TIMP 3. Genes encoding PEDF, Prph2, BPDE, Bcl2, FGF-2, CNTF, Mertk, GUCY2D, AIPL1, RPGRIP, RPE65, LCA6, LCA10, anti-VEGF protein, endostatin, angiostatin and their protein-engineered mimics, antibodies and protein fragments, and anti-complement protein and its protein-engineered mimics, antibodies and protein fragments; wherein the mass ratio of the polymer to the DNA is between about 10:1 and about 50:1.

[0006] In some respects, n and m are each independently integers having a range of 1 to 10,000, 1 to 1,000, 1 to 100, 1 to 30, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 to 2 and 1.

[0007] In some respects, R is free to choose from the following groups: ; ; ; ; ; ; ; ; ; ; ; ; (BL1); (B8); (B10); (B11); (B12); (B13); (B7); (B9); Where p1, p2 and t are each independent integers selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10.

[0008] In some respects, R' is selected from the following groups: .

[0009] In some respects, "R" is selected from the following groups: ;

[0010] ;and .

[0011] In some respects, -(CH2) m1 -(C=C) q -(CH2) m2 -CH3 is selected from the following groups: .

[0012] In some aspects, the particulate composition further comprises lipid-polyethylene glycol (PEG). In some aspects, the lipid-PEG is selected from the group consisting of 1,2-dimyristoyl-racemic-glycerol-3-methoxypolyethylene glycol 2000 (DMG-PEG2k) and C18-PEG2k. In certain aspects, the particulate composition comprises lipid-PEG in a weight percentage of about 2 wt% to about 10 wt%, including about 2 wt%, 3 wt%, 4 wt%, 5 wt%, 6 wt%, 7 wt%, 8 wt%, 9 wt%, and 10 wt%.

[0013] In some aspects, the method includes administering a particulate composition into the suprachoroidal space of the eyeball, said particulate composition comprising: (a) a poly(β-amino ester) (PBAE) polymer of formula (I) and a pharmaceutically acceptable salt thereof: (I); Where: n is an integer from 1 to 10,000; R is selected from... ; ;R' is selected from (S2) (S3) and (S4); R” is selected from (E6) and (E7); and (b) contains DNA containing at least one gene selected from the following: ABCA4, MYO7A, USH1C, CDH23, PCDH15, SANS, CIB2, USH2A, GPR98, WHRN, CLRN1, TIMP3, PEDF, Prph2, BPDE, Bcl2, FGF-2, CNTF, Mertk, GUCY2D, AIPL1, RPGRIP, RPE65, LCA6, LCA10, genes encoding anti-VEGF protein, endostatin, angiostatin and their protein-engineered mimics, antibodies and protein fragments, and genes encoding anti-complement protein and its protein-engineered mimics, antibodies and protein fragments; wherein the mass ratio of PBAE to DNA is between about 10:1 and about 50:1.

[0014] In some respects, anti-VEGF proteins are selected from VEGFR1 / sFLT-1, VEGFR2, and VEGFR3.

[0015] In some respects, the DNA is selected from microcircular plasmid DNA, nanoparticle DNA, and closed-terminal DNA. In some respects, the DNA: (a) is substantially free of bacterial elements; (b) is about 1-4 kbp in the absence of the said gene; and / or (c) is substantially free of unmethylated CpG sequences.

[0016] In some aspects, the DNA contains one or more repeats of the 72-bp region of the CAG promoter and the SV40 enhancer, ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1). In some aspects, the method includes two or more repeats of the 72-bp region of the SV40 enhancer, ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1). In a particular aspect, the DNA comprises a nanoparticle containing one or more repeats of a target gene driven by the CAG promoter and the 72-bp region of the SV40 enhancer, ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1), wherein the DNA is substantially free of bacterial genetic elements and unmethylated CpG sequences.

[0017] In some respects, the PBAE of equation (I) is 457: .

[0018] In some respects, the PBAE of equation (I) is 447: .

[0019] In some respects, the molecular weight of PBAE of formula (I) or formula (II) has a range selected from about 5,000 to about 40,000 Da, about 5,000 to about 10,000 Da, about 10,000 Da to about 20,000 Da, about 20,000 Da to about 30,000 Da and about 10,000 Da.

[0020] In some aspects, the particulate composition has a size selected from the range of about 50 nm to about 800 nm, about 100 nm to about 500 nm, about 100 nm to about 300 nm and about 200 nm.

[0021] In some respects, the mass ratio of polymer to DNA has a range of about 10:1 to about 50:1, about 15:1 to about 40:1, about 20:1 to about 30:1, about 20:1, about 25:1 and about 30:1.

[0022] In some respects, with or without an infusion pump, a specialized insert tip is used to apply the particulate composition to the suprachoroidal space of the subject's eyeball, the insert tip being in the range of about 1-5 mm and having a specification of about 25-35 G.

[0023] In some aspects, the particulate composition is administered to the suprachoroidal space of the subject's eyeball via more than one injection at one or more injection sites. In some aspects, more than one injection is administered during a single treatment session. In some aspects, a single treatment session includes an outpatient visit. In some aspects, the method also includes a waiting period between the more than one injection. In some aspects, more than one injection is administered using an auto-injector or infusion pump.

[0024] In some respects, DNA has concentrations ranging from about 0.1 mg / mL to about 2.0 mg / mL, from about 0.2 mg / mL to about 1.0 mg / mL, from about 0.2 mg / mL to about 0.5 mg / mL, and from about 0.3 mg / mL to about 0.4 mg / mL.

[0025] In some aspects, the method includes an application volume to the suprachoroidal space ranging from about 20 μL to 500 μL, from about 50 μL to 300 μL, and from about 50 μL to 100 μL.

[0026] In some aspects, the particulate composition further comprises one or more of a sugar, a sugar alcohol, a salt, MgCl2, a buffer, a cryoprotectant, an excipient, and combinations thereof. In some aspects, the sugar is selected from the group consisting of glucose, fructose, sorbitol, mannitol, sucrose, trehalose, and raffinose. In certain aspects, the sugar is selected from sucrose and trehalose. In some aspects, one or more sugar alcohols include sorbitol.

[0027] In some cases, eye diseases or conditions are selected from the following groups: Stargardt disease, Usher syndrome, neovascular AMD and other diseases that cause choroidal neovascularization, diabetic retinopathy, retinal vein occlusion, retinitis pigmentosa, Leber congenital amaurosis, and geographic atrophy.

[0028] Some aspects of the subject matter disclosed herein have been set forth above, and are presented in whole or in part by the subject matter disclosed herein. Other aspects will become apparent as the description proceeds, when taken in conjunction with the accompanying embodiments and drawings, which are best described herein. Brief description of the attached diagram This patent or application document contains at least one drawing shown in color. A published copy of this patent or application with a color drawing will be provided by the competent authority upon request and payment of the necessary fees.

