A bacterial ghost tumor vaccine based on a csga pilus antigen display system and a preparation method and application thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SOUTH CHINA UNIV OF TECH
- Filing Date
- 2026-05-19
- Publication Date
- 2026-08-04
AI Technical Summary
[0005]针对现有肿瘤疫苗抗原递送效率低、免疫原性弱的问题,本发明提供一种基于CsgA 菌毛抗原展示系统的菌影肿瘤疫苗及其制备方法和应用,首次将 CsgA 蛋白开发为大肠杆菌外膜抗原展示载体,构建高效、安全的菌影肿瘤疫苗,实现目标抗原肽与菌影固有佐剂成分的协同递送,增强肿瘤的抗原特异性免疫应答,有效抑制肿瘤进展,对突破现有肿瘤疫苗技术瓶颈、提升肿瘤免疫治疗效果具有重要意义
[0029] (1) This invention develops CsgA protein from Escherichia coli Nissle 1917 into an outer membrane antigen display vector, overcoming the limitations of existing technologies that rely on traditional vectors for E. coli outer membrane display. This design not only avoids steric hindrance between the antigen peptide and the carrier protein, ensuring the native conformation and immunogenicity of the antigen peptide, but also achieves synergistic delivery of the antigen peptide and the inherent adjuvant components of the bacterial shadow, significantly improving the immune activation efficiency of the vaccine, effectively inhibiting tumor progression, and significantly prolonging survival. Specifically, in macrophage-related RT-qPCR detection, the AO-BGs group further improved the expression level of pro-inflammatory genes compared to the OVA + A-BGs group, and showed a stronger pro-inflammatory reprogramming trend in the M2 macrophage model, indicating that this invention is superior to the simple physical mixing method of antigen peptide and empty bacterial shadow in inducing macrophages to transform towards immune activation. Furthermore, ELISA analysis of cell supernatant showed that, in both M0 and M2 macrophage systems, the AO-BGs group induced higher levels of TNF-α and IL-6 secretion than the OVA + A-BGs group, indicating that this invention can more effectively activate the secretion function of macrophage inflammatory factors. Meanwhile, RNA analysis of tumor tissue further showed that the AO-BGs group was also superior to the OVA + A-BGs group in regulating the expression of local tumor immune-related genes.
Smart Images

Figure CN122499283A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of tumor immunotherapy and biopharmaceutical technology, specifically relating to a bacterial shadow tumor vaccine based on the Escherichia coli curli-specific gene A (CsgA) subunit antigen display system and its preparation method, particularly the application of this vaccine in the immunotherapy of malignant tumors such as melanoma. Background Technology
[0002] Melanoma is a malignant tumor originating from melanocytes, characterized by its high invasiveness, high metastasis rate, and poor prognosis. Traditional treatments such as surgery, chemotherapy, and radiotherapy have limited efficacy for patients with advanced melanoma. Tumor immunotherapy, which activates the body's own immune system to recognize and eliminate tumor cells, has become an important direction in melanoma treatment. Among these treatments, tumor vaccines have broad application prospects due to their ability to actively induce antigen-specific immune responses.
[0003] Current tumor vaccines often face problems such as low antigen delivery efficiency, weak immunogenicity, and insufficient biosafety. Bacterial shadows, as empty shell carriers without cellular contents but retaining an intact outer membrane structure, contain inherent adjuvant components such as lipopolysaccharides and flagellin, effectively activating innate immune responses and exhibiting good biosafety, making them ideal vaccine carriers. However, how to construct an efficient antigen display system to achieve stable display and synergistic delivery of target antigens on the surface of bacterial shadows is a key technical bottleneck in improving the efficacy of bacterial shadow tumor vaccines.
