Construction of a mouse model of ovarian dysgenesis based on mutation of site K947 of DNA polymerase gamma

Abstract

This invention discloses the construction of a mouse model of ovarian hypoplasia based on a mutation at the DNA polymerase γ K925 site, belonging to the field of genetic engineering and model organism construction. This invention targets human-derived... POLG- The mouse homologous functional site K925, corresponding to the clinical mutation of K947R, was targeted and edited using CRISPR / Cas9 gene editing technology via specific sgRNA. Polg By targeting the K925 site in the exon18 region of a gene and combining homologous recombination, a stable mutant mouse model was obtained through genotyping and passaging screening. The mouse model constructed in this invention can specifically mimic human mutations. POLG- The K947R heterozygous mutation is associated with the pathological features of early-onset ovarian insufficiency, without the phenotype of systemic mitochondrial disease. It is suitable for mechanism research, diagnostic marker screening and targeted drug development for ovarian dysplasia-related diseases.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering and model organism construction, specifically to the construction of a mouse model of ovarian hypoplasia based on a mutation at the DNA polymerase γK925R site. Background Technology

[0002] Ovarian dysplasia is a group of congenital or acquired diseases characterized by abnormal ovarian tissue structure, follicular development disorders, and decreased reproductive function. Its pathological manifestations include a decrease in mature follicles and an increase in atretic follicles, which can lead to infertility in severe cases.

[0003] Current research suggests that mitochondrial dysfunction is one of the important causes of ovarian hypoplasia. Among them, DNA polymerase γ (POLG), as the only catalytic enzyme for mitochondrial DNA (mtDNA) replication and repair, can cause mtDNA mutation accumulation and energy metabolism disorders when its function is defective, thereby inducing oocyte and granulosa cell apoptosis, ultimately leading to ovarian hypoplasia.

[0004] However, existing animal models struggle to accurately simulate this relationship: traditional Citizen Mutant mice are mostly global knockouts or random fragment mutations, often leading to systemic mitochondrial diseases (such as neuropathy and embryonic lethality), making it impossible to focus on ovarian tissue-specific phenotypes; some ovarian dysplasia models rely on chemical induction or non-chemical induction. Citizen Gene editing results in poor phenotypic stability and a lack of correspondence with clinical mutation sites.

[0005] Therefore, there is an urgent need in this field to construct a portable Citizen Mouse models with precise mutations at key functional sites to mimic human mice. Citizen Mutation-related pathological features of ovarian insufficiency fill the gaps in the understanding of " Citizen This fills a gap in the research on the mechanism of "site mutation—mitochondrial dysfunction—ovarian hypoplasia" and provides a dedicated tool for clinical translational research. Summary of the Invention

[0006] To address the problems existing in current technologies, this invention provides a method for constructing a mouse model of ovarian hypoplasia based on a mutation at the DNA polymerase γK925 site. This invention utilizes CRISPR / Cas9 technology to target and edit mice... Citizen Mice with stable genetic mutations obtained at the K925 gene locus can mimic the pathological features of ovarian hypoplasia. This model is suitable for mechanism research, diagnostic marker screening, and drug development of ovarian-related diseases, and can be applied in the fields of medicine and biomedicine.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solutions.

[0008] This invention discloses a mouse model of ovarian hypoplasia based on DNA polymerase γ mutation, characterized in that the mouse model... Citizen The K925R mutation exists at the K925 site of the gene.

[0009] This invention also discloses a method for constructing the aforementioned mouse model, characterized by comprising the following steps: (1) Targeted mice Citizen In the exon18 region of the gene, sgRNAs corresponding to the K925R mutation were designed. (2) Constructing a system containing Citizen Homologous recombination donor vector for site-directed mutation of gene K925; (3) Inject Cas9 mRNA, the sgRNA described in step (1) and the homologous recombination donor vector described in step (2) into mouse zygotes; (4) The injected fertilized eggs were transferred into pseudopregnant mice to produce F0 generation mice; (5) Genotyping of F0 generation mice was performed to screen for... Citizen First-generation mice with K925R gene mutation; (6) The positive first-generation mice were mated with wild-type mice, and the mice were passaged and screened to obtain stably inherited strains. Polg- K925R / + heterozygous mutant mouse model.

[0010] Further, the nucleotide sequence of the sgRNA described in step (1) is shown in SEQ ID NO:1.

[0011] Further, according to the above-described mouse model or the method described in any one of the above embodiments, the characteristic is that the... Citizen The gene K925 site mutation is a K925R / + heterozygous mutation.

[0012] The present invention also discloses the application of the mouse model described above or the mouse model constructed by the method described above in the study of the pathogenesis of ovarian dysplasia.

[0013] The present invention also discloses the application of the mouse model described above or the mouse model constructed by the method described above in screening drugs for the treatment or prevention of diseases related to ovarian dysplasia.

[0014] The present invention also discloses the application of the mouse model described above or the mouse model constructed by the method described above in evaluating the effects of drugs or interventions on ovarian function.