[0030] The subject matter disclosed herein has already been described in general terms, and reference will now be made to the accompanying drawings, which are not necessarily drawn to scale, and in which: Figure 1 A, Figure 1 B and Figure 1 C illustrates an example of the characterization of the PBAE nanoparticles (NPs) disclosed herein. The PBAE NPs were prepared by lyophilization, stored at -20°C, and then resuspended in sterile water, as they would be used in in vivo studies. Figure 1 A) Hydrodynamic diameter (particle size) and zeta potential (ZP) (surface charge) of NPs were evaluated under aqueous conditions using DLS. Bars represent the average ± SE of the z-mean diameter and zeta potential from three independently prepared batches. Figure 1 B) Visualize the size and shape of the NP using TEM. Figure 1 C) Gel electrophoresis shows complete binding of DNA in NPs; Figure 2 A, Figure 2 B and Figure 2 C indicates that injection of poly(β-amino ester) (PBAE) nanoparticles (NP) containing a green fluorescent protein (GFP) expression plasmid onto the choroid of miniature pigs resulted in widespread expression of GFP in the photoreceptors. Figure 2 A) The diagram illustrates how a cross-section is used to locate the expression relative to the eye's equator. Figure 2 B) Inject 50 μL of a solution containing 19.2 μg into the choroid of Göttingen minipigs. pCAG-GFP-Z1 Two weeks after PBAE NP, transverse ocular sections taken at 2.87 mm anterior to the equator, at the equator, or 8.12 mm posterior to the equator showed GFP fluorescence around the entire circumference of the eyeball. Figure 2 C) At higher magnification, GFP immunofluorescence staining showed that the fluorescence was due to the expression of GFP in the inner and outer segments of the photoreceptor. Figure 3 A, Figure 3 B. Figure 3 C Figure 3 D、 Figure 3 E and Figure 3 F shows the injection of 50, 100, or 200 μL of [a specific substance] into the choroid. pCAG-GFP-Z1Comparison of GFP expression two weeks after NP administration. Yucatan minipigs were injected intrachoroidally with 50, 100, or 200 μL of GFP containing 0.38 µg / µL... pCAG-GFP-Z1 PBAE NP. Two weeks after injection of each volume, GFP fluorescence was observed around the entire circumference of eye sections at and behind the equator; Figure 4 A, Figure 4 B. Figure 4 C and Figure 4 D shows that a single injection of 50 μL containing 19.2 µg of [a specific substance] into the choroid plexus... pCAG- GFP-Z1 The levels of GFP protein in different regions of the retina after NP were measured. Three miniature pigs were injected intrachoroidally with 50 μL of [agent / container / product name missing]. pCAG-GFP-Z1 PBAE NP. Two weeks post-injection, GFP protein was measured in retinal punches by ELISA. GFP levels in pg / mg total protein are shown at the sample site in each of the three injected eyes. Figure 4 A- Figure 4 C). A dot plot of all values ​​in each eye shows the mean and illustrates the variability within and between eyeballs. Figure 4 D). ND = Not detected; NC = Not collected; Figure 5 A, Figure 5 B. Figure 5 C Figure 5 D、 Figure 5 E and Figure 5 F shows the injection of 50, 100, or 200 μL of [a specific substance] into the choroid. pCAG-GFP-Z1 Comparison of GFP expression at two and twelve weeks after NP administration. 50, 100, or 200 μL of 0.38 µg / µL euctani was injected intrachoroidally into miniature pigs. pCAG-GFP-Z1 PBAE NP. Inject 50 μL ( Figure 5 A and Figure 5 B) 100 μL ( Figure 5 C and Figure 5 D) or 200 μL ( Figure 5 E and Figure 5 Two weeks after PBAE NP (each volume for three eyes) or twelve weeks after NP (each volume for two eyes), the retina was measured by ELISA at the locations specified in the illustration. Figure 5 A, Figure 5 C Figure 5 E) or RPE / choroid ( Figure 5 B. Figure 5 D、 Figure 5F) The GFP protein in the punch. The point plot of all measurements at each dose / time point tested shows the injection of 200 μL containing 76.8 µg. pCAG-GFP-Z1 Twelve weeks after PBAE NP, retina ( Figure 5 E) and RPE / choroid ( Figure 5 The trend is towards higher average GFP protein and lower variability in F); Figure 6 A, Figure 6 B. Figure 6 C Figure 6 D、 Figure 6 E and Figure 6 F shows minimization in GFP expression plasmids. CpG Effects of bacterial sequence analysis. Yucatan was administered via intrachoroidal injection of 50 μL containing 19.2 μg of [unspecified substance] into miniature pigs (n=3). pCAG-GFP-nP The PBAE NPs were used, with the bacterial sequence minimized. Two weeks post-injection, one eye from each pig was used to locate GFP expression in serial frozen sections of the eye, and the other eye was used to measure GFP expression at seven sites in the retina and RPE / choroid by ELISA. Representative eye sections anterior to the equator show GFP fluorescence around the entire circumference of the eye. Figure 6 A), and high magnification shows GFP expression in cells of the inner retina and photoreceptors. Figure 6 B). Sections taken 7.49 mm posterior to the equator also showed GFP fluorescence around the entire circumference of the eyeball. Figure 6 C), and high magnification showed that GFP fluorescence was mainly in photoreceptors, but also in some inner retinal cells (C). Figure 6 D). Retinal retina (calculated from seven measurements in each of the three eyes). Figure 6 E) or RPE choroid ( Figure 6 The average level of GFP protein in F) during injection pCAG-GFP- nP The subsequent values ​​were 219.2 and 649.8 pg / mg total protein, compared to those obtained at the injection site. pCAG-GFP-Z1 The subsequent values ​​were 51.2- and 68.2- pg / mg. Due to variability, the differences were not statistically significant. Based on a linear mixed-effects model, p=0.26; p=0.08; Figure 7 A, Figure 7 B. Figure 7 C Figure 7 D、 Figure 7 E and Figure 7F indicates that the substance was injected into the choroid at three different locations. pCAG-GFP-nP PBAE NP reduced the variability of GFP expression throughout the retina and RPE / choroid. In three eyes, 50 μL of GFP containing 19.2 µg was injected into the choroid at 12:00. pCAG-GFP-nP Two weeks after PBAE NP, in the retina ( Figure 7 A) and RPE choroid ( Figure 7 The GFP protein levels (pg / mg total protein) measured at seven locations in B) were compared with those measured at three injection sites (once superior, once temporal, and once inferior) containing 19.2 µg of GFP protein in 50 μL. pCAG-GFP-nP PBAENP two weeks after retinal ( Figure 7 C) and RPE choroid ( Figure 7 The levels of GFP protein measured at the same seven locations in D) were compared. A dot plot of all GFP protein levels at all locations in each eye shows that, compared to eyes that received a single injection, eyes that received three injections showed lower levels of GFP protein in the retina (D). Figure 7 E) and RPE / choroid ( Figure 7 The coefficient of variation (CV) of GFP levels in F) was significantly reduced; Figure 8 This diagram illustrates in vivo gene delivery on the choroid in rats using PBAEs with different structures (i.e., containing different combinations of monomers). Transfection levels (expressed as GFP transgenes measured in pg / mg total protein) were high only for the two PBAEs evaluated (e.g., 4-5-7 and 4-4-7). In contrast, transfection levels were low for all other PBAEs tested, including two PBAEs that differed only in the number of carbon atoms between acrylate groups in the main chain monomer and between amino and alcohol groups in the side chain monomers (e.g., 5-3-7) or in terminal identity (e.g., 4-5-6). Data were obtained from rats; Figure 9 This demonstrates that nonviral in vivo gene delivery transfection via choroidal injection of 4-5-7 nanoparticles is superior in a direct comparison between subretinal and intravitreal injection. This example importantly demonstrates that the PBAE-based nanoparticles of this application penetrate the choroid and retinal pigment epithelium (RPE) to reach photoreceptors in the retina, where they exhibit robust expression (as measured by transgenic GFP). This observation is unexpected because it was previously thought that nonviral nanoparticles could not penetrate the retina, resulting in intracellular delivery to photoreceptors and delivery to the nucleus of these non-dividing cells to achieve the observed exogenous transgenic expression. Data were obtained from rats; Figure 10The results showed that labeled PBAE 4-5-7 nanoparticles rapidly penetrated the RPE and retina after injection onto the choroid (images are taken 6–12 hours post-injection). The nanoparticles rapidly exited the suprachoroidal space to cross the choroid and RPE to reach photoreceptors. They were then taken up by the photoreceptors for subsequent intracellular release of encapsulated DNA and downstream gene expression. Cy3-labeled DNA showed red fluorescence at the site where it had been carried and delivered by the PBAE-based nanoparticles. Data were obtained from rats. Figure 11 The results showed that intrachoroidal injection of PBAE 4-5-7 nanoparticles resulted in surprisingly robust transfection and expression of the GFP transgene via the choroid and RPE, reaching the periretinal 360 degrees and extending to the posterior retina. Data were obtained from the eyes of large-sized miniature pigs. Repeated doses of the PBAE nanoparticles (above figure) were also well tolerated. This characteristic of the PBAE nanoparticles in this application contrasts with viral transfection, where repeated administration can lead to toxicity. Figure 12 The image shows the contrast between choroidal injection of free Cy3-labeled plasmid DNA (top panel) encapsulated in nanoparticles (NP) and injection into the choroid (bottom panel). NP-encapsulated DNA exhibits (i) penetration into the retina, rather than merely residing in the suprachoroidal space, and (ii) persistence in the retina, rather than rapid clearance. Free DNA molecules in the suprachoroidal space (e.g., by direct injection or release from the device) cannot achieve the combined effects of suprachoroidal injection and PBAE-based nanoparticles, as shown here, in terms of both penetration and persistence. These data indicate that naked plasmids are visible in the suprachoroidal space at 1 hour post-injection but not within cells, and are very faint at 3 hours post-injection, and invisible at 6 or 24 hours post-injection. Labeled DNA in PBAE-based nanoparticles is already present in the photoreceptor and RPE at 1 hour post-injection and remains in the photoreceptor for at least 24 hours (the longest time point analyzed). Figure 13 A, Figure 13 B. Figure 13 C Figure 13 D、 Figure 13 E and Figure 13 F shows that the appearance of the retina was not altered after PBAE nanoparticles containing GFP expression plasmid were injected onto the choroid. In Göttingen miniature pigs (… Figure 13 A and Figure 13 B) or Yucatan miniature pig ( Figure 13 C and Figure 13Fundus photographs were obtained two weeks before and after the injection of PBAE nanoparticles containing 1 μg of GFP expression plasmid onto the choroid. Two weeks after the injection of PBAE nanoparticles containing 1 μg of GFP expression plasmid onto the choroid, eye sections showed artificial separation of the retina from the retinal pigment epithelium (RPE), and both the retina and RPE appeared normal. Figure 13 E). Higher magnification revealed normal retinal structures and no evidence of inflammatory cells. Figure 13 F); Figure 14 A, Figure 14 B. Figure 14 C Figure 14 D、 Figure 14 E and Figure 14 F shows the collection of retinal and RPE / choroidal samples used to measure GFP protein. Figure 14 A and Figure 14 B) A schematic diagram showing the numbering system used to identify sample locations: 1 posterior nose, 2 posterior temporal region, 3 temporal region, 4 superior nose, 5 superior temporal region, 6 inferior nose, 7 inferior temporal region. Figure 14 C) Because the pigment of the RPE is visible through the translucent retina, small pig eye cups with the anterior segment and vitreous removed appear black. Figure 14 D) Small pig eye cups after removing 7 retinal samples with a 7-mm trephine, revealing the remaining darkly stained RPE. Figure 14 E and Figure 14 F) The remaining sclera is shown in the small pig eye cups on the right and left sides after the RPE / choroid sample was removed; Figure 15 A and Figure 15 B indicates that plasmid cargo within nanoparticles can be quantified via nanoparticle tracking analysis (NTA). Figure 15 A) Number-weighted nanoparticle size distribution measured by NTA. Figure 15 B) The number of plasmids per particle was quantified from the corresponding calculated volume distribution using the previously described method. Bhise et al., 2012. Nanoparticle tracking analysis (NTA) showed that the number-weighted average diameter of the particles was 100 ± 10 nm (mean of three replicates ± SEM), and the volume-weighted diameter was 140 ± 20 nm. This measurement corresponds to an average of 250 ± 20 kbp encapsulated in each particle, or 80 ± 5 plasmids of 3151 bp; and Figure 16 A and Figure 16 B shows that injecting 50 μL of a solution containing 19.2 μg into the choroid... pCAG-GFP-nP The fluorescence observed 2 weeks after PBAE NP was due to GFP expression rather than autofluorescence. (The text abruptly ends here, likely due to an incomplete sentence or missing information.) Figure 6The section of the same eye shown was stained immunohistochemically for GFP. Fluorescence was observed in the retina. Figure 16 A) Corresponding to GFP staining ( Figure 16 B).

[0031] Detailed description The subject matter of this disclosure will now be described more fully below with reference to the accompanying drawings, in which some, but not all, embodiments of the invention are illustrated. The same numerals always refer to the same elements. The subject matter disclosed herein can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that the disclosure will satisfy applicable legal requirements. In fact, many modifications and other embodiments of the subject matter disclosed herein will be apparent to those skilled in the art, benefiting from the teachings presented in the foregoing description and the associated drawings. Therefore, it should be understood that the subject matter disclosed herein is not limited to the specific embodiments disclosed, and that variations and other embodiments are intended to be included within the scope of the appended claims.

[0032] In some embodiments, the subject matter disclosed herein provides nonviral, biodegradable polymer nanoparticles capable of achieving high levels of exogenous gene expression, broad biodistribution throughout the retina, long duration of action, the ability to be re-administered for cumulative effects of efficacy, and overall safety in the eye and other tissues. (Shen et al., 2020). In some embodiments, these effects are achieved via choroidal injection. In other embodiments, other routes of administration are used, such as subretinal injection.

[0033] Suprachoroidal injection provides a novel route for drug delivery to the retina. Patel et al., 2011; Patel et al., 2012. The suprachoroidal space is essentially the potential space that expands when fluid is injected only into the interior of the sclera. For some drugs, suprachoroidal injection may have potential advantages over intravitreal injection because they can increase delivery to the retina and minimize delivery to the anterior structures of the eye. For example, in this application… Figure 9 The study demonstrated the superiority of choroidal injection for ocular gene transfer.

[0034] The specific implementation schemes of the nanoparticle formulations disclosed herein include: (1) the design of biodegradable polymers and biomaterials that form nanoparticles; (2) the design of a target gene expressed as a treatment corresponding to a specific eye disease; (3) the design of a DNA vector containing a promoter / enhancer that drives expression; (4) the design of excipients that can improve the transport, transfection and / or stability of the nanoparticle formulation; and (5) the method of administration, including a device for administration.

[0035] In certain implementations, the topics disclosed herein include: (1) Design of biodegradable polymers and biomaterials to form nanoparticles In some embodiments, linear cationic-terminated poly(β-amino esters) (PBAEs), including B4-S5-E7 and B4-S4-E7, are used at a polymer-to-DNA mass ratio of about 10 to about 50 (polymer mass:DNA mass). In other embodiments, other straight-chain or branched PBAEs may be used. In some embodiments, lipophilic hybrid PBAEs may be used, consisting of a hydrophobic alkyl side chain having at least eight carbon atoms and a hydrophilic side chain containing at least one oxygen atom. In some embodiments, mixtures of polymer materials are used. In some embodiments, polyethylene glycol-modified polymers or polyethylene glycol-modified lipids are added to the nanoparticle formulation.

[0036] More specifically, in some embodiments, the subject matter disclosed herein provides nonviral biodegradable polymer nanoparticles capable of achieving high levels of exogenous gene expression, broad biodistribution throughout the retina, long duration of action, the ability to be re-administered for cumulative effects of efficacy, and overall safety in the eye and other tissues. Shen et al., 2020.

[0037] As used herein, “biodegradable” polymers and / or nanoparticles are those that, when introduced into cells, are broken down by cellular machinery or by hydrolysis into components that are reusable or treatable by the cells without significant toxicity (i.e., less than about 20% of cells are killed when the component is added to cells in vitro). Such components preferably do not cause inflammation or other side effects in vivo. In some cases, the chemical reactions upon which the degradation of biodegradable compounds depends are uncatalyzed.

[0038] In some embodiments, the biodegradable polymer and / or nanoparticles comprise a chemical moiety having one or more degradable bonds, such as ester bonds, disulfide bonds, amide bonds, anhydride bonds, and bonds readily degradable by enzymes. Representative degradable bonds include, but are not limited to: .

[0039] In some embodiments, the biodegradable polymer and / or nanoparticles comprise poly(β-amino ester) (PBAE). Exemplary PBAEs suitable for use with the subject matter disclosed herein include those disclosed below: U.S. Patent No. 9,884,118 to Green et al. entitled Multicomponent Degradable CationicPolymers, granted on February 6, 2018; U.S. Patent No. 9,802,984 to Popel et al. entitled "Biomimetic Peptide and Biodegradable Delivery Platform for the Treatment of Angiogenesis- and Lymphangiogenesis-Dependent Diseases" was granted on October 31, 2017. U.S. Patent No. 9,717,694 to Green et al. entitled Peptide / Particle Delivery Systems, granted on August 1, 2017; U.S. Patent No. 8,992,991 to Green et al. entitled Multicomponent Degradable CationicPolymers, granted on March 31, 2015; U.S. Patent Application Publication No. 20180256745, entitled Biomimetic Artificial Cells: Anisotropic Supported Lipid Bilayers on Biodegradable Micro and Nanoparticles for Spatially Dynamic Surface Biomolecule Presentation, was published on September 13, 2018 by Meyer et al. U.S. Patent Application Publication No. 20180112038, entitled Poly(Beta-Amino Ester)-Co-Polyethylene Glycol (PEG-PBAE-PEG) Polymers for Gene and Drug Delivery, was published by Green et al. on April 26, 2018. The U.S. patent application entitled "Nanoparticle Modification of Human Adipose-Derived Mesenchymal Stem Cells for Treating Brain Cancer and other Neurological Diseases" by Quinones-Hinojosa and Green, published on August 3, 2017, with publication number 20170216363; U.S. Patent Application Publication No. 20150273071, entitled Bioreducible Poly (Beta-AminoEster)s For siRNA Delivery, by Green et al., was published on October 1, 2015. U.S. Patent No. 8,287,849 to Langer et al. entitled Biodegradable Poly(beta-aminoesters) and Uses Thereof, granted on October 16, 2012; The international PCT patent application titled "Poly(beta-Amino Ester)-Co-Polyethylene Glycol (PEG-PBAE-PEG) Polymers for Gene and Drug Delivery" by Green et al., published on September 29, 2016, has the publication number WO2016154622. The international PCT patent application entitled "Nonviral Gene Transfer to the Suprachoroidal Space" by Campochiaro et al., published on April 11, 2019, has publication number WO2019070727. The international PCT patent application titled "Poly(Beta-Amino Ester) Nanoparticles for the Non-Viral Delivery of Plasmid DNA for Gene Editing and Retinal Gene Therapy" by Green et al., published on April 16, 2020, has the publication number WO2020077159. Green's international PCT patent application entitled "Gene Delivery Particles to InduceTumor-Derived Antigen Presenting Cells" was published on October 1, 2020, with publication number WO2020198145. The international PCT patent application entitled "Polymers and Nanoparticle Formulations for Systemic Nucleic Acid Delivery" by Green et al., published on March 31, 2022, has the publication number WO / 2022 / 067249. The international PCT patent application titled "Photo-Crosslinked Bioreducible Polymeric Nanoparticles for Enhanced RNA Delivery" by Green et al., published on July 28, 2022, has the publication number WO / 2022 / 159855. The international PCT patent application titled "Polymeric Nanoparticle Genetic Vaccines" by Green et al., published on April 6, 2023, with publication number WO / 2023 / 056293; and The international PCT patent application entitled "Polymers and Nanoparticles for Intramuscular Nucleic Acid Delivery" by Green et al., published on May 4, 2023, has the publication number WO / 2023 / 077150. Each of them is incorporated into the whole through reference.