[0004] Escherichia coli Nissle 1917 (EcN) is a safe probiotic strain whose Curli-specific gene A (CsgA) is a major extracellular matrix component in biofilm formation. However, there is currently no technology to develop CsgA into an E. coli outer membrane antigen display system for the construction of tumor vaccines. Existing E. coli outer membrane antigen display technologies mostly rely on carrier molecules such as outer membrane protein A (OmpA) and flagellin. These systems generally suffer from low antigen display efficiency and easy changes in antigen conformation after fusion. At the same time, there is a lack of specific and efficient antigen delivery systems for melanoma, making it difficult to achieve precise and potent immunotherapy. Summary of the Invention
[0005] To address the issues of low antigen delivery efficiency and weak immunogenicity in existing tumor vaccines, this invention provides a CsgA fimbriae antigen display system-based Escherichia coli (E. coli) tumor vaccine, its preparation method, and its application. For the first time, CsgA protein is developed as an E. coli outer membrane antigen display carrier, constructing a highly efficient and safe E. coli tumor vaccine. This achieves synergistic delivery of the target antigen peptide and the inherent adjuvant components of E. coli, enhancing the antigen-specific immune response to tumors and effectively inhibiting tumor progression. This is of great significance for overcoming the technological bottlenecks of existing tumor vaccines and improving the efficacy of tumor immunotherapy.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A bacterial shadow tumor vaccine based on a CsgA fimbrial antigen display system includes bacterial shadows as a carrier and a fusion antigen molecule displayed by the carrier; the fusion antigen molecule comprises a CsgA protein derived from Escherichia coli Nissle 1917 and a target tumor antigen peptide, wherein the CsgA protein acts as an outer membrane anchoring molecule to mediate the display of the target tumor antigen peptide on the surface of the bacterial shadow.
[0008] Preferably, the bacterial shadow is a cell-free shell carrier formed by treating Gram-negative bacteria with a bacteriophage lysis gene, while retaining an intact outer membrane structure; preferably, it is the Escherichia coli Nissle 1917 bacterial shadow, which contains inherent adjuvant components such as lipopolysaccharide and flagellin, which can synergistically activate the immune response; the bacteriophage lysis gene is preferably a mutant of the E gene of ID52 bacteriophage, ID52-E-W4A. The gene sequence of the mutant ID52-E-W4A is shown in SEQ ID NO:3 of Chinese Patent Publication No. CN118344442 A.
[0009] Preferably, the target tumor antigen peptide includes one or more of solid tumor antigen peptides and hematologic tumor antigen peptides. For example, melanoma antigen peptide, lung tumor antigen peptide, or colorectal cancer antigen peptide, or its neoantigen peptide. Taking melanoma antigen peptide as an example, the tumor antigen peptide of the present invention includes survivin antigen peptide or its neoantigen peptide, such as MHC I epitope antigen peptide or its neoantigen peptide and / or MHC II epitope antigen peptide or its neoantigen peptide, or it can be a combination of MHC I epitope antigen peptide, MHC II epitope antigen peptide or its neoantigen peptide.
[0010] Preferably, the CsgA protein and the target tumor antigen peptide are linked by a (GGGS)3 linker to form a peptide bond, thereby constituting a CsgA-antigen peptide fusion protein; the amino acid sequence of the (GGGS)3 linker is shown in SEQ ID NO:2, which has good flexibility and can avoid steric hindrance between the CsgA protein and the target antigen peptide, thus ensuring the native conformation and immunogenicity of the antigen peptide.
[0011] Preferably, the Escherichia coli Nissle 1917 is EcN / ΔtnaA::T7 RNAP.
[0012] The preparation method of the bacterial shadow tumor vaccine includes the following steps:
[0013] (1) Construction of knockout mutant strain: The gene encoding CsgA protein in the genome of Escherichia coli Nissle 1917 was knocked out to obtain EcNΔcsgA mutant strain;
[0014] (2) Construction of recombinant expression vector: The gene encoding CsgA protein and the gene encoding the target tumor antigen peptide were cloned in tandem into the expression vector to obtain a recombinant plasmid containing the CsgA-antigen peptide fusion gene;
[0015] (3) Preparation of recombinant engineered bacteria: The recombinant plasmid described in step (2) is transformed into competent cells of the EcNΔcsgA mutant strain in step (1), and recombinant engineered bacteria that stably express CsgA-antigen peptide fusion protein are screened to obtain the recombinant engineered bacteria.
[0016] (4) Preparation of bacterial shadows: The recombinant engineered bacteria described in step (3) are lysed using a phage lysis gene-mediated method to remove cell contents and obtain bacterial shadows that retain and display fusion antigen molecules;
[0017] (5) Separation and purification: The bacterial shadow obtained in step (4) is separated and purified to obtain the bacterial shadow tumor vaccine.
[0018] Preferably, the lysis treatment conditions in step (4) are 37 ± 3℃ for 1 ± 0.5h of induction culture.