[0015] The present invention also discloses the application of the mouse model described above or the mouse model constructed by the method described above in screening biomarkers for evaluating mitochondrial function.

[0016] The present invention also discloses the application of the mouse model described above or the mouse model constructed by the method described above in screening drugs for delaying ovarian aging.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows.

[0018] Precision Design: Targeted Citizen exon18 K925 We designed sgRNA and homologous recombination vectors to achieve site-directed mutations without affecting other gene functions.

[0019] High-efficiency editing: Optimize CRISPR / Cas9 system and microinjection and embryo transfer parameters to improve mutation and embryo survival efficiency.

[0020] Multilayer identification: Mutant mice were screened by PCR and sequencing, and their genetic stability was verified by passage.

[0021] Functional validation: Identify the phenotypes related to ovarian development and mitochondrial function in the model, and confirm their application value in mechanism research and drug screening. Attached Figure Description

[0022] Figure 1 Citizen Schematic diagram of the strategy for constructing -K925R mutant mice.

[0023] Figure 2 Citizen -K925R PCR amplification products were identified by agarose gel electrophoresis.

[0024] Figure 3 Citizen Comparison of sequencing results for the -K925R mutation. A: Wild-type sequence; B: Heterozygous mutant sequence.

[0025] Figure 4 Wild type and Citizen -Statistical chart of the number of offspring produced by continuous breeding in female K925R mutant mice.

[0026] Figure 5 Citizen HE staining and statistical analysis of follicle development ratio in ovarian tissue of -K925R mutant mice. A: Staining diagram; B: Statistical graph.

[0027] Figure 6 Citizen Immunohistochemical analysis of PCNA levels in ovarian tissue of -K925R mutant mice.

[0028] Figure 7 Citizen Electron micrograph of mitochondrial ultrastructure in ovarian tissue of a K925R mutant mouse; squares represent swollen mitochondrial matrix, and triangles represent broken or missing mitochondrial cristae. Scale bar: 400 nm.

[0029] Figure 8 Flow cytometry detection of KGN cell (human ovarian granulosa cells) overexpression POLICE -WT and POLICE A graph showing the apoptosis level of K947R. A: Flow cytometry; B: Statistical graph.

[0030] Figure 9 Predicting using the α-fold method POLICE -WT and POLICE -K947R structure.

[0031] Figure 10 Real-time quantitative PCR detection of KGN cell overexpression POLICE -WT and POLICE The effect of -K947R on the expression of mtDNA-encoded genes. A: ND1 relative to mRNA level; B: ND5 relative to mRNA level. Detailed Implementation

[0032] The present invention will be further described in detail below with reference to specific embodiments. However, this should not be construed as limiting the scope of the above-described subject matter of the present invention to the following embodiments; all technologies implemented based on the content of the present invention fall within the scope of the present invention.

[0033] Unless otherwise specified, all reagents and materials used in this invention are commercially available.

[0034] In the early stages, a case of carrier was discovered during clinical research. POLICE- Patients with progressive extraocular muscle palsy due to the K947R mutation, in addition to typical neurological symptoms such as proximal muscle weakness and bilateral facial muscle weakness, also present with very early menopause (menarche at age 15, permanent menopause at age 18) and infantile uterus. This comorbid phenotype is... POLICE The direct pathological link between specific site mutations and ovarian hypoplasia provides crucial clinical evidence, suggesting... POLICE- K947 mutations may be involved in the pathological process of ovarian developmental abnormalities; a comparison of human and mouse models using the NCBI database was conducted. Citizen Gene coding sequence confirms human POLICE- K947 and mice Polg- The K925 site is highly homologous and evolutionarily conserved, therefore this invention targets and edits mice. Polg- K925 locus, precisely mimicking human... POLICEThe pathological effects of the -K947R mutation provide insights into... Citizen The molecular mechanisms by which mutations lead to ovarian hypoplasia provide experimental tools.

[0035] I. Reagents and Instruments

[0036] 1. Main reagents.

[0037] Gene editing related: Cas9 mRNA (Thermo Fisher), targeted therapy Polg- The K925-specific sgRNA (sequence: 5'-GCGGCCATAGTTGAAGATTT-3' (SEQ ID NO.1, synthesized by Southern Model Organisms), homologous recombination donor DNA (SEQ ID NO.2): 5'-CTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAGGATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCACAGGCTCACA-3', containing the K925 mutant sequence and homologous arm (synthesized by Southern Model Organisms), restriction endonuclease (NEB), DNA ligase (Takara), and PCR amplification kit (TaKaRa PremixTaq).

[0038] Mouse-related: PMSG (pregnant mare serum gonadotropin, Sigma), hCG (human chorionic gonadotropin, Sigma), embryo manipulation solution (M2 medium, Sigma), genotype identification forward primer F: 5'-GTTGAAAGCCATGGTGCAGG (SEQ ID NO.3) and reverse primer R: 5'-GCCCAGAGATGGAAGAGAGC-3' (SEQ ID NO.4), commissioned to Southern Model Organisms for synthesis.