[0040] Typically, the multi-component biodegradable cationic polymers disclosed herein comprise a backbone derived from a diacrylate monomer (hereinafter referred to as "B"), an amino alcohol hydrophilic side-chain monomer (hereinafter referred to as "S"), a hydrophobic side-chain monomer, and an amine-terminated monomer (hereinafter referred to as "E"). For a given polymer material, the structure of the end-capping group differs from and is separate from the polymer backbone structure and the side-chain structure of the intermediate precursor molecule.

[0041] The PBAE compositions disclosed herein may be referred to as, for example, B5-S4-E7 or S47, where R is B5, R' is S4, and R" is E7, etc., where B is the main chain and S is the side chain, followed by the number of carbon atoms in its hydrocarbon chain; for example, S4 contains four alkylene groups. The end-capping monomers E are numbered sequentially according to the similarity of their amine structures. Furthermore, in some embodiments, the PBAEs disclosed herein include hydrophobic side chains referred to as SC-XX, where XX is the number of carbon atoms in the chain.

[0042] In some embodiments, the subject matter disclosed herein provides a method for treating an ocular disease or condition in a subject requiring appropriate treatment, the method comprising administering a particulate composition comprising poly(β-amino ester) (PBAE) of formula (I) into the suprachoroidal space of the eyeball: (I); in: n is an integer from 1 to 10,000; R is selected from ; ; R' is selected from (S2) (S3) and (S4); R is selected from (E6) and (E7); and its pharmaceutically acceptable salts.

[0043] In the specific implementation plan, the PBAE of equation (I) is 457: .

[0044] In the specific implementation scheme, the PBAE of equation (I) is 447: .

[0045] In some embodiments, other PBAEs may be used. PBAEs suitable for the methods disclosed herein can be prepared by condensing an acrylate monomer with an amine-containing side-chain monomer. In some embodiments, the side-chain monomer comprises a primary amine, but in other embodiments, the side-chain monomer comprises secondary and tertiary amines. The side-chain monomer may also comprise C1 to C8 straight-chain or branched alkylene groups, which may optionally be substituted. Illustrative substituents include hydroxyl, alkyl, alkenyl, thiol, amine, carbonyl, and halogen.

[0046] In some embodiments, the molecular weight of the linear and / or branched PBAE polymer is from about 5 kDa to about 50 kDa, in some embodiments it is from about 5 kDa to about 40 kDa, in some embodiments it is from about 5 kDa to about 30 kDa, in some embodiments it is from about 5 kDa to about 25 kDa, in some embodiments it is from about 5 kDa to about 20 kDa, in some embodiments it is from about 5 kDa to 15 kDa, and in some embodiments it is from about 5 kDa to 10 kDa.

[0047] In some embodiments, the subject matter disclosed herein provides nanoparticles comprising PBAE of formula (I) or formula (II) and their pharmaceutically acceptable salts: (I); or (II); in: m and n are each independent integers from 1 to 10,000; m1 is an integer selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; m2 is an integer that can be selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20; q is an integer selected from 0 or 1; Wherein -(CH2) m1 -(C=C) q -(CH2) m2 -CH3 contains hydrophobic side chains; R contains a divalent group, the divalent group comprising a biodegradable ester bond and / or a bioreducible disulfide bond; R' is a hydrophilic side chain containing a monovalent group derived from a hydrophilic amine monomer; R” is a monovalent group derived from an amine-terminated group.

[0048] In some implementations, n and m are each independently an integer having a range of 1 to 10,000, 1 to 1,000, 1 to 100, 1 to 30, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 to 2 and 1.

[0049] In some implementations, R is selected from the group consisting of: ; ; ; ; ; ; ; ; ; ; ; ; (BL1); (B8); (B10); (B11); (B12); (B13); (B7); (B9); Where p1, p2 and t are each independent integers selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10.

[0050] In some implementations, R' is selected from the group consisting of: .

[0051] In some implementations, R is selected from the group consisting of: ; ;and .

[0052] In some implementations, -(CH2) m1 -(C=C) q -(CH2) m2 -CH3 is selected from the following groups: .

[0053] In a particular implementation, R is selected from the group consisting of the following: ; ; (B7); and (B9); Where p1, p2 and t are each independent integers selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10.

[0054] In a particular implementation, R' is selected from the group consisting of the following: .

[0055] In a particular implementation, R” is selected from the group consisting of the following: .

[0056] In certain implementations, -(CH2) m1 -(C=C) q -(CH2) m2 -CH3 is selected from the following groups: .

[0057] In a more specific embodiment, the compound of formula (II) comprises the following combinations: (a) an R group selected from the group consisting of B5, B7, B9, and BR6; (b) an R' group selected from the group consisting of S3, S4, S90, and S91; (c) an R” group selected from the group consisting of E1, E6, E7, E27, E31, E33, E39, E49, E56, E58, E63, and E65; and (d) a -(CH2) group selected from the group consisting of Sc12, Sc14, Sc16, and Sc18. m1 -(C=C) q -(CH2) m2 -CH3 part.

[0058] In a particular implementation, R is: ;or (B7)

[0059] In a particular implementation, R' is: .

[0060] In a particular implementation, R” is: .

[0061] In certain implementations, -(CH2) m1 -(C=C) q -(CH2) m2 -CH3 is Sc12.

[0062] In some embodiments, the nanoparticles further comprise one or more additional compounds selected from formula (I) or formula (II) and / or lipid-polyethylene glycol (PEG). In some embodiments, the lipid-PEG is selected from the group consisting of 1,2-dimyristoyl-racemic-glycerol-3-methoxypolyethylene glycol 2000 (DMG-PEG2k) and C18-PEG2k. In a particular embodiment, the lipid-PEG comprises DMG-PEG2k.

[0063] In some embodiments, the nanoparticles contain about 2 wt% to about 10 wt%, including about 2 wt%, 3 wt%, 4 wt%, 5 wt%, 6 wt%, 7 wt%, 8 wt%, 9 wt% and 10 wt% by mass percentage of lipid PEG.

[0064] In some embodiments, the zeta potential of the nanoparticles varies with the weight percentage of lipid-PEG, wherein the zeta potential ranges from -12 mV to +18 mV, including about -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2, -1, 0, +1, +2, +3, +4, +5, +6, +7, +8, +9, +10, +11, +12, +13, +14, +15, +16, +17, and +18 mV, and in some embodiments is between -5 mV and +5 mV, including about -5, -4, -3, -2, -1, 0, +1, +2, +3, +4, and +5 mV. In some embodiments, the zeta potential is measured under aqueous conditions, such as in 150 mM phosphate-buffered saline (PBS).

[0065] In some embodiments, the nanoparticles comprise a plurality of nanoparticles with a polydispersity of less than about 0.2, including nanoparticles of about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, and 0.20.

[0066] In some embodiments, the particulate composition further comprises one or more of sugars, salts, buffers, excipients, and combinations thereof. In some embodiments, one or more excipients include one or more cryoprotectants, one or more sugars or sugar alcohols, MgCl2, and combinations thereof. In a specific embodiment, one or more cryoprotectants include sugars. In a more specific embodiment, the sugar is selected from the group consisting of glucose, fructose, sorbitol, mannitol, sucrose, trehalose, and raffinose. In a particular embodiment, one or more sugar alcohols include sorbitol. In a particular embodiment, the sugar is selected from sucrose and trehalose. In some embodiments, the nanoparticles are lyophilized. In some embodiments, the nanoparticles comprise a storable powder.

[0067] In some embodiments, at least one size of the nanoparticles is in the range of about 50 nm to about 500 nm, or about 50 nm to about 200 nm. Exemplary nanoparticles may have an average size (e.g., average diameter) of about 50, about 75, about 100, about 125, about 150, about 200, about 250, about 300, about 400, or about 500 nm. In some embodiments, the average diameter of the nanoparticles is about 50 nm to about 500 nm, about 50 nm to about 300 nm, or about 50 nm to about 200 nm, or about 50 nm to about 150 nm, or about 70 to 100 nm. In some embodiments, the average diameter of the nanoparticles is about 200 nm to about 500 nm. In some embodiments, the nanoparticles have at least one size, such as an average diameter, of about 50 to about 100 nm. Nanoparticles are generally desired for in vivo applications. For example, nanoparticles smaller than about 200 nm will distribute better into target tissues in vivo. In some embodiments, the nanoparticles have a diameter of about 100 nm to about 150 nm, including diameters of 100, 105, 110, 115, 120, 125, 130, 135, 140, 145 and 150 nm.

[0068] In some embodiments, the subject matter disclosed herein provides a pharmaceutical formulation comprising one or more nucleic acids and a poly(β-amino ester) (PBAE) of formula (I) or formula (II) in a pharmaceutically acceptable carrier.

[0069] As used herein, “pharmaceutically acceptable carrier” is intended to include, but is not limited to, water, saline, dextran solution, human serum albumin, liposomes, hydrogels, micron particles, and nanoparticles. The use of such media and agents in pharmaceutically active compositions is well known in the art, and therefore further examples and methods of incorporating each into the composition at effective levels need not be discussed herein.

[0070] In some embodiments, the subject matter disclosed herein provides a kit comprising one or more of the following: one or more compounds of formula (I) or formula (II), one or more target nucleic acids, optionally one or more lipids PEG, and, if necessary, one or more reagents and instructions for use.

[0071] In some embodiments, the disclosed kit comprises one or more containers, including but not limited to vials, tubes, ampoules, bottles, etc., for containing a pharmaceutical composition comprising one or more compounds of formula (I) or formula (II). The compounds of formula (I) or formula (II) may be in solvated, suspension, or powder form and may then be reconstituted in a pharmaceutically acceptable carrier to deliver the pharmaceutical composition. One or more containers may also be carried within a suitable carrier, such as a box, carton, tube, or the like. Such containers may be made of plastic, glass, laminated paper, metal foil, or other materials suitable for containing pharmaceutical preparations.

[0072] In some embodiments, the container may contain the pharmaceutical composition and may have a sterile inlet (e.g., the container may be an intravenous solution bag or a vial with a stopper that can be punctured by a hypodermic needle). Optionally or additionally, the article may also include a second (or third) container containing a pharmaceutically acceptable buffer solution, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution, and dextran solution. It may also include other materials desirable from a commercial and user perspective, including additional buffers, diluents, filters, needles, and syringes.

[0073] (2) Design of target genes expressed as a treatment for specific eye diseases The following important target diseases for non-viral gene transfer on the choroid have been identified, including: (a) Staggart disease; (b) Usher syndrome; (c) neovascular AMD and other diseases that cause choroidal neovascularization; (d) diabetic retinopathy; (e) retinal vein occlusion; (f) retinitis pigmentosa; (g) Lieber congenital amaurosis; and (h) geographic atrophy.

[0074] Genes encoding nonviral polymer nanoparticles intended for ocular injection may include: ABCA4; MYO7A; USH1C; CDH23; PCDH15; SANS; CIB2; USH2A; GPR98; WHRN; CLRN1; TIMP3; PEDF; Prph2; BPDE; Bcl2; FGF-2; CNTF; Mertk; GUCY2D; AIPL1; RPGRIP; RPE65; LCA6; LCA10; genes encoding anti-VEGF proteins, endostatin, angiostatin and their protein-engineered mimics, antibodies and protein fragments; and genes encoding anti-complement proteins and their protein-engineered mimics, antibodies and protein fragments.

[0075] In some implementations, the DNA is selected from microcircular plasmid DNA, nanoparticle DNA, and blocked-end DNA.

[0076] In some embodiments, the DNA: (a) is substantially free of bacterial elements; (b) is about 1-4 kbp, including 1 kbp, 2 kbp, 3 kbp, and 4 kbp, excluding the said gene; and / or (c) is substantially free of unmethylated CpG sequences. As used herein, the term "substantially free" means less than 5%, including less than 4%, less than 3%, less than 2%, and preferably less than 1%, including less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, and less than 0.1%.

[0077] In some embodiments, the polymer to DNA mass ratio is between about 10:1 and about 50:1. In some embodiments, the polymer to DNA mass ratio has a range of about 15:1 to about 40:1, about 20:1 to about 30:1, about 20:1, about 25:1, and about 30:1.

[0078] In some embodiments, the DNA has a concentration ranging from about 0.1 mg / mL to about 2.0 mg / mL, from about 0.2 mg / mL to about 1.0 mg / mL, from about 0.2 mg / mL to about 0.5 mg / mL, and from about 0.3 mg / mL to about 0.4 mg / mL.