[0019] Preferably, the purification process in step (4) includes centrifugation to collect the bacterial shadow precipitate, washing with PBS buffer, adding β-propiolactone to the bacterial shadow precipitate for inactivation, and washing with PBS buffer.
[0020] The specific preparation method of the bacterial shadow tumor vaccine is as follows:
[0021] (1) Construction of EcN / ΔtnaA::T7 RNAP chassis strain: The tnaA gene in the genome of Escherichia coli Nissle 1917 (WT) was knocked out using λ-Red homologous recombination and CRISPR / Cas9 gene editing technology, and a gene expressing T7 RNA polymerase was integrated into this site; firstly, an sgRNA targeting the tnaA gene (sequence shown in SEQ ID NO:3) was designed and cloned into the pTargetF plasmid; 500 bp homologous arms were obtained upstream and downstream of the tnaA gene, and fusion PCR was performed in the order of left homologous arm-T7 RNAP-right homologous arm to obtain recombinant DNA fragments; the EcN strain containing the pCas9 plasmid was transferred to OD 600 When the concentration of L-arabinose was 0.2-0.3, L-arabinose was used to induce Cas9 protein expression to a final concentration of 0.2%, and after culturing for about 1 hour, the OD was... 600 When the concentration reaches 0.6-0.8, prepare chemically competent cells. Add recombinant DNA fragment and pTargetF (gRNA) at a ratio of 3:1-4:1 to the competent cells and place on ice for 5 min. Place in the cup of an electroporator (Bio-Rad) and electroporate at 2.0 kV. Immediately after electroporation, add 1 mL of LB broth and incubate at 30°C and 220 rpm for 1-1.5 h for recovery. Centrifuge at 5000 rpm for 3 min, discard part of the supernatant, resuspend the remaining bacterial cells and spread them on the corresponding antibiotic plates and incubate overnight at 30°C. Inoculate the correctly sequenced bacteria into 50 mL of LB broth, add 50 μL of 1 M IPTG for induction, and incubate on a shaker at 30°C. Streak the cells triangularly on a Kan monoclonal antibody plate, then streak them on a Kan-Spe double antibody plate and Kan. The bacteria that grow on the Kan plate but not on the Kan-Spe plate are the strains that eliminate pTargetF. Further pick the bacteria and incubate at 42°C. Cultured under specific conditions, i.e., eliminating the pCas9 plasmid, ultimately yielded EcN / ΔtnaA::T7 RNAP.
[0022] (2) Construction of EcN / ∆csgA knockout mutant: The csgA gene in the genome of Escherichia coli Nissle 1917 (WT) was knocked out using CRISPR / Cas9 gene editing technology; an sgRNA targeting the csgA gene (sequence shown in SEQ ID NO:4) was designed, and a recombinant knockout plasmid pCas9-sgCsgA containing the sgRNA and the Cas9 protein-coding gene was constructed; the knockout plasmid was transformed into WT Escherichia coli Nissle 1917 competent cells and cultured at 30℃ until OD 600=0.2-0.3, add L-arabinose to a final concentration of 0.2% to induce Cas9 protein expression, and culture at 37℃ for 4-6 h to achieve csgA gene knockout; verify the knockout effect by PCR, screen for csgA gene knockout strains (denoted as EcN / ∆csgA), and confirm the correctness of the knockout by sequencing.
[0023] (3) Construction of recombinant expression vector: Based on the CsgA protein gene sequence (GenBank accession number: XIE57941.1), (GGGS)3 linker amino acid sequence and target antigen peptide amino acid sequence of Escherichia coli Nissle 1917, the gene encoding CsgA protein, the gene encoding (GGGS)3 linker and the gene encoding target antigen peptide were designed and synthesized; the above three genes were tandemly linked in the order of "CsgA gene-(GGGS)3 linker gene-antigen peptide gene" and cloned into pRSFDuet-1(+) expression vector to construct the recombinant plasmid pRSFDuet-1-CsgA-GS-OVA containing the CsgA-(GGGS)3-antigen peptide fusion gene;
[0024] (4) Construction of recombinant engineered bacteria: The above plasmids and lysed protein plasmids were transformed into Escherichia coli Nissle 1917 competent cells using electroporation. Positive clones were obtained by PCR verification, and recombinant engineered bacteria stably expressing CsgA-(GSSS)3-antigen peptide fusion protein were obtained;
[0025] (5) Preparation of bacterial shadows: Recombinant engineered bacteria were cultured at 37°C and 220 rpm until OD. 600 =0.6-1.2, add an inducer to induce lysed protein expression, collect the bacterial cells by centrifugation, wash, then resuspend and freeze-dry.