[0039] Lentiviral related: A wild-type human POLG lentivirus (h-POLG-WT +3flag) with a synonymous mutation of the target sequence, its core coding region nucleotide sequence is shown in SEQ ID NO. 6; a human POLG lentivirus (h-POLG-K947R +3flag) with a synonymous mutation of the target sequence and a K947R mutation, its core coding region nucleotide sequence is shown in SEQ ID NO. 7. The above lentiviruses were packaged using the VP010-CMV-MCS-3flag-EF1-NEO vector backbone, and Polybrene was used as the staining agent.

[0040] Other: Agarose (Invitrogen 75510019), ready-to-use immunohistochemistry kit (Maixin Biotech KIT-9710), DAB chromogenic solution (Sewell Biotech G1212-200T), hematoxylin counterstaining solution (Maixin Biotech CTS-1090), Annexin V-APC / 7-AAD double staining apoptosis detection kit (Kaiyin Biotech GA1106-10).

[0041] 2. Main instruments.

[0042] Molecular biology instruments: PCR instrument (Takara), DNA sequencer (ABI 3730), gel imaging system (Bio-Rad), microinjection apparatus (Eppendorf), stereo microscope (Nikon), CO2 incubator (Thermo Fisher), clean bench (Sujing Antai), centrifuge (Haonuosi), mouse cage (Cyagen Biosciences).

[0043] II. Experimental Methods.

[0044] (a) Construction of sgRNA and homologous recombination donor vector.

[0045] Based on mice Citizen The gene sequence (Ensembl ID ENSMUSG00000039176) was used to design a specific sgRNA targeting the K925 site of exon18 to ensure that the target sequence has no off-target risk.

[0046] Homologous recombination donor vectors were constructed, and homologous arms containing the K925 site-directed mutation (1000bp each in the left and right arms) were inserted. The correctness of the vectors was verified by enzyme digestion and sequencing.

[0047] (II) Microinjection of fertilized eggs and embryo transfer.

[0048] Donor female mice (6-8 weeks old, C57BL / 6J) were injected intraperitoneally with PMSG (5 IU / mouse), followed by an injection of hCG (5 IU / mouse) 48 hours later. Fertilized eggs were collected after the mice were housed with male mice.

[0049] The mixture of Cas9 mRNA (100 ng / µL), sgRNA (50 ng / µL), and donor DNA (20 ng / µL) was microinjected into the pronucleus of the fertilized egg (10 pL per egg).

[0050] After injection, the fertilized eggs were cultured at 37°C and 5% CO2 for 1-2 hours. Normally developed embryos were selected and transferred to the oviducts of pseudopregnant ICR female mice, with 10-15 embryos transferred to each side.

[0051] (III) Genotyping and screening of mutant mice.

[0052] Three weeks after birth, F0 generation mice had their tail tips cut off to extract genomic DNA, which was then amplified by PCR using specific primers (product length 526bp).

[0053] 1. PCR amplification.

[0054] PCR reaction system (20µL): ddH2O 8.0µL, 2×RapidTaq Master Mix 10.0µL, forward and reverse primers 0.5µL each, genomic DNA 1.0µL.

[0055] .

[0056] The amplified products were initially screened by agarose gel electrophoresis, and positive samples were subjected to DNA sequencing to confirm the K925 site mutation.

[0057] 2. DNA electrophoresis identification.

[0058] (1) Gel preparation: Weigh an appropriate amount of agarose, add it to 1×TAE buffer, heat it in a microwave oven until it is completely dissolved, and when the solution is cooled to 50~60℃, add nucleic acid dye and mix thoroughly. Pour the gel solution into the gel casting tank, insert a comb with a suitable aperture, and let it stand at room temperature for 30~40 minutes until the gel is completely solidified.

[0059] (2) Sample preparation: Take the PCR amplification product, add 6×DNA loading buffer according to the ratio, mix thoroughly and set aside.

[0060] (3) Electrophoresis operation: Place the solidified gel into the electrophoresis tank, add enough 1×TAE buffer to immerse the gel, and carefully pull out the comb; add the DNA sample and marker to the sample well of the gel in sequence, turn on the power, set a constant voltage of 150V, electrophoresis for 25min, and stop electrophoresis when the bromophenol blue indicator migrates to 2 / 3 of the gel.

[0061] (4) Results observation and photography: Place the gel after electrophoresis in a gel imaging system, observe the DNA bands under a UV transilluminator, collect images and analyze the results, determine the size and purity of the target band based on the molecular weight of the DNA Marker, and complete the electrophoretic identification of the DNA sample.

[0062] Positive F0 generation mice were mated with wild-type C57BL / 6J mice to obtain F1 generation mice. F1 generation mice were self-crossed to obtain F2 generation mice. Mutant mice were screened by PCR and sequencing.

[0063] (iv) Effects of K925R heterozygous mutation on the continuous reproductive capacity of female mice.

[0064] 1. Laboratory animals and grouping.