[0079] (3) Design of DNA vectors containing promoters / enhancers that drive expression (i) In some embodiments, small DNA vectors (including the Z1 plasmid) with a minimal backbone have been found to be preferred, wherein the number of base pairs in the backbone is between about 1 and 4 kbp rather than greater than 4 kbp. Other small-sized nucleic acid constructs, such as microcircular plasmids, are also effective for the methods disclosed herein. To facilitate this approach, PCR-based techniques have been developed for generating microcircular plasmids. Further reduction in plasmid size (including minimizing size and eliminating bacterial sequences) is also important.

[0080] (ii) The ubiquitous promoter exhibits better transfection efficiency than photoreceptor-specific promoters, and in some embodiments, the CAG promoter is the preferred leader promoter to be included in the DNA backbone. The 72-bp repeat of the SV40 enhancer also contributes to the efficient ocular transfection of the nanoparticles disclosed herein.

[0081] (iii) In some embodiments, the DNA includes a 72-bp region of the CAG promoter and the SV40 enhancer, specifically the sequence ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1). In a specific embodiment, the DNA comprises a nanoparticle containing a target gene driven by the CAG promoter and a single or repeating 72-bp region of the SV40 enhancer, wherein the DNA is substantially free of bacterial genetic elements and unmethylated CpG sequences.

[0082] (4) The design of excipients that can improve the transport, transfection and / or stability of formulations.

[0083] Sugars, such as sucrose and trehalose, enhance the stability of nanoparticle formulations for ocular injection. Other sugars, salts, buffers, transport polymers, and excipients can be used to improve the stability of nanoparticles during freeze-drying or lyophilization, and can also improve convective transport of formulations when injected via the choroid.

[0084] (5) Method of application, including the device for application. Currently, the method for gene replacement in eye diseases and conditions is subretinal injection of viral vectors. However, choroidal injection of non-viral vectors has the following advantages.

[0085] Subretinal injection of viral vectors causes photoreceptors to detach from the RPE, while choroidal injection of non-viral vectors does not cause this detachment. This characteristic is a major advantage of choroidal injection over subretinal injection, because separating the photoreceptor from the RPE can damage the photoreceptor, especially in eye conditions where the photoreceptor is already damaged.

[0086] Furthermore, unlike subretinal injections, which must be performed in the operating room as part of a procedure called vitrectomy, choroidal nonviral gene transfer can be performed on an outpatient basis. Vitrectomy causes cataracts in a high percentage of patients and carries a 1-2% risk of retinal detachment. Therefore, choroidal injections are safer, cheaper, and more convenient than subretinal injections.

[0087] Furthermore, the carrier diffuses more in the suprachoroidal space than in the subretinal space, allowing for the treatment of a larger portion of the retina with a single injection. This characteristic means that more photoreceptors can replace and salvage defective genes, which will translate into better visual outcomes.

[0088] Unlike viral vectors, which elicit an immune response and can only be administered once, non-viral gene transfer does not elicit an immune response and can be repeated. Therefore, if the initial response is insufficient, it can be enhanced through repeated injections.

[0089] Finally, the nanoparticles used for non-viral gene transfer have a much larger capacity than AAV vectors, thus allowing them to be used to replace larger genes or to incorporate multiple genes. This feature is particularly useful for replacing very large Staggart disease genes.

[0090] Therefore, suprachoroidal delivery of these nanoparticle formulations is superior to other ocular delivery routes. As used herein, the suprachoroidal space refers to the region between the sclera and the choroid. This region can expand after the composition is applied.

[0091] In some embodiments, intrachoroidal injection is performed using a dedicated insert tip, with or without an injection pump. The dedicated injection tip can be in the range of approximately 1–5 mm and can be approximately 25–35 G. Repeated intrachoroidal injection of the pBAE NP vector increases transgene expression and is part of the methods disclosed herein.

[0092] In some embodiments, the particulate composition is administered to the suprachoroidal space of the subject's eyeball via more than one injection at one or more injection sites.

[0093] In some embodiments, more than one injection is administered during a single treatment session. In certain embodiments, a single treatment session includes an outpatient visit. In some embodiments, the method also includes a waiting period between the more than one injection. In some embodiments, more than one injection is administered using an auto-injector or infusion pump.

[0094] The composition can be administered at different frequencies depending on the subject, disease, etc. For example, the composition can be administered 1 to 4 times daily at any suitable interval for a period of time, such as 1 to 10 years. The composition can also be administered at any suitable interval that allows for accurate analysis of the subject over a period of 1 day, 10 days, 1 month, 6 months, 12 months, 5 years, or 10 years. For example, the composition can be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, or 10 years, or more. Within the timeframe of performing this method, the steps of observing and / or quantifying the delivery of the therapeutic agent to the subject's eyeball can be performed any suitable number of times. For example, in an implementation plan where the method is carried out for at least 6 months, the steps of observing and / or quantifying the therapeutic agent can be performed once a day, twice a day, once every 2 days, once every 3 days, and so on.

[0095] In some embodiments, the method includes an application volume to the suprachoroidal space, which in some embodiments ranges from about 20 μL to 500 μL, in some embodiments from about 50 μL to 300 μL, and in some embodiments from about 50 μL to 100 μL.

[0096] As used herein, the term "treatment" can include reversing, alleviating, or inhibiting the progression of one or more symptoms or manifestations of a disease, disorder, or condition to which such term applies, or preventing or reducing the possibility of one or more symptoms or manifestations of a disease, disorder, or condition to which such term applies. Prevention refers to preventing the worsening of a disease, disorder, or condition, or the symptoms or manifestations of such a disease, disorder, or condition, or the severity of such a disease, disorder, or condition. Therefore, the compounds disclosed herein can be administered prophylactically to prevent or reduce the incidence or recurrence of a disease, disorder, or condition.

[0097] As used herein, the term “inhibition” and its grammatical derivatives refer to the ability of a compound disclosed herein (e.g., a composition of formula (I) or formula (II) disclosed herein) to block, partially block, interfere with, reduce, or alleviate the severity of a disease state. Therefore, those skilled in the art will understand that the term “inhibition” encompasses a complete and / or partial reduction in the severity of a disease state, such as a reduction of at least 10%, and in some embodiments, a reduction of at least 20%, 30%, 50%, 75%, 95%, 98%, and up to and including 100%.

[0098] The “subject” treated by the methods disclosed herein in many embodiments is intended to be a human subject, although it should be understood that the methods described herein are effective for all vertebrate species, and all vertebrate species are intended to be included in the term “subject.” Thus, “subject” can include human subjects for medical purposes, such as for the treatment of an existing condition or disease or for the preventative treatment of the onset of a condition or disease, or animal subjects for medical, veterinary, or developmental purposes. Suitable animal subjects include mammals, including but not limited to primates such as humans, monkeys, apes, etc.; bovines such as cattle, bulls, etc.; ovines such as sheep, etc.; caprines such as goats, etc.; porcines such as pigs, hogs, etc.; equines such as horses, donkeys, zebras, etc.; felines, including wildcats and domestic cats; canines, including dogs; rabbits, including domestic rabbits, hares, etc.; and rodents, including mice, rats, etc. The animal may be a genetically modified animal. In some implementations, the subject is a human, including but not limited to fetuses, newborns, infants, adolescents, and adult subjects. Furthermore, "subject" may include patients who have or are suspected of having a condition or disease. Therefore, the terms "subject" and "patient" are used interchangeably herein. The term "subject" also refers to an organism, tissue, cell, or collection of cells derived from the subject.

[0099] Generally, the “effective amount” of an active agent or drug delivery device refers to the amount required to elicit the desired biological response. As will be understood by those skilled in the art, the effective amount of an agent or device can vary depending on factors such as the desired biological endpoint, the agent to be delivered, the composition of the pharmaceutical composition, the target tissue, etc.

[0100] The term "combination" is used in its broadest sense and refers to the administration of at least two agents, more particularly compounds of formula (I) or formula (II) as described herein, and at least one other therapeutic agent, such as a protein-targeting modulator therapy. More specifically, the term "in combination" refers to the concomitant administration of two (or more) active agents for the treatment of, for example, a single disease state. As used herein, active agents may be combined and administered in a single dosage form, may be administered simultaneously as separate dosage forms, or may be administered as separate dosage forms administered alternately or sequentially on the same or separate dates. In one embodiment of the subject matter disclosed herein, the active agents are combined and administered in a single dosage form. In another embodiment, the active agents are administered in a separate dosage form (e.g., where it is desirable to change the amount of one rather than the other). The single dosage form may contain additional active agents for the treatment of the disease state.

[0101] Furthermore, the compositions described herein can be administered alone or in combination with adjuvants that enhance the stability of the composition, alone or in combination with one or more therapeutic agents, facilitate administration of pharmaceutical compositions containing them in some embodiments, provide increased solubility or dispersion, increase inhibitory activity, provide adjunctive therapy, etc., including other active ingredients. Advantageously, such combination therapies utilize lower doses of conventional therapeutic agents, thus avoiding the potential toxicity and adverse side effects that can occur when those agents are used as monotherapy.

[0102] The timing of administration of the composition of formula (I) or formula (II) described herein and at least one additional therapeutic agent may vary, as long as the beneficial effects of the combination of these agents are achieved. Therefore, the phrase "in combination with" means administering the composition of formula (I) or formula (II) described herein and at least one additional therapeutic agent simultaneously, sequentially, or in combination thereof. Thus, a subject receiving the combination of the composition of formula (I) or formula (II) described herein and at least one additional therapeutic agent may receive the composition of formula (I) or formula (II) described herein and at least one additional therapeutic agent simultaneously (i.e., concurrently) or at different times (i.e., sequentially, in any order, on the same day or on different days), as long as the combined effect of the two agents is achieved in the subject.

[0103] When administered sequentially, the agents may be administered over intervals of 1 minute, 5 minutes, 10 minutes, 30 minutes, 60 minutes, 120 minutes, 180 minutes, 240 minutes, or longer. In other embodiments, the agents administered sequentially may be administered over intervals of 1 day, 5 days, 10 days, 15 days, 20 days, or more. When the compositions of formula (I) or (II) described herein are administered simultaneously with at least one additional therapeutic agent, they may be administered to the subject as separate pharmaceutical compositions, each comprising a composition of formula (I) or (II) or at least one additional therapeutic agent, or they may be administered to the subject as a single pharmaceutical composition comprising both agents.

[0104] When administered in combination, the effective concentration of each of the agents that elicits a specific biological response can be lower than the effective concentration of each agent when administered alone, thus allowing for a reduction in the dose of one or more agents relative to the dose required if the agent were administered as a single agent. The effects of multiple agents can, but do not have to, be additive or synergistic. Agents can be administered multiple times.

[0105] In some embodiments, when administered in combination, two or more agents may have a synergistic effect. As used herein, the terms “synergistic,” “synergistic,” “synergistically,” and their derivatives, such as in “synergistic effect,” “synergistic combination,” or “synergistic composition,” refer to a situation where the combination of the composition of formula (I) or (II) described herein with at least one other therapeutic agent has a biological activity greater than the sum of the biological activities of the individual agents when administered alone.

[0106] Synergy can be expressed as the "synergy index (SI)," which is typically determined from the following ratios using the method described by FC Kull et al., Applied Microbiology 9, 538 (1961): Q a / Q A + Q b / Q B = Synergy Index (SI) in: Q A It is the concentration of component A acting alone, which produces an endpoint related to component A; Q a It represents the concentration of component A in the mixture, and its endpoint. Q B It is the concentration of component B acting alone, which produces endpoints related to component B; and Q b It represents the concentration of component B in the mixture, and its endpoint.

[0107] Typically, when Q a / Q A and Q b / Q B A sum greater than 1 indicates antagonism. A sum equal to 1 indicates additivity. A sum less than 1 indicates synergy. The lower the SI, the greater the synergistic effect exhibited by that particular mixture. Therefore, the activity of a “synergistic combination” is higher than that that could be expected based on the activity of a single component observed when used alone. Furthermore, the “synergistic effective amount” of a component refers to the amount of component necessary to induce a synergistic effect in another therapeutic agent present in, for example, the composition.

[0108] Throughout this specification and claims, the terms “comprise,” “comprises,” and “comprising” are used in a non-exclusive sense, unless the context requires otherwise. Similarly, the term “include” and its grammatical variations are intended to be non-restrictive, such that the listing of items does not exclude other similar items that may replace or be added to the listed items.

[0109] According to long-standing patent law practice, the terms “a,” “an,” and “the,” when used in this application including the claims, refer to “one or more.” Thus, for example, reference to “a subject” includes more than one subject, unless the context clearly indicates the opposite (e.g., more than one subject), etc.