[0026] The base sequence of the plasmid pRSFDuet-1-CsgA-GS-OVA in step (2) is shown in SEQ ID NO:5.
[0027] The aforementioned bacterial shadow tumor vaccine is used in the preparation of tumor immunotherapy drugs. Preferably, the immunotherapy drug exerts its therapeutic effect by promoting dendritic cell maturation, enhancing cross-antigen presentation, and inducing macrophage polarization towards the M1 phenotype. Simultaneously, this vaccine is a modular platform; by replacing the target antigen peptide in the fusion antigen molecule, it can be adapted to the treatment needs of different types of malignant tumors, enabling the preparation of personalized tumor immunotherapy drugs. The tumors include lung cancer, breast cancer, melanoma, colon cancer, leukemia, lymphoma, and multiple myeloma.
[0028] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0029] (1) This invention develops CsgA protein from Escherichia coli Nissle 1917 into an outer membrane antigen display vector, overcoming the limitations of existing technologies that rely on traditional vectors for E. coli outer membrane display. This design not only avoids steric hindrance between the antigen peptide and the carrier protein, ensuring the native conformation and immunogenicity of the antigen peptide, but also achieves synergistic delivery of the antigen peptide and the inherent adjuvant components of the bacterial shadow, significantly improving the immune activation efficiency of the vaccine, effectively inhibiting tumor progression, and significantly prolonging survival. Specifically, in macrophage-related RT-qPCR detection, the AO-BGs group further improved the expression level of pro-inflammatory genes compared to the OVA + A-BGs group, and showed a stronger pro-inflammatory reprogramming trend in the M2 macrophage model, indicating that this invention is superior to the simple physical mixing method of antigen peptide and empty bacterial shadow in inducing macrophages to transform towards immune activation. Furthermore, ELISA analysis of cell supernatant showed that, in both M0 and M2 macrophage systems, the AO-BGs group induced higher levels of TNF-α and IL-6 secretion than the OVA + A-BGs group, indicating that this invention can more effectively activate the secretion function of macrophage inflammatory factors. Meanwhile, RNA analysis of tumor tissue further showed that the AO-BGs group was also superior to the OVA + A-BGs group in regulating the expression of local tumor immune-related genes.
[0030] (2) The preparation process of this invention is simple. After constructing recombinant engineered bacteria through genetic engineering, the vaccine can be obtained by induction expression, lysis and purification. The production cost is low and it is easy to scale up production.
[0031] (3) The vaccine of the present invention has the advantages of good biosafety, simple preparation process and low production cost. The system is a modular and flexibly designed tumor vaccine platform. By replacing different target antigen peptides fused to CsgA, it can quickly adapt to the immunotherapy needs of a variety of malignant tumors, providing a key technical path for the development of personalized tumor vaccines. Attached Figure Description
[0032] Figure 1 This is a schematic diagram of the pRSF-CsgA-GS-OVA plasmid.
[0033] Figure 2 The image shows the expression effect of CsgA-GS-OVA validated by SDS-PAGE gel. The black arrow points to the target band. WT represents the normal EcN / ΔtnaA::T7 RNAP / ΔCsgA.
[0034] Figure 3TEM images of the "Curli fimbriae" of EcN / ΔtnaA::T7 RNAP / ΔCsgA expressing CsgA-GS-OVA; A: Wild-type Escherichia coli (EcN / ΔtnaA::T7 RNAP); C: Mutant Escherichia coli (EcN / ΔtnaA::T7 RNAP / ΔCsgA); E: Recombinant engineered strain (EcN / ΔtnaA::T7 RNAP / ΔCsgA / pRSF-CsgA-GS-OVA); B, D, and F are magnified views of A, B, and C, respectively.
[0035] Figure 4 The effect of engineered bacterial shadow AO-BGs on M0 type RAW264.7 cells was evaluated by RT-qPCR; the left figure shows cytokine