[0065] In this embodiment, mice with a C57BL / 6 background were used as experimental animals, and two groups were set up: an experimental group and a control group. The experimental group consisted of 5 age-appropriate K925R heterozygous female mice (K925R+ / -), and the control group consisted of 5 wild-type female mice (WT) under the same conditions. The male mice used for breeding with the female mice in both groups were healthy adult wild-type (WT) males.

[0066] 2. Breeding experiment steps.

[0067] In November 2025, female mice from both the experimental and control groups were co-bred with wild-type male mice at a 1:1 ratio, with a total of 10 breeding cages (5 cages for the experimental group and 5 cages for the control group). Each cage contained one wild-type male mouse and one corresponding female mouse to be tested. All experimental animals were housed in an SPF-grade standard environment with free access to food and water, and a 12-hour light-12-hour dark cycle was maintained. From the time of co-breeding, the birthing of each female mouse was continuously observed and recorded. To rule out potential reproductive instability in primiparous mice (first litter), this experiment focused on examining and recording the birthing performance of mice after they entered their peak reproductive period.

[0068] 3. Data statistics and selection.

[0069] The number of surviving pups from each female mouse in the experimental group (n=5) and the control group (n=5) in the second, third, and fourth litters was collected and recorded. The litter size of each female mouse within these three consecutive breeding cycles (litters 2-4) was summarized as representative data for assessing the continuous fertility of the sample. Subsequently, professional analysis software such as GraphPad Prism was used to summarize, plot, and analyze the collected litter sizes. Independent samples t-tests (Student's t-test) were used to compare differences between groups. P <0.05 is used as the statistical standard for determining a significant difference.

[0070] 4. Validation of genetic stability and function in mutant mice.

[0071] Mutant mice were passaged continuously to the F5 generation, and the K925 mutation status was verified by sequencing in each generation. Growth, development, and reproductive capacity were observed. Ovarian morphology was observed through dissection, and HE staining was performed to count the number of atretic and mature follicles. PCNA expression levels in ovarian tissue were detected using immunohistochemistry.

[0072] (1) HE staining steps: ① Dewaxing and hydration: The paraffin-embedded tissue sections were baked in a 65℃ oven for 2 hours to melt the wax. Then, they were placed in xylene I for 15 minutes and xylene II for 15 minutes to dewax. Next, they were placed in anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, 95% ethanol for 5 minutes, and 75% ethanol for 5 minutes to dehydrate in a gradient. Finally, they were placed in distilled water for 5 minutes and PBS solution for 5 minutes to complete the gradient hydration of the sections. ② Hematoxylin staining: Immerse the hydrated sections in hematoxylin staining solution for 1 second, then rinse thoroughly with tap water to remove excess stain; then differentiate with 1% hydrochloric acid alcohol for a few seconds (control the degree of differentiation under a microscope until the cell nuclei are clearly blue-purple and the cytoplasm is colorless), rinse with tap water to stop differentiation; rinse thoroughly with running water for 10 minutes to make the cell nuclei bright blue. ③ Eosin staining: Immerse the blue-stained sections in eosin staining solution for 3 minutes, then rinse quickly with tap water to remove excess staining solution until the cytoplasm is uniformly pink. ④ Dehydration, clearing, and mounting: The slides were sequentially immersed in 75% alcohol for 5 min, 95% alcohol for 5 min, anhydrous ethanol II for 5 min, and anhydrous ethanol I for 5 min for dehydration. Then, they were immersed in xylene II for 10 min and xylene I for 10 min for clearing. Finally, they were mounted with neutral resin and covered with a coverslip. The slides were then observed and images were acquired under an optical microscope. The staining criteria were that the cell nuclei were blue and the cytoplasm and extracellular matrix were pink. Histological analysis was then performed.