[0110] For the purposes of this specification and the appended claims, unless otherwise indicated, all figures representing quantities, sizes, dimensions, proportions, shapes, formulations, parameters, percentages, quantities, properties, and other numerical values ​​used in the specification and claims shall in all cases be understood to be modified by the term “about,” even if the term “about” may not explicitly appear with the value, quantity, or range. Therefore, unless indicated to the contrary, the numerical parameters set forth in the following specification and the appended claims are not precise and need not be precise, but may be approximate and / or larger or smaller as desired, reflecting tolerances, conversion factors, rounding, measurement errors, and other factors known to those skilled in the art, depending on the desired nature sought from the subject matter disclosed herein. For example, when the term “about” refers to a value, it may be intended to cover variations of ±100% in some embodiments, ±50% in some embodiments, ±20% in some embodiments, ±10% in some embodiments, ±5% in some embodiments, ±1% in some embodiments, ±0.5% in some embodiments, and ±0.1% in some embodiments, because such variations are appropriate for carrying out the disclosed method or using the disclosed composition.

[0111] Furthermore, when the term “about” is used in conjunction with one or more numbers or ranges of values, it should be understood to refer to all such numbers, including all numbers within the range and modifications by extending the boundaries to ranges above and below the stated values. Describing a range of values ​​by endpoints includes all numbers falling within that range, such as all integers, including their fractions (e.g., a description of 1 to 5 includes 1, 2, 3, 4, and 5, and their fractions such as 1.5, 2.25, 3.75, 4.1, and similar fractions), and any range within that range.

[0112] Example The following examples have been included to provide guidance to those skilled in the art on representative embodiments for practicing the subject matter disclosed herein. Based on this disclosure and the general level of skill of those skilled in the art, it will be appreciated that the following examples are intended to be exemplary only, and many variations, modifications, and alterations can be made without departing from the scope of the subject matter disclosed herein. The subsequent comprehensive description and specific examples are intended for illustrative purposes only and should not be construed as limiting in any way to the preparation of the compounds of this disclosure by other methods.

[0113] Example 1 Gene transfer via non-viral nanoparticles in the choroid of the eyeballs of large animals 1.1 Introduction Nonviral gene therapy on the choroid using biodegradable poly(β-amino ester) nanoparticles (NPs) offers broad expression in photoreceptor and retinal pigment epithelium (RPE) cells and therapeutic benefits in rodents. In this example, we showed in human-sized miniature pig eyes that intrachoroidal injection of 50 μL of NP containing 19.2 μg of GFP expression plasmid induced GFP expression throughout the photoreceptors and RPE of the entire eye without toxicity. Expression varied considerably within and between the eyes two weeks after injections of 50, 100, or 200 μL, decreased three months after 200 μL injection, and significantly decreased after three intrachoroidal injections at different locations around the eye. A reduction in the bacterial CpG sequence in the expression plasmid led to a trend toward higher expression. These data suggest that nonviral gene therapy on the choroid using optimized polymers, expression plasmids, and injection methods has the potential to treat photoreceptors throughout the entire retina of human-sized eyes.

[0114] 1.2 Introduction Significant progress has been made in ocular gene therapy using adeno-associated virus (AAV) vectors. Subretinal injection expression... Rpe65 The AAV2 vector due to Rpe65 Biallelic mutations have improved activity in certain patients with retinal degeneration (Russell et al., 2017), leading to FDA approval of voretigene Neparvovec-rzyl. However, since that approval, some patients treated with subretinal injections of voretigene Neparvovec-rzyl have developed perifoveal choroidal atrophy (Gange et al., 2022). The mechanism of this toxicity is unclear, but the delayed onset and nature of the changes suggest the possibility of a late immune response. While it is necessary to continue investigating the long-term benefits and risks of viral ocular gene transfer and to find ways to minimize the risks, it is prudent to develop non-viral ocular gene transfer methods.

[0115] Poly(β-amino esters) (PBAEs) with primary, secondary, and tertiary amines and ester bonds can compress expression plasmid DNA into nanoparticles (NPs) that enter cells via endocytosis (Green et al., 2007), and are hydrolyzable. Large numbers of NPs escape from the endosome and degrade within minutes to hours, allowing the expression plasmid to enter the nucleus and initiate transgene expression (Sunshine et al., 2012; Guerrero-Cazares et al., 2014; Rui et al., 2022). The relatively rapid degradation of novel biocompatible gene delivery materials is particularly important for retinal gene therapy, as recent studies have highlighted the potential toxicity issues of conventional materials (e.g., lipid nanoparticles) used in the retina (Herrerra-Barrera et al., 2023; Drag et al., 2023). Choroidal injection of PBAE NPs containing a GFP expression plasmid resulted in widespread expression of GFP in rat photoreceptor and retinal pigment epithelium (RPE) cells (Shen et al., 2020); however, it is important to know the extent and level of GFP expression following choroidal injection of PBAE NPs in eyes that are more similar in size to human eyes and may have more significant transport restrictions. Miniature pig eyes were chosen for the experiments presented in this example because, in addition to being more similar in size to human eyes, the miniature pig retina is similar to the human retina in that it is avascular and has a central region with high-density cone photoreceptors similar to the macula of primates (Vrolyk et al., 2020).

[0116] 1.3. Results 1.3.1 Characterization of Nanoparticles (NPs) The properties of the NPs were evaluated after fabrication, lyophilization, storage at -20°C, and resuspending in sterile water. Evaluation of the NP size and surface charge revealed a z-mean hydrodynamic diameter of 443 nm and a zeta potential of +29.4 mV. Figure 1 A). Transmission electron microscopy (TEM) revealed that the electrostatically formed polymeric composite NP had a spherical morphology, and the dry particle size was similar to the hydrated particle size. Figure 1 B). Gel electrophoresis studies showed that NPs completely bind to DNA and encapsulate DNA within NPs ( Figure 1 C). The size of these electrostatically formed NPs and the complete encapsulation of DNA plasmids allow for a high DNA load per particle, calculated as an average of 250 ± 20 kbp DNA, or 80 ± 5 3151 bp plasmids, encapsulated in each particle. Figure 15 This could be beneficial for in vivo gene therapy. Dynamic light scattering (DLS), TEM, and NP tracking analysis (NTA) were used to analyze these parameters. Figure 15 The measured particle size variation is due to the polydispersity of the particle population; while most particles (counted by TEM and NTA as the number mean) are relatively small (<200 nm), less common larger particles deviate from the z-mean calculated by DLS via intensity-averaged size.

[0117] 1.3.2 Retinal appearance after choroidal injection of PBAE NP containing GFP expression plasmid The experiment was conducted in Göttingen and Yucatan miniature pigs. Fundus photographs were taken before and after PBAE NP injection into the choroid. Representative before and after fundus photographs of Göttingen and Yucatan miniature pigs are shown below. Figure 13 Indirect ophthalmoscopy was performed before and after injection, at baseline, and before euthanasia, to examine the entire retina. No visible changes in the retina were observed on fundus photographs or by indirect ophthalmoscopy two or twelve weeks after choroidal injection.

[0118] 1.3.3 Injection of PBAE NP containing pCAG-GFP-Z1 expression plasmid into the choroid of miniature pig eyes followed by GFP expression Distribution of expressions In a previously reported experiment, Shen et al., 2020, used a commercially available 4733-bp GFP expression plasmid p EGFP-N1 Perform intrachoroidal injection, among which CMV The promoter drives GFP expression. In this embodiment, 4021-bp p CAG-GFP-Z1 By using CAG Promoter replacement CMV The promoter is removed and foreign bacterial sequences are excised, but those sequences that are allowed to reproduce and be selected in the bacteria are retained for generation.

[0119] 50 μL of PBAE NP containing 19.2 μg was injected into the choroid 4.5 mm posterior to the limbus. pCAG-GFP- Z1 Two weeks after DNA analysis, miniature pig eyeballs were fixed, subjected to a sucrose gradient treatment, and frozen in embedding medium. Starting from the anterior end of the eyecup, 35µm transverse sections were cut as far back as possible. The section with the largest diameter passing through the equator was identified, and then the distances anterior or posterior to the equator for all other sections were determined. Figure 2 A). Figure 2 B shows fluorescence microscopy of sections at the equator, as well as sections 2.87 mm anterior to the equator and 8.12 mm posterior to the equator. Fluorescence extends around the entire circumference of the eyeball at each of the three locations. Higher magnification of the equatorial sections stained with anti-GFP antibody immunohistochemically shows that the fluorescence is due to GFP expression primarily in the inner and outer segments of the photoreceptors. Figure 2 C). This observation indicates that a single injection of 50 μL containing 19.2 μg p into the anterior choroid can reduce the risk of infection. CAG-GFP-Z1Two weeks after PBAE NP, GFP expression occurred in photoreceptors throughout the entire circumference of the eyeball and extended to the far posterior region as determined by this technique. These sections stained with hematoxylin and eosin showed a normal retina without inflammatory cells. Figure 13 E and Figure 13 F).

[0120] 1.3.4 Effects of increasing volume / dose and / or time after NP injection The eyeball is a closed compartment, and any fluid injected into it causes a momentary increase in intraocular pressure. This pressure normalizes as the aqueous humor flows out through the eye's outflow pathways. In humans, the most common volume of medication injected into the vitreous cavity or suprachoroidal space is 50 μL, but most patients can tolerate injections of up to 100 μL unless outflow patency is restricted by glaucoma. Even larger volumes can be injected if the injection rate is very slow without raising the intraocular pressure above the infusion pressure.

[0121] Similar to previous experiments, 50 μL of a solution containing 19.2 μg p was injected into the choroid. CAG-GFP-Z1 Two weeks after PBAE NP, GFP fluorescence was observed around the entire circumference of the eyeball in all transverse sections up to 7–9 mm posterior to the equator. This is approximately the limit for obtaining completely circular sections due to technical limitations. Figure 3 A and Figure 3 B). Injecting 100 μL containing 38.4 μgp CAG-GFP-Z1 NP ( Figure 3 C and Figure 3 D) or 200 μL containing 76.8 μg p CAG-GFP-Z1 NP ( Figure 3 E and Figure 3 Two weeks after F), GFP expression was also widely distributed. Because fluorescence microscopy is very sensitive but not quantitative, these experiments could not determine whether there were differences in GFP expression levels after injection of different volumes of NP.

[0122] To quantify and better localize expression, GFP protein levels were measured in the retina and RPE / choroid at several locations throughout the eye using enzyme-linked immunosorbent assay (ELISA). Circular punches were collected from the retina and RPE / choroid at the following seven locations using a 7.0-mm trephine: (1) posterior nasal, (2) posterior temporal, (3) temporal, (4) superior nasal, (5) superior temporal, (6) inferior nasal, and (7) inferior temporal. Figure 14 A and Figure 14 B). Before the trephine, a translucent retina is seen covering the darkly tinted RPE ( Figure 14C). After removing the retinal sample, the darkly stained RPE is more clearly visible within the circle where the retina has been removed. Figure 14 D). After removing the RPE / choroid sample, the sclera is seen in the circle ( Figure 14 E and Figure 14 F). GFP protein / mg total protein in each sample was measured using ELISA.

[0123] Figure 4 A- Figure 4 C showed that 50 μL containing 19.2 μg p was injected into the choroid. CAG-GFP-Z1 Two weeks after PBAE NP, GFP protein / mg total protein was measured at each of seven retinal sites in three eyes. Injections were performed at the anterior 11:00 or 12:00 meridian, 4.5 mm posterior to the limbus. GFP expression was measured at all retinal sites except for one site in one eye. Expression levels were not consistently higher in the retinal region closest to the injection site, and in one eye, significantly higher levels were observed in the retinal region furthest from the injection site. Figure 4 B). There is no consistent pattern regarding the differences in GFP expression at different locations within the eye or between different eyes, but detectable expression was observed in all parts of the retina after a single choroidal injection.

[0124] Graphical display of each data point for each eye provides a better indication of intraocular and interocular variability in regional GFP levels. Figure 4 (D) In ​​both eyes, eyes 1–2 weeks and eyes 3–2 weeks, the mean (13.6– and 13.7– pg / mg protein) and range of the seven measurements were similar, although there was a lack of correlation between values ​​from eyes at the same location. Compared to these two eyes, the third eye, eyes 2–2 weeks, showed a mean GFP protein level (126.1– pg / mg protein) that was more than 9-fold higher and a wider range of values.

[0125] 50 μL PBAE NP (19.2 µg p) was injected into the choroid. CAG-GFP-Z1 The GFP protein levels observed two weeks after injection were comparable to those observed 12 weeks after injection. Figure 5 A). Generally, there is a correlation between GFP levels in the retina and GFP levels in the RPE / choroid, because eyeballs with higher expression levels in the retina tend to have higher expression levels in the RPE / choroid. Figure 5 A and Figure 5 B). Figure 5 C shows that 100 μL contains 38.4 μg. pCAG- GFP-Z1The levels of GFP protein in seven retinal locations were measured at two weeks (three eyes) or twelve weeks (two eyes) after PBAE NP. These data were compared with… Figure 5 Comparison of data in A shows that doubling the volume and dose of the vector did not lead to significant differences in retinal GFP protein levels, but high levels were observed at some locations in the RPE / choroid in two of the three eyes. Figure 5 D). At this dose, GFP protein levels were similar at 2 and 12 weeks post-injection for both the retina and RPE / choroid. Compared to the lower dose, an injection of 200 μL containing 76.8 μg of GFP into the choroid resulted in similar levels. pCAG-GFP-Z1 Two weeks after PBAE NP, GFP protein levels showed no significant increase, but 12 weeks after injection, GFP levels were high at all sites in the retina and RPE / choroid. Figure 5 E and Figure 5 F). Two weeks after injection of 200 μL PBAE NP versus twelve weeks, the mean GFP levels at all retinal sites were 37.0 versus 284.4 pg / mg protein (p=0.07 according to a linear mixed-effects model), and the RPE / choroidal comparison was 96.7 versus 879.5 pg / mg protein (p<0.0001).