[0073] (2) Immunohistochemical steps: ① Dewaxing and hydration: The paraffin-embedded tissue sections were baked in a 65℃ oven for 2 hours to melt the wax. Then, they were placed in xylene I for 15 minutes and xylene II for 15 minutes to dewax. Next, they were placed in anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, 95% ethanol for 5 minutes, and 75% ethanol for 5 minutes to dehydrate in a gradient. Finally, they were placed in distilled water for 5 minutes and PBS buffer for 5 minutes to complete the gradient hydration of the sections. ② Antigen retrieval: Place the hydrated slides into citrate antigen retrieval solution (pH 6.0), heat to boiling in an autoclave and maintain for 2 minutes, then cool naturally to room temperature, and rinse twice with PBS buffer for 5 minutes each time; ③ Endogenous enzyme blocking: Incubate the sections with 3% hydrogen peroxide solution at room temperature in the dark for 10 min to block endogenous peroxidase activity, and wash three times with PBS buffer for 5 min each time; ④ Non-specific blocking: Add 5% goat serum working solution, block at room temperature for 30 minutes, pour off excess liquid, no rinsing required; ⑤ Primary antibody incubation: Add PCNA rabbit monoclonal primary antibody (working concentration 1:4000), place the slide in a humidified chamber at 4°C and incubate overnight; the next day, take out the slide, warm it to room temperature for 30 min, and wash it thoroughly with PBS buffer 3 times, 5 min each time; ⑥ Secondary antibody incubation: Add horseradish peroxidase-labeled goat anti-rabbit IgG secondary antibody working solution, incubate at room temperature for 30 min, and wash 3 times with PBS buffer, 5 min each time; ⑦ Development and counterstaining: Add DAB development solution, develop at room temperature in the dark for 3-5 minutes, control the degree of development under a microscope, and rinse with tap water to stop the reaction; then put the section into hematoxylin staining solution for 1 second for counterstaining, rinse with tap water, then differentiate with 1% hydrochloric acid alcohol for a few seconds, rinse with tap water, soak in 0.6% ammonia water to turn blue, and rinse thoroughly with running water. ⑧ Dehydration, clearing and mounting: The sections are sequentially immersed in 75% alcohol for 5 min, 95% alcohol for 5 min, anhydrous ethanol II for 5 min and anhydrous ethanol I for 5 min for dehydration, then immersed in xylene II for 10 min and xylene I for 10 min for clearing, and finally mounted with neutral resin. ⑨ Result interpretation: Observe and acquire images under an optical microscope. The presence of brownish-yellow or brownish-brown granules in the cell nucleus indicates positive expression of PCNA. Cover the slide with a coverslip, observe and acquire images under an optical microscope, and observe the expression level of positive cells.

[0074] 5. Ultrastructural observation of mitochondria in ovarian tissue (transmission electron microscopy): ①Sampling and Fixation: Dissect and rapidly remove wild-type (WT) pups aged 6-12 weeks and Polg- Ovarian tissue from K925R mutant mice was immediately cut into 1mm pieces. 3 Small pieces were placed in 2.5% glutaraldehyde fixative and fixed at 4°C for at least 24 hours. ② Post-fixation and dehydration: The tissue blocks were rinsed three times with PBS buffer, then fixed in 1% osmium tetroxide solution at room temperature for 2 hours. Dehydration was performed sequentially with 30%, 50%, 70%, 80%, 95% and 100% ethanol, and finally soaked in acetone. ③ Embedding and sectioning: Epoxy resin was used for infiltration and embedding, and polymerization was carried out in a 60℃ oven for 48 hours. Ultrathin sections of 60~80nm were cut using an ultramicrotome and placed on a copper grid; ④ Staining and observation: After double staining with uranium acetate and lead citrate, the sections were air-dried. The morphology of mitochondria, cristae arrangement, and matrix density in ovarian granulosa cells were observed using a transmission electron microscope, and images were acquired.

[0075] 6. Apoptosis detection.

[0076] exist POLICE Gene knockout POLICE In the context of human ovarian granulosa cells with -KO, re-expression (overexpression) was performed separately. POLICE -WT and POLICE -K947R (corresponding to the mouse K925R homologous site) was used to detect cell apoptosis. The specific operation steps are as follows.

[0077] (1) POLICE Construction of a Lentiviral Infection and Compensation Model in a KO Cell Context: ① Target cell preparation: Pre-prepared endogenous cells knocked out POLICE Human ovarian granulosa KGN cells (hereinafter referred to as KGN cells) POLICE -KO KGN cells). Seed the above knockout cells into culture plates 16-24 hours in advance and culture until the cell confluence reaches 30%~40% to ensure that the cells are in the best growth state; ② Virus preparation: Wild-type h-viruses with synonymous mutations of the target sequence were prepared using the lentiviral vector VP010-CMV-MCS-3flag-EF1-NEO. POLICE -WT+3 flag Lentiviral and mutant h- POLICE -K947R+3flag lentivirus. Note: Synonymous mutation of the target sequence is intended to prevent the exogenous complement gene from being recognized and cleaved by gene editing systems targeting endogenous sequences. The original wild-type fragment sequence of the sgRNA target region before synonymous mutation is shown in SEQ ID NO. 5. To achieve target escape, the complement lentiviral vector used in this invention has undergone synonymous mutation treatment of this region (the modified core fragment sequence is shown in SEQ ID NO. 6), thereby ensuring that the complement fragment is cleaved without changing the amino acid sequence. POLICE -KO cells can be stably expressed without being cleaved. Among them, the mutant vector, in addition to synonymous mutations, further includes human K947R mutation (corresponding to mouse K925R mutation site, the core fragment sequence is shown in SEQ ID NO. 7); ③ Viral infection: Remove the frozen lentivirus from the refrigerator and thaw it slowly on ice; according to the pre-set optimal MOI (reinfection index) value, administer the virus to the experimental group. POLICE Add the corresponding volumes of wild-type and mutant lentivirus solution to KO KGN cells, and add the staining agent Polybrene to achieve a final concentration of 5µg / mL. After gently mixing, place the cells in an incubator for further culture. ④ Medium change and culture: 16 hours after infection, the supernatant containing the virus in each well is aspirated and replaced with fresh complete medium; the medium is changed routinely according to the cell growth status, and culture is continued for about 72 hours to ensure that the exogenous target gene is fully expressed and to complete the construction of the gene site mutation complementation model.

[0078] (2) Flow cytometry detection: Collect the cells to be tested from each group after the above treatment. Collect suspended cells by centrifugation at 300×g for 5 min. Collect adherent cells by trypsin digestion without EDTA. Wash cells twice with PBS, centrifuge at 300×g for 5 min each time, and collect 1×10⁶ cells. 5 ~5×10 5 Each cell was resuspended in 500 μL of Binding Buffer to form a single-cell suspension. Then, 5 µL of Annexin V-APC and 5 µL of 7-AAD staining solution were added, and the mixture was gently mixed. The cells were incubated at room temperature in the dark for 5–10 min. Flow cytometry was used to detect Annexin V-APC fluorescence via FL4 channel and 7-AAD fluorescence via FL3 channel. Apoptosis-induced cells were used as a control to adjust fluorescence compensation and the position of the cross gate.

[0079] 7. Protein structure prediction.

[0080] To thoroughly evaluate the impact of the K947R amino acid mutation on the three-dimensional conformation and potential biological function of the POLG protein, this embodiment uses the SWISS-MODEL tool to analyze the wild-type ( POLICE -WT) and mutants ( POLICE Homology modeling and structural alignment analysis were performed on the -K947R protein. The specific implementation steps are as follows.

[0081] (1) Amino acid sequence acquisition and preparation: Obtain the complete POLG wild-type amino acid sequence of the target species from a protein database (such as UniProt or NCBI). Based on the obtained sequence, replace the lysine (K) at position 947 with arginine (R) to generate... POLICE- K947R mutant amino acid sequence. Both sequences were saved in standard FASTA format.

[0082] (2) Template search and homology modeling: prepare the template search and homology modeling. POLICE- WT and POLICE- The K947R amino acid sequence was submitted to the SWISS-MODEL automated online server. The system used BLAST and HHblits algorithms to perform homology sequence alignment searches in the SWISS-MODEL template library (SMTL), and selected the high-resolution known crystal structure with the highest sequence identity and the widest coverage as the most suitable template for homology modeling.

[0083] (3) Model Construction and Quality Assessment: Based on the selected optimal template, three-dimensional structural models of wild-type and mutant proteins were constructed using the server's built-in algorithm. The quality of the generated three-dimensional models was assessed using the GMQE (Global Model Quality Estimate) and QMEAN scoring systems to ensure that the constructed models have high reliability and topological rationality (Note: This can be supplemented according to the actual situation, for example: in this embodiment, the GMQE of the generated models is greater than X, and the QMEAN Z-score is within the normal threshold range).

[0084] (4) 3D structure visualization and difference analysis: Visualizing the completed model POLICE- WT and POLICE- Import the K947R model file (.pdb format) into molecular 3D structure visualization software (such as PyMOL or UCSF Chimera). Perform structural superimposition on the two models, focusing on the conformational changes of the mutation site at position 947 and its surrounding local microenvironment.

[0085] 8. mtDNA replication capacity.

[0086] Human POLG-WT and POLG-K947R were overexpressed in KGN cells, and the mtDNA encoding genes were detected by qPCR. ND1、ND5 The relative expression levels were used to assess mtDNA replication efficiency.

[0087] (1) Total RNA extraction from samples (Trizol method): ① Reagent and sample preparation: Prepare Trizol total RNA extraction reagent, chloroform (trichloromethane CHCl3), isopropanol, 75% ethanol, DEPC water, RNase-free EP tubes, RNase-free pipette tips and other reagents and consumables in advance; if it is a cell sample, add 1mL of Trizol to the cells in advance and store it at -80℃ for later use. ② Sample lysis: Take out the tissue sample from -80℃, transfer it to an RNase-free EP tube, add reagent at a ratio of 1 mL Trizol to 100 mg of tissue, break the tissue by cutting or homogenizing, let the sample stand at room temperature for 1~5 min to fully lyse, centrifuge at 1200 r / min for 2 min, and take the supernatant for later use. ③ Phase separation: Add 200µL of chloroform (in equal proportion to Trizol) to the supernatant, shake vigorously for 15s, and let stand at room temperature for 2-3min to allow the sample to separate into layers: the upper layer is the aqueous phase, the middle layer is the protein layer, and the lower layer is the organic phase. ④ Centrifugation and phase separation: Place the sample in a centrifuge at 4℃ and centrifuge at 12000r / min for 15min; ⑤ Aqueous phase aspiration: Carefully aspirate the upper clear aqueous phase into a new RNase-free EP tube; ⑥ RNA precipitation: Add an equal volume of isopropanol (about 500µL) to the aqueous phase, invert to mix well, and let stand at room temperature for 5-10 minutes to allow the RNA to precipitate completely. ⑦ Precipitation collection: Centrifuge at 12000r / min for 10min at 4℃, discard the supernatant, and retain the RNA precipitate at the bottom of the tube; ⑧ Washing the precipitate: Add 1 mL of 75% ethanol to the precipitate, centrifuge at 14000 r / min for 5 min, aspirate the supernatant (first use the large pipette tip, then the small pipette tip), repeat the centrifugation and washing twice, and stop the centrifugation when the precipitate is observed to move. ⑨ RNA drying: Air dry the precipitate at room temperature for 5-10 minutes, until the precipitate becomes translucent; ⑩ RNA dissolution and preservation: Add 30-40µL of DEPC water to the precipitate to dissolve the RNA, and then test the RNA concentration and purity.