[0126] 1.3.5 The role of minimizing bacterial sequences and CpG repeats in expression plasmids Bacterial sequences in expression plasmids, especially unmethylated ones CpG The presence of motifs increases the likelihood of an immune response (Häcker et al., 2002; Kinman et al., 2002; Reyes-Sandoval and Ertl, 2004; Talati et al., 2008; Hyde et al., 2008). Therefore, we contracted with commercial vendors (Aldevron, Fargo, ND) to minimize CpG motifs and pCAG-GFP-Z1 Other bacterial sequences in the genome. This modification produces a 3322-bp plasmid ( pCAG-GFP-nP ). Inject 50 μL containing 19.2 μg into the choroid. pCAG-GFP-nP Two weeks after PBAE NP, transverse sections showed GFP fluorescence around the entire circumference of the eyeball surrounding the anterior equatorial region. Figure 6 A), and high magnification revealed GFP expression in cells of the inner retina and photoreceptors. Figure 6 B). Immunohistochemical staining for GFP showed that fluorescence in both the inner and outer retina was due to GFP expression rather than autofluorescence. Figure 16 Slices located far behind the equator also showed GFP fluorescence around the entire circumference of the eyeball. Figure 6C), and high magnification showed that GFP is mainly expressed in photoreceptors, but also in some cells of the inner retina. Figure 6 D). A trend toward higher GFP protein levels was observed in the retina and RPE / choroid, but the differences were not statistically significant due to significant variability. Figure 6 E and Figure 6 F).

[0127] 1.3.6 Effect of multiple 50 μL choroidal injections of PBAE NP containing 19.2 μg pCAG-GFP-nP The test showed that a single upper injection of 50 μL contained 19.2 μg. pCAG-GFP-nP The levels of GFP protein at each retinal location sampled two weeks after PBAE NP showed considerable regional variability within each of the three eyes and between eyes. Figure 7 A), and the same applies to RPE / choroid. Figure 7 B). To test whether the uneven diffusion of PBAE NPs in the suprachoroidal space might contribute to this variability in GFP expression, three injections were performed at different locations around the three eyes. 50 μL contained 19.2 μg of PBAE NPs. pCAG-GFP-nP The PBAE NP was administered in three injections: one superiorly, one temporally, and one inferiorly, all 4.5 mm posterior to the limbus, with approximately 5 minutes between injections. Two weeks after the injections, retinal ( Figure 7 C) and RPE / choroid ( Figure 7 High levels of GFP protein were present at all sampling sites in D), indicating reduced intraocular variability. The retina of the three eyes that received a single injection compared to the three eyes that received three injections (…) Figure 7 E) and RPE / choroid ( Figure 7 Dot plots of all 21 measurements in F) showed a significant decrease in the coefficient of variation of GFP protein levels in the retina and RPE / choroid after three injections, indicating a significant reduction in interocular and intraocular variability. The mean GFP protein level tended to be higher after three injections, but the difference was not statistically significant. At any dose evaluated, in these eyes or with pCAG-GFP-Z1 NP or pCAG-GFP-nP No toxicity was observed in any of the eyes treated with NP.

[0128] 1.4 Discussion There are many inherited retinal degenerations that lead to substantial visual impairment. Many of these degenerations are caused by loss-of-function mutations in genes crucial for photoreceptor function and survival. If initiated early in the disease, gene therapy that replaces or adds the defective protein has the potential to cure these blinding conditions. The most common strategy is subretinal injection of an AAV vector expressing the desired protein. Subretinal injection causes the photoreceptor to detach from the RPE via a fluid containing the vector, resulting in small retinal detachments called bubbles. The advantage of this approach is that it provides a high concentration of the vector close to the photoreceptor and RPE, resulting in good transfection efficiency and high expression of the therapeutic protein.

[0129] However, a drawback of this approach is that the gene is barely expressed in the rest of the retina, and unless a large injection volume is injected, resulting in a large bulla covering a large area of ​​the retina, much of the retina remains untreated. This is a major problem because it means the genetic defect is not corrected in the rod cells that cover a large area of ​​the retina, and those rod cells are destined to degenerate. When a sufficient number of rod cells degenerate, oxygen utilization decreases and oxygen levels increase, Yu et al., 2000; Yu et al., 2004, leading to oxidative damage to the remaining rod and cone cells, causing gradual, progressive degeneration of the remaining retina. She et al., 2005; Komeima et al., 2006; Komeima et al., 2007; Cideciyan et al., 2013; Jacobson et al., 2015. Therefore, gene replacement should be performed as early as possible before widespread rod degeneration occurs and should target as many rods as possible.

[0130] Another potential drawback of this approach is that detachment of photoreceptors from the RPE may damage them. While photoreceptor recovery is possible, it may be incomplete, potentially leading to permanent vision loss due to foveal involvement. A third issue is the continued uncertainty regarding how the immune system responds to AAV-transfected cells. Initial inflammation may occur after ocular gene therapy with AAV vectors, varying depending on the route of administration, and is generally mild and manageable after subretinal injection. More concerning are signs of a possible late immune response that could cause retinal damage in some patients. For example, some patients treated with subretinal injection of voretigene Neparvovec-rzyl (an AAV2 vector expressing RPE65) have developed progressive perifoveal choroidal retinal atrophy (Gange et al., 2022), which may be a late immune response to viral antigen presentation by transfected retinal neurons.

[0131] Choroidal intraocular gene therapy using PBAE polymer NP has the potential to address the aforementioned problems. We previously showed that injection of 3 μL of PBAE NP containing 1 μg of GFP expression plasmid into the choroid of rats resulted in GFP expression in photoreceptors throughout the retina and in adjacent RPEs (Shen et al., 2020). In this example, we have demonstrated that injection of 50 μL of PBAE NP containing 19.2 μg of GFP expression plasmid into the choroid resulted in widespread GFP expression in photoreceptors and RPEs in the eyes of miniature pigs. Cross-sections extending as far posteriorly as possible showed that GFP expression was detectable in photoreceptors and RPEs throughout the entire circumference of the eyeball, even in the most posterior sections. Quantitative analysis was performed by measuring GFP protein levels in retinal and RPE / choroidal samples obtained from seven locations across the entire eye cup using ELISA. This analysis confirmed that a single injection of 19.2 μg of PBAE NP into the anterior choroid resulted in GFP expression. pCAG-GFP-Z1 Following PBAE NP, GFP protein was detectable in all parts of the retina, but with considerable regional variability. Variables were observed in the RPE / choroid, where GFP levels were low in most locations of most eyeballs, but higher in some locations. Generally, eyeballs with higher GFP levels at some locations in the RPE / choroid also tend to have higher GFP levels at some locations in the retina.

[0132] To avoid being bound by any particular theory, it is believed that increasing the volume (which would also increase the amount of plasmid / transgenic copy injected) would further expand the suprachoroidal space and allow for more uniform diffusion and more uniform and higher GFP expression. Two weeks after injecting a higher volume of NP, high intraocular and interocular variability remained, making it difficult to assess the effect of increasing the dose. Injections of 50 μL or 100 μL containing 19.2 μg or 38.4 μg... pCAG-GFP-Z1 GFP expression was similar at two and twelve weeks after PBAE NP. , However, the injection contained 76.8 μg in 200 μL. pCAG-GFP-Z1 Between 2 and 12 weeks after PBAE NP, there was a statistically significant increase in RPE / choroid and a trend toward increasing expression in the retina. This observation suggests that peak expression following higher doses of the carrier occurred sometime after two weeks.

[0133] The bacterial sequence in the expression plasmid was reduced and evaluated. CpG Can the sequence increase GFP expression? This is determined after injecting a plasmid containing the modification. pCAG-GFP-nP Two weeks after PBAE NP relative to the parent plasmid, an increasing trend of GFP levels was observed in the retina and RPE / choroid. Figure 5However, due to variability within and between the eyeballs, the differences were not statistically significant. Although increasing the injection volume failed to reduce the variability in expression, it is believed that inconsistent diffusion of the carrier in the suprachoroidal space may still be the cause of variability, and this could be overcome by multiple injections at different locations around the eyeball.

[0134] Therefore, 50 μL containing 19.2 μg was injected into the choroid. pCAG-GFP-nP PBAE NPs were administered superiorly, temporally, and inferiorly (poor nasal exposure in pigs prevented injection on the side of the eye). Two weeks after triple injection, the coefficient of variation was significantly lower than after a single injection, indicating a significant reduction in intraocular and interocular variability. This observation confirms that uneven diffusion of the vector in the suprachoroidal space is the cause of variable expression throughout and between the eyeballs after a single injection. No signs of toxicity were observed after administration of biodegradable PBAE NPs, suggesting that this method can be a safe, nonviral approach for ocular gene transfer. Anatomical differences between eyeballs and technical differences regarding injection (e.g., needle depth and orientation, and injection rate) may contribute to uneven diffusion of the vector in the suprachoroidal space.

[0135] Compared to experiments involving choroidal injection in a large number of rodents during a single treatment (providing a large number of experiments), choroidal injection in pigs requires general anesthesia and a large number of researchers, and only a maximum of three pigs can be injected per treatment. These requirements significantly reduce the number of experiments, making statistical comparisons difficult. Despite these challenges, the study described in this embodiment provides a good indication of the optimal dosage of PBAE NP and the choroidal injection technique required to achieve good reporter gene expression throughout the retina and RPE / choroid in a human-sized eye. These results provide a foundation for initiating therapeutic transgenic expression studies in miniature pigs and provide further evidence for the feasibility of using non-viral gene transfer to treat hereditary retinal degeneration.

[0136] 1.5 Materials and Methods 1.5.1 Experimental Design This study was designed to optimize the level and distribution of GFP expression in the retina and RPE / choroid after injecting PBAE NP containing the GFP expression plasmid into the choroid. Expression levels were quantified by ELISA using samples collected from the entire eye. The effects of increasing the plasmid dosage were planned to be tested by increasing the injection volume and performing repeated injections. The experiments aimed to assess the stability of expression over time between 2 and 12 weeks post-injection and to evaluate the effect of reducing bacterial sequences in the expression plasmid.

[0137] 1.5.3 Polymer Synthesis 1,4-Butanediol diacrylate (B4), 5-amino-1-pentanol (S5), and 1-(3-aminopropyl)-4-methylpiperazine (E7) were purchased from Alfar Aesar (Ward Hill, MA). The PBAE polymer was synthesized via a two-step reaction. First, the acrylate-terminated base polymer (B4S5) was synthesized by a Michael addition reaction of 1,4-butanediol diacrylate (B4) and 5-amino-1-pentanol (S5) at a 1.1:1 acrylate:amine monomer molar ratio in the dark at 90°C for 24 hours with magnetic stirring. In the second step, the acrylate-terminated base polymer was capped by another Michael addition reaction in the presence of an excess of the primary amine-containing small molecule 1-(3-aminopropyl)-4-methylpiperazine (E7). Briefly, 200 mg / mL of the polymer was mixed with 0.5 M E7 in anhydrous tetrahydrofuran (THF) at room temperature for 2 hours. The final polymer (B4S5E7 or 457) was purified by precipitation into diethyl ether and stored in anhydrous DMSO at -20°C with a desiccant at 100 mg / mL until use. The polymer molecular weight was evaluated relative to polystyrene standards by gel permeation chromatography (Agilent, Savage, MD), with number-average and weight-average molecular weights of 8610 and 43,500 g / mol, respectively.

[0138] 1.5.4 Plasmid Preparation pEGFP-N1 was obtained from Takara Bio USA, Inc. (Mountain View, CA). pCAG-eGFP-Z1 was prepared to minimize the total plasmid length and eliminate unwanted sequences from the parent plasmid construct. First, a linear DNA fragment containing a multiple cloning site, a bacterial bleomycin resistance gene, and a bacterial origin of replication was synthesized by Twist Bioscience (South San Francisco, CA), with EcoRI sites at the 5' and 3' ends (1397 bp). The linear DNA fragment was then digested with EcoRI and ligated to form an empty plasmid (1391 bp) containing a multiple cloning site, a bacterial bleomycin resistance gene, and the pUC bacterial origin of replication. The SV40 polyadenylated sequence was introduced from pUNO1-m41BBL (Invivogen, San Diego, CA) using a 5' / 3' enzyme pair of NheI and EcoRI. The CAG promoter sequence (1726 bp) was introduced from pPB-CAG-GFPd2 (Addgene115665) using SpeI and KpnI 5' and 3' restriction enzyme clones. eGFP was then introduced from eGFP-N1 using AgeI and XbaI restriction enzyme pairs at 5' / 3'. All restriction enzymes were purchased from New England Biolabs, Ipswich, MA. GFP expression nanoparticles with most of the bacterial and CpG sequences removed were then processed. pCAG-GFP-nP Purchased from Aldevron (Fargo, ND).