[0088] (2) Reverse transcription to synthesize cDNA: ① Sample preparation: Genomic DNA removal: Prepare a mixture in an RNase-free centrifuge tube: 16µL RNase-free ddH2O, 4µL 4×g DNA wiper Mix, add template RNA and mix by pipetting. ②Preparation of reverse transcription reaction system: Add 4µL of 5×HiScriptIIIqRT SuperMix directly to the above reaction tube, mix with the reaction solution from step 1 (16µL), and pipette to mix evenly; ③ Perform reverse transcription reaction: Set the reaction program to incubate at 37℃ for 15 min, then terminate the reaction by heating at 85℃ for 5 s; ④ Preparation of qPCR reaction system (20µL system): Add 10µL of SYBR Pre mix, 0.4µL of Forward Primer (10µM), 0.4µL of Reverse Primer (10µM), 1µL of cDNA template, and 7.2µL of DEPC water in sequence, mix well and then perform qPCR amplification.

[0089] (3) Realtime PCR reaction conditions.

[0090] (4) Primer design for real-time quantitative PCR.

[0091] III. Experimental Results.

[0092] 1. Model Construction Results: Enzyme digestion and sequencing confirmed the correct targeting of the sgRNA, and the K925 mutant sequence insertion in the homologous recombination donor vector was correct. A total of 300 fertilized eggs were collected, with 245 surviving after injection. Forty-two F0 generation mice were obtained through embryo transfer, and eight of these were identified as positive for gene editing, resulting in a gene editing efficiency of 19.0% (see appendix). Figure 1 ).

[0093] 2. Genetic stability results: F0 generation positive first-generation mice were crossed with wild-type C57BL / 6J mice to obtain F1 generation heterozygous mutant (+ / -) mice. These results were verified by PCR amplification combined with DNA sequencing. K925 Locus mutations can stabilize germline inheritance. When F1 generation heterozygous mutant (+ / -) mice are crossed (+ / - × + / -), according to Mendel's laws of inheritance, the F2 generation should theoretically yield 25% homozygous mutant (- / -), 50% heterozygous mutant (+ / -), and 25% wild-type (+ / +) offspring. However, in the actual F2 generation, only wild-type and heterozygous mutant mice were detected; no homozygous mutant (- / -) individuals were obtained. The genetic proportions significantly deviate from Mendel's law of segregation, suggesting... Polg- The K925R homozygous mutation may be an embryo lethal mutation. This invention only yields stably heritable mutations. Polg- The K925R heterozygous mutant (+ / -) mouse strain, continuously passaged to the F5 generation, showed no reversion to the K925 mutation, and the mice exhibited no significant differences in growth, development, or basal reproductive capacity compared to the wild type, indicating that the mutation is stably inherited. (See appendix) Figure 2 , 3 ).

[0094] 3. Analysis of continuous breeding experiment results: such as Figure 4 The bar chart shown visually illustrates the comparison of average litter size between wild-type (WT) and heterozygous mutant (K925R + / -) female mice in litters 2 through 4. Statistical data indicates that wild-type control group females exhibited stable high fertility after entering their peak reproductive period (litters 2-4), with an average litter size of approximately (6.87) offspring. In contrast, K925R heterozygous mutant females (+ / -) showed a significant decrease in litter size during the same consecutive breeding cycles, with an average litter size of only (5.13) offspring. Statistical analysis shows that... Polg- The K925R heterozygous mutant group showed a highly significant difference in average litter size compared to the wild-type control group (**). P <0.01). The above experimental results clearly confirm that, Polg- Heterozygous mutations at the K925R site can lead to a significant reduction in the continuous fertility of female mice.

[0095] 4. Ovarian tissue phenotypic results: Mice aged 6-12 weeks were selected for the experiment. Compared with wild-type mice, the proportion of MII oocytes in the ovarian tissue of heterozygous mutant mice was significantly reduced. P <0.05, the proportion of atretic follicles increased significantly ( P <0.05), exhibiting a typical phenotype of ovarian hypoplasia (see Appendix). Figure 5 ).

[0096] 5. PCNA expression results in ovarian tissue: Mice aged 6-12 weeks were used in the experiment. Compared with wild-type mice, Polg- The positive expression level of PCNA (proliferating cell nuclear antigen, a core marker of cell proliferation) in the ovarian tissue of K925R heterozygous mutant mice was significantly reduced. P <0.05%, decreased ovarian granulosa cell proliferation capacity, providing molecular evidence for abnormal follicular development and ovarian dysfunction (see Appendix). Figure 6 ).