[0139] 1.5.5 nanoparticle formulation Through positively charged PBAE polymers and negatively charged expression plasmids ( pCAG-GFP-Z1 and pCAG-GFP- nP Electrostatic binding of 457 PBAE polymer in DMSO and pDNA in water were used to prepare NPs carrying pDNA, as previously described (Shen et al., 2020). Briefly, 100 mg / mL of 457 PBAE polymer in DMSO and pDNA in water were diluted to 5.05 mg / mL and 0.31 mg / mL, respectively, with 25 mM sodium acetate at pH 5 (NaAc). The polymer and pDNA solutions were then mixed at a 3:2 v / v ratio (polymer to DNA ratio 25 w / w) and incubated for 10 minutes to allow particle recombination. For lyophilization of the NPs, the final NP solution was mixed with sucrose as a cryoprotectant to a final concentration of 30 mg / mL, aliquoted, and lyophilized. The lyophilized NPs were stored at -20°C with a desiccant until use. Just before injection, the lyophilized NPs were reconstituted with sterile water to a final sucrose concentration of 100 mg / mL.

[0140] 1.5.6 Characterization of Nanoparticles The lyophilized NPs were resuspended in sterile water to a final concentration of 0.38 μg / μL, and 20 μL of NPs were diluted in 1 mL of 0.1 × phosphate-buffered saline (PBS). Particle size (hydrodynamic diameter) was assessed by DLS using a Malvern Zetasizer Pro (Malvern Panalytical, Malvern, UK). Surface charge (zeta potential) was assessed by electrophoretic mobility using a Malvern Zetasizer Pro. Size and surface charge were repeatedly assessed for n=3 individually prepared NPs. Number-weighted size distribution was also measured by NTA using a NanoSight NS300 (Malvern Panalytical) after each of the three individually prepared particle batches was diluted 500-fold in 1 × PBS. The number of plasmids per particle was calculated by NTA as previously described. (Bhise et al., 2012.)

[0141] To evaluate morphology and confirm NP size, samples were imaged using a Hitachi 7600 TEM (Hitachi High-Tech, Tokyo, Japan). Lyophilized particles were resuspended in water to a DNA concentration of 0.38 μg / μL. The samples were further diluted to a concentration of 0.001 μg / μL, transferred to a 400-mesh copper grid (Electron Microscopy Sciences, Hatfield, PA), and allowed to dry for 4 hours. Subsequently, a 1% uranium acetate solution (Electron Microscopy Sciences, Hatfield, PA) was added to the copper grid. The grid was then washed with deionized water, dried overnight, and imaged by TEM.

[0142] To assess NP DNA binding, DNA NPs and naked DNA were loaded into 1% agarose gels containing ethidium bromide (1 μg / mL; 250 ng per lane) and imaged after electrophoresis.

[0143] 1.5.7 Laboratory Animals Ten 3-4 month old Göttingen miniature pigs (Marshall Bio Resources, North Rose, NY) and fifteen 3-4 month old Yucatan miniature pigs (Sinclair Bio Resources, Auxvasse, MO) were treated according to the Association for Research in Vision and Ophthalmology Statement for Use of Animals in Ophthalmic and Vision Research, and the protocols were reviewed and approved by the Johns Hopkins University Animal Care and Use Committee. The miniature pigs were anesthetized using the following combinations: (1) ketamine hydrochloride (11-33 mg / kg, IM) for sedation; (2) butorphanol 0.2 mg / kg + midazolam 0.5 mg / kg + acepromazine 0.2 mg / kg, IM; (3) ketamine 20-30 mg / kg + toluidine 2-3 mg / kg, IM, followed by reversal with yohimbine 0.11 mg / kg, IM or IV. In all cases, the pigs were fasted overnight prior to anesthesia. Anesthesia was maintained by inhalation of 0.5% to 2.5% isoflurane and 100% O2. Heart rate and O2 saturation were monitored during anesthesia using pulse oximetry. After sedation, the eyeballs were disinfected with one drop of povidone-iodine solution USP, 10% (Ricca Chemical Company, Arlington, TX) and anesthetized with one drop of promethacin hydrochloride ophthalmic solution USP 0.5% (Bausch & Lomb, Bridgewater, NJ). Fundus images were taken before and after the choroidal injection. The pupils were dilated with 1% tropicamide (Alcon Labs, Inc., Fort Worth, TX) and 2.5% phenylephrine hydrochloride (Paragon BioTeck, Portland, OR), and both eyes received one drop of hydroxypropyl methylcellulose solution GenTeal (Alcon, Fort Worth, TX). The lens of a RetCam3 fundus camera (Natus, Middleton, WI) was gently brought into contact with the cornea, and the fundus was photographed before and after the injection. Following the injection into the choroid, a small amount of the triple antibiotic ointment bacitracin (First Aid Research Corp., Jupiter, FL) was applied to lubricate the eye until the pig awoke and to minimize the possibility of infection.At the end of the experiment, the patients were euthanized by administering an overdose of pentobarbital (150 mg / kg IV - Euthasol 390 mg / mL, Virbac, Westlake, TX).

[0144] 1.5.8 NP intrachoroidal injection Injection was performed under aseptic conditions using sterile instruments. Miniature pigs were anesthetized and topically treated with 0.5% promecaine and 5% povidone-iodine eye drops (see the Laboratory Animals section for details on anesthesia). A sterile speculum was placed to keep the eyelids open. The retina was examined using a handheld RetCam fundus camera, and fundus photographs were taken before injection. The eyeball was examined using a surgical microscope (Zeiss, Oberkochen, Germany), and the conjunctiva was incised to expose the sclera near the limbus. A sloping, partial-thickness scleral channel was created 4.5 mm posterior to the limbus using a 30-gauge needle attached to a 1-mL syringe, and then a blunt-tipped needle connected to a Hamilton syringe (Hamilton, Reno, NV) was used to enter the suprachoroidal space. For 50-μL or 100-μL injections, use a 100-μL Hamilton #710 syringe with a 34-gauge 45° beveled blunt needle. For 200-μL injections, use a Hamilton #1725 syringe and a 33-gauge / 11-mm needle (PRE-33013 Acuderm, Inc, FL). Before the 200-μL injection, use eye massage to lower intraocular pressure, and the injection should be performed very slowly. After the injection, keep a cotton swab on the injection site for approximately 60 seconds before removing the needle. Take a fundus photograph with a RetCam after the injection, and examine the entire retina with an indirect ophthalmoscopy.

[0145] 1.5.9 Histology and Immunohistochemistry After removal, the eyeballs of miniature pigs were fixed in 10% formalin at room temperature for 4–6 hours. The cornea was removed, and the eyeballs were filled with 10% formalin and fixed overnight at 4°C. The anterior segment was removed under a dissecting microscope, and the vitreous cavity was flushed with 10% formalin using a 23-gauge needle to allow fixative insertion into the vitreous. The eyecups were then incubated in 10% formalin at 4°C for 12 hours, followed by incubation in PBS containing 15% sucrose for 12 hours, and then incubation in PBS containing 30% sucrose for 12 hours. Under a dissecting microscope, PBS was injected through a 20-gauge needle to gently dissect and remove the remaining vitreous. The eyecups were then filled with OCT embedding medium and placed overnight at -80°C. Cross-sections of 35 μm were cut from the anterior edge of the eyecup posteriorly.

[0146] The slides were dried and examined using a Zeiss fluorescence microscope. Due to the large size of the slides, the entire circumference of the eyeball could not be obtained in a single image. Therefore, overlapping images were taken around the entire circumference and merged using Photoshop's Photomerge function or ImageJ (imagej.nih.gov / ij / download.html). Some slides were immunohistochemically stained for GFP. Nonspecific binding was blocked by incubation at 25°C in 8% normal rabbit serum for 30 minutes. The slides were incubated at 23°C for 2 hours with a polyclonal antibody (1:300) against EGFP conjugated to Alexa-594 (A-21312, ThermoFisher, Waltham, MA). After washing with PBS containing 0.05% Tween-20, the slides were counterstained with Hoechst 33258 (861405, Sigma, St. Louis, MO) and examined by fluorescence microscopy.

[0147] 1.5.10 Measure GFP protein levels by ELISA After removal, the eyeball was held on ice and the anterior segment and vitreous body were removed under a dissecting microscope. Circular punches were made in the retina at seven locations using a 7.0-mm corneal trephine. Figure 14 Then, a trephine was used to dissect deeper and obtain circular RPE / choroid samples from the same seven locations. The retinal and choroid / RPE samples were placed in 300 μL of phosphate-buffered saline (PBS) containing a protease inhibitor mixture (11836170001, Roche, Mannheim, Germany) and sonicated for 5 seconds. The samples were centrifuged at 14,000 rpm for 15 minutes and protein concentration was determined by CCB-G250 binding assay (#5000006, Bio-Rad, Hercules, CA) using BSA as a standard. GFP protein levels were measured using the GFP SimpleStep ELISA kit (ab171581, Abcam, Cambridge, MA). In short, 50 μL of sample or GFP standard dilution was added to two replicate wells of a 96-well plate, followed by 50 μL of a mixture of GFP capture antibody and GFP detection antibody. The plates were incubated at 23°C for 1 hour and washed five times with rinsing buffer. After adding 100 μL of 3,3',5,5'-tetramethylbenzidine (TMB) substrate solution, they were incubated at 23°C in the dark for 10 minutes. After adding 100 μL of stop solution, the absorbance was measured at 450 nm using a SpectraMax Plus 384 microplate reader.

[0148] 1.5.11 Data Analysis and Statistics Statistical comparisons of treatment effects in each experiment were determined using a general linear mixture model, and plots were generated using GraphPadPrism® software v.5.0. When modeling relevant structures, it was assumed that all measurements from any one eye of the pig were commutative and subjected to non-error variability. A p-value less than 0.05 was considered significant.

[0149] References All publications, patent applications, patents, and other references mentioned in this specification indicate the level of skill of a person skilled in the art to which the subject matter disclosed herein pertains. All publications, patent applications, patents, and other references are incorporated herein by reference to the same extent that each individual publication, patent application, patent, and other reference is specifically and individually indicated to be incorporated by reference. It should be understood that although many patent applications, patents, and other references are mentioned herein, such references do not constitute an acknowledgment that any of these documents constitute part of the common general knowledge in the art. In the event of any conflict between this specification and any incorporated references, this specification (including any modifications thereof, which may be based on the incorporated references) shall prevail. The standard, field-recognized meanings of terms used herein are used unless otherwise indicated. Standard abbreviations for various terms are used herein.

[0150] Campochiaro, PA; Lauer, AK; Sohn, EH; Mir, TA; Naylor, S.; Anderton, MC; Kelleher, M.; Harrop, R.; Ellis, S.; Mitrophanous, K. Hum. Gene Ther. 2016, 28, (1), 99-111. Vandenberghe, LH; Bell, P.; Maguire, AM; Cearley, CN; Xiao, R.; Calcedo, R.; Wang, L.; Castle, MJ; Maguire, AC; Grant, R.; Wolfe, JH; Wilson, JM; Bennett, J. Sci. Trans. Med. 2011, 3, (88), 1-9. Heier, JS; Kherani, S.; Desai, S.; Dugel, P.; Kaushal, S.; Cheng,SH; Delancono, C.; Purvis, A.; Richards, S.; Le-Halpere, A.; Connelly, J.;Wadsworth, SC; Varona, R.; Buggage, R.; Scaria, A.; Campochiaro, PA The Lancet 2017, 389, May 17. water: S0140-6736(17)30979-0. doi: 10.1016 / S0140-6736(17)30979-0. [Epub ahead of print]. Li, Q.; Miller, R.; Han, PY; Pang, J.; Dinculescu, A.; Chiodo, V.;Hauswirth, WW Mol. Ther. 2008, 14, 1760-1769. Kotterman, MA; Yin, L.; Strazzeri, J.M.; Flannery, JG;Merigan, WH; Schaffer, DV Gene Ther. 2014, 22, (12), 116-126. Patel, SR; ROOM; Edelhauser, HF; Prausnitz , MR Pharm. Res. 2011, 28, (1), 166-176. Patel, SR; Berezovsky, DE; McCarey, BE; Zarnitsyn, V.;Edelhauser, HF; Prausnitz , MR Invest. Ophthalmol. Vis. Sci. 2012, 53,(8), 4433-4441. Russell et al., Efficacy and safety of voretigene neparvovec (AAV2-hRPE65v2) in patients with RPE65-mediated inherited retinal dystrophy: arandomized, controlled, open-label, phase 3 trial. Lancet 390, 849-860(2017). Gange et al., Perifoveal chorioretinal atrophy after subretinalvoretigene Neparvovec-rzyl for RPE65-mediated leber congenital amaurosis.Ophthamol. Retina 6, 58-64 (2022). Green, J. J., Langer, R., Anderson, D. G., A Combinatorial PolymerLibrary Approach Yields Insight into Nonviral Gene Delivery. ACC. Chem. Res. 41, 749-759 (2007). Sunshine, J.C., Peng, D. Y., Green, J. J., Uptake and transfectionwith polymeric nanoparticles are dependent on polymer end-group structure,but largely independent of nanoparticle physical and chemical properties. Mol. Pharm. 9, 3375-3383 (2012). Guerrero-Cazares, H., Tzeng, S. Y., Young, N. P., Abutaleb, A. O.,Quinones-Hinojosa, A., Green, J. J., Biodegradable polymeric nanoparticlesshow high efficacy and specificity at DNA delivery to human glioblastoma invitro and in vivo. ACS Nano 8, 5141-5153 (2014). Rui, Y., Wilson, D.R., Tzeng, S.Y., Yamagata, H., Sudhakar, D.,Conge, M., Berlinicke, C.A., Zack, D.J., Tuesca, A., Green, J.J., High-throughput and high-content bioassay enables tuning of polyesternanoparticles for cellular uptake, endosomal escape, and systemic in vivodelivery of mRNA. Sci. Adv. 8, eabk2855 (2022). Herrera-Barrera, M., Ryals, R.C., Gautam, M., Jozic, A., Landry, M.,Korzun, T., Gupta, M., Acosta, C., Stoddard, J., Reynaga, R., Tschetter, W.,Jacomino, N., Taratula, O., Sun, C., Lauer, A.K., Neuringer, M., Sahay, G.,Peptide-guided lipid nanoparticles deliver mRNA to the neural retina ofrodents and nonhuman primates. Sci. Adv. 9, eadd4623 (2023). Drag, S., Dotiwala, F., Upadhyay, A.K., Gene therapy for retinaldegenerative diseases: Progress, challenges, and future directions. Invest.Ophthalmol. Vis. Sci. 64, 39 (2023). Shen, J., Kim, J., Tzeng, S. Y., Ding, K., Hafiz, Z., Long, D., Wang,J., Green, J. J., Campochiaro, P. A., Suprachoroidal gene transfer withnonviral nanoparticles. Sci. Adv. 6, eaba1606 (2020). Vrolyk, V., Desmariais, M.-J., Lambert, D., Haruna, J., Benoit-Biancamano, M., Meonatal and juvenile ocular development in Göttingenminipigs and domestic pigs: a histomorphological and immunohistochemicalstudy. Veterinary Pathol. 57, 889-914 (2020). Shen J., Yang X., Dong A., Petters R. M., Peng Y. W., Wong F.,Campochiaro P. A., Oxidative damage is a potential cause of cone cell deathin retinitis pigmentosa. J Cell Physiol. 203(3), 457-64 (2005). Komeima K., Rogers B. S., Lu L., Campochiaro P. A., Antioxidantsreduce cone cell death in a model of retinitis pigmentosa. Proc Natl Acad Sci USA . 103(30), 11300-5 (2006). Komeima K., Rogers B. S., Campochiaro P. A., Antioxidants slowphotoreceptor cell death in mouse models of retinitis pigmentosa. J Cell Physiol. 213(3), 809-15 (2007). Cideciyan et al., Human cone visual pigment deletions sparesufficient photoreceptors to warrant gene therapy. Hum Gene Ther. 24(12),993-1006 (2013). Jacobson et al., Improvement and decline in vision with gene therapyin childhood blindness. N Engl J Med. 372(20),1920-6 (2015). Häcker G., Redecke V., Häcker H. Activation of the immune system bybacterial CpG-DNA. Immunology. 105(3), 245-51 (2002). Kinman, D.M., Takeshita, F., Fursel, I., Leifer, C., Ishii, K.J.,Verthelyi, D., Gursel, M., CpG DNA: Recognition by and activation ofmonocytes. Micobes Infect. 4, 897-901 (2002). Reyes-Sandoval A., Ertl H.C., CpG methylation of a plasmid vectorresults in extended transgene product expression by circumventing inductionof immune responses. Mol Ther. 9(2), 249-61 (2004). Talati A. J., Kim H. J., Kim Y. I., Yi A. K., English B. K, Role ofbacterial DNA in macrophage activation by group B streptococci. Microbes Infect. 10(10-11):1106-13 (2008). Hyde et al., Nat Biotechnol. 26(5), 549-51 (2008). Yu D. Y., Cringle S. J., Su E. N., Yu P. K., Intraretinal oxygenlevels before and after photoreceptor loss in the RCS rat. Invest Ophthalmol Vis Sci. 41(12):3999-4006 (2000). Yu D. Y., Cringle S., Valter K., Walsh N., Lee D., Stone J.,Photoreceptor death, trophic factor expression, retinal oxygen status, andphotoreceptor function in the P23H rat. Invest Ophthalmol Vis Sci. 45(6),2013-9 (2004). Bhise, NS, Shmueli, RB, Gonzalez, J., Green, JJ, A novel assay for quantifying the number of plasmids encapsulated by polymer nanoparticles. Small 8, 367-373 (2012). Although the foregoing subject matter has been described in considerable detail by way of illustration and example for the purpose of clear understanding, those skilled in the art will understand that certain changes and modifications may be made within the scope of the appended claims.

Claims

1. A method for treating an ocular disease or condition in a subject requiring appropriate treatment, the method comprising administering a particulate composition into the suprachoroidal space of the eyeball, the particulate composition comprising: (a) Poly(β-amino ester) (PBAE) of formula (I) or (II) and its pharmaceutically acceptable salts: (I); or (II); in: m and n are each independent integers from 1 to 10,000; m1 is an integer selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; m2 is an integer that can be selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20; q is an integer selected from 0 or 1; Wherein -(CH2) m1 -(C=C) q -(CH2) m2 -CH3 contains hydrophobic side chains; R contains a divalent group, the divalent group comprising a biodegradable ester bond and / or a bioreducible disulfide bond; R' is a hydrophilic side chain containing a monovalent group derived from a hydrophilic amine monomer; "R" is a monovalent group derived from an amine-terminated group; and (b) DNA containing at least one gene selected from the following: ABCA4, MYO7A, USH1C, CDH23, PCDH15, SANS, CIB2, USH2A, GPR98, WHRN, CLRN1, TIMP3, PEDF, Prph2, BPDE, Bcl2, FGF-2, CNTF, Mertk, GUCY2D, AIPL1, RPGRIP, RPE65, LCA6, LCA10, genes encoding anti-VEGF protein, endostatin, angiostatin and their protein-engineered mimics, antibodies and protein fragments, and genes encoding anti-complement protein and its protein-engineered mimics, antibodies and protein fragments; The mass ratio of the polymer to the DNA is between about 10:1 and about 50:

1.

2. The method of claim 1, wherein n and m are each independently an integer having a range of 1 to 10,000, 1 to 1,000, 1 to 100, 1 to 30, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 to 2 and 1.

3. The method according to claim 1 or claim 2, wherein R is selected from the group consisting of: ; ; ; ; ; ; ; ; ; ; ; ; (BL1); (B8); (B10); (B11); (B12); (B13); (B7); (B9); Where p1, p2 and t are each independent integers selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10.

4. The method according to any one of claims 1-3, wherein R' is selected from the group consisting of: 。 5. The method according to any one of claims 1-4, wherein R” is selected from the group consisting of: ; ;and 。 6. The method according to any one of claims 1-5, wherein -(CH2) m1 -(C=C) q -(CH2) m2 -CH3 is selected from the following groups: 。 7. The method according to any one of claims 1-6, wherein the particulate composition further comprises lipid-polyethylene glycol (PEG).

8. The method according to any one of claims 1-7, wherein the lipid-PEG is selected from the group consisting of 1,2-dimyristoyl-racemic-glycero-3-methoxy polyethylene glycol 2000 (DMG-PEG2k) and C18-PEG2k.

9. The method according to any one of claims 1-8, wherein the particulate composition comprises about 2 wt% to about 10 wt% by weight, including about 2 wt%, 3 wt%, 4 wt%, 5 wt%, 6 wt%, 7 wt%, 8 wt%, 9 wt% and 10 wt% of lipid PEG.

10. The method according to any one of claims 1-9, comprising administering a particulate composition into the suprachoroidal space of the eyeball, the particulate composition comprising: (a) Poly(β-amino ester) (PBAE) polymers of formula (I) and their pharmaceutically acceptable salts: (I); in: n is an integer from 1 to 10,000; R is selected from ; ; R' is selected from (S2) (S3) and (S4); R is selected from (E6) and (E7); and (b) DNA containing at least one gene selected from the following: ABCA4, MYO7A, USH1C, CDH23, PCDH15, SANS, CIB2, USH2A, GPR98, WHRN, CLRN1, TIMP3, PEDF, Prph2, BPDE, Bcl2, FGF-2, CNTF, Mertk, GUCY2D, AIPL1, RPGRIP, RPE65, LCA6, LCA10, genes encoding anti-VEGF protein, endostatin, angiostatin and their protein-engineered mimics, antibodies and protein fragments, and genes encoding anti-complement protein and its protein-engineered mimics, antibodies and protein fragments; The mass ratio of PBAE to DNA is between approximately 10:1 and approximately 50:

1.

11. The method according to any one of claims 1-10, wherein the anti-VEGF protein is selected from VEGFR1 / sFLT-1, VEGFR2, and VEGFR3.

12. The method according to any one of claims 1-11, wherein the DNA is selected from microcircular plasmid DNA, nanoparticle DNA, and blocked-end DNA.

13. The method according to any one of claims 1-12, wherein the DNA: (a) It contains virtually no bacterial elements; (b) approximately 1-4 kbp excluding the aforementioned gene; and / or, (c) It contains virtually no unmethylated CpG sequences.

14. The method according to any one of claims 1-13, wherein the DNA comprises one or more repeats of the 72-bp region ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1) of the CAG promoter and SV40 enhancer.

15. The method of claim 14, comprising two or more repetitions of the 72-bp region ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1) containing the SV40 enhancer.

16. The method according to any one of claims 1-15, wherein the DNA comprises a nanoparticle containing one or more repeats of a 72-bp region ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1) of a target gene driven by a CAG promoter and an SV40 enhancer, wherein the DNA is substantially free of bacterial genetic elements and unmethylated CpG sequences.

17. The method according to any one of claims 1-16, wherein the PBAE of formula (I) is 457: 。 18. The method according to any one of claims 1-17, wherein the PBAE of formula (I) is 447: 。 19. The method according to any one of claims 1-18, wherein the molecular weight of the PBAE of formula (I) or formula (II) has a range selected from about 5,000 to about 40,000 Da, about 5,000 to about 10,000 Da, about 10,000 Da to about 20,000 Da, about 20,000 Da to about 30,000 Da, and about 10,000 Da.

20. The method according to any one of claims 1-19, wherein the size of the particulate composition has a range selected from about 50 nm to about 800 nm, about 100 nm to about 500 nm, about 100 nm to about 300 nm and about 200 nm.

21. The method according to any one of claims 1-20, wherein the mass ratio of said polymer to said DNA has a range of about 10:1 to about 50:1, about 15:1 to about 40:1, about 20:1 to about 30:1, about 20:1, about 25:1 and about 30:

1.

22. The method according to any one of claims 1 to 21, wherein, with or without an infusion pump, the particulate composition is applied to the suprachoroidal space of the subject's eyeball using a specialized insert tip, the insert tip being in the range of about 1-5 mm and having a specification of about 25-35 G.

23. The method according to any one of claims 1 to 22, wherein the particulate composition is administered to the suprachoroidal space of the subject's eyeball via more than one injection at one or more injection sites.

24. The method of claim 23, wherein the more than one injection is administered during a single treatment session.

25. The method of claim 24, wherein the single treatment includes an outpatient visit.

26. The method of claim 25, further comprising a waiting period between the more than one injection.

27. The method according to any one of claims 23 to 26, wherein the more than one injection is performed by an autoinjector or an infusion pump.

28. The method according to any one of claims 1-27, wherein the DNA has a concentration ranging from about 0.1 mg / mL to about 2.0 mg / mL, from about 0.2 mg / mL to about 1.0 mg / mL, from about 0.2 mg / mL to about 0.5 mg / mL, and from about 0.3 mg / mL to about 0.4 mg / mL.

29. The method according to any one of claims 1 to 28, comprising an application volume to the suprachoroidal space ranging from about 20 μL to 500 μL, from about 50 μL to 300 μL, and from about 50 μL to 100 μL.

30. The method according to any one of claims 1 to 29, wherein the particulate composition further comprises one or more of sugar, sugar alcohol, salt, MgCl2, buffer, cryoprotectant, excipient, and combinations thereof.

31. The method of claim 30, wherein the sugar is selected from the group consisting of glucose, fructose, sorbitol, mannitol, sucrose, trehalose, and raffinose.

32. The method of claim 31, wherein the sugar is selected from sucrose and trehalose.

33. The method of claim 30, wherein the one or more sugar alcohols include sorbitol.

34. The method according to any one of claims 1-33, wherein the ocular disease or condition is selected from the group consisting of: Staggart disease, Usher syndrome, neovascular AMD and other diseases causing choroidal neovascularization, diabetic retinopathy, retinal vein occlusion, retinitis pigmentosa, Lieber congenital amaurosis and geographic atrophy.