[0097] 6. Results of ultrastructural observation of mitochondria in ovarian tissue: Ultrastructural analysis of mouse ovarian tissue was performed using transmission electron microscopy. The results showed (see appendix). Figure 7 (Scale bar is 400 nm) ① Wild-type (WT) group: The mitochondria in the ovarian granulosa cells are intact, oval or rod-shaped, with clear and densely arranged mitochondrial cristae and uniform matrix; ② Polg- The K925R heterozygous mutant group exhibited significant ultrastructural damage to mitochondria in ovarian granulosa cells. Compared to the wild type, the mutant group showed significantly swollen and enlarged mitochondria with decreased matrix density in some areas, exhibiting marked vacuolation (indicated by squares in the figure); simultaneously, the cristae structures within the mitochondria were disordered, showing significant breakage and even large-scale disappearance (indicated by triangles in the figure). These results provide direct and conclusive evidence at the submicroscopic structural level that... Polg- The K925R mutation causes severe physical damage to mitochondria in mouse ovarian tissue, providing the core pathomorphological basis for the abnormal follicle development and ovarian dysfunction caused by this mutation.

[0098] 7. Apoptosis detection results: Flow cytometry results showed that the proportion of apoptotic cells increased significantly after overexpression of POLG-K947R in KGN cells. POLICE Mutation at the K947 site of the gene (corresponding mouse) Polg- The K925R site can significantly induce apoptosis and reduce cell viability (see appendix). Figure 8 ).

[0099] 8. POLG protein structure prediction results: (Compared to...) POLICE Compared to wild type (WT), POLICE -K947R (corresponding mouse) Polg- Following the mutation at the K925R homologous site, the three-dimensional molecular structure of the POLG protein's core functional domain is significantly altered, with a noticeably looser central structural region and abnormal spatial conformation of key amino acid residues. This directly affects the normal biological function of the POLG protein, providing a structural basis for mitochondrial dysfunction and abnormal ovarian development (see Appendix). Figure 9 ).

[0100] 9. mtDNA replication capacity results: Overexpression of POLG-WT and POLG-K947R (corresponding to mouse POLG-WT) in KGN cells (human ovarian granulosa cells) Polg- (K925R homologous site), KGN cells overexpressing POLG-K947R showed significantly reduced mtDNA replication efficiency, mtDNA encoding gene ND1、ND5 The relative expression levels of all three decreased significantly. ND1 : P <0.001; ND5 : P <0.01), mitochondrial energy metabolism disorders provide a basis for the mitochondrial functional mechanism of ovarian hypoplasia and ovarian dysfunction (see appendix). Figure 10 ).

[0101] The above description is merely a preferred embodiment of the present invention and is not intended to limit the patent scope of the present invention. For those skilled in the art, the present invention can have various modifications and variations. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A mouse model of ovarian hypoplasia based on DNA polymerase γ mutation, characterized in that, The mouse model Polg A K925R heterozygous mutation exists at the K925 locus of the gene ( Polg- K925R / +).

2. A method for constructing the mouse model according to claim 1, characterized in that, Includes the following steps: (1) Targeted mice Polg Design an sgRNA corresponding to the K925 site from the exon18 region of the gene. (2) Constructing a system containing Polg Homologous recombination donor DNA of the site-directed mutation sequence at the K925 site of the gene; (3) Inject Cas9 mRNA, the sgRNA described in step (1) and the homologous recombination donor DNA described in step (2) into mouse zygotes; (4) The injected fertilized eggs were transferred into pseudopregnant female mice to produce F0 generation mice; (5) Genotyping of F0 generation mice was performed to screen for... Polg First-generation mice with a mutation at the K925 site of the gene; (6) The positive first-generation mice were mated with wild-type mice, and the mice were passaged and screened to obtain stably inherited strains. Polg A mouse model with a mutation at the K925 gene site.

3. The method according to claim 2, characterized in that, The nucleotide sequence of the sgRNA described in step (1) is shown in SEQ ID NO:

1.

4. The method according to the mouse model of claim 1 or any one of claims 2-3, characterized in that, The Polg The gene K925 site mutation is a K925R / + heterozygous mutation.

5. The application of a mouse model as described in claim 1 or a mouse model constructed by the method described in any one of claims 2-3 in the study of the pathogenesis of ovarian dysplasia.

6. The use of a mouse model as described in claim 1 or a mouse model constructed by the method of any one of claims 2-3 in screening drugs for the treatment or prevention of diseases related to ovarian dysplasia.

7. The use of a mouse model as described in claim 1 or a mouse model constructed by the method described in any one of claims 2-3 in evaluating the effects of drugs or interventions on ovarian function.

8. The use of a mouse model as described in claim 1 or constructed by the method of any one of claims 2-3 in screening biomarkers for assessing mitochondrial function.

9. The use of a mouse model as described in claim 1 or a mouse model constructed by the method of any one of claims 2-3 in screening drugs for delaying ovarian aging.

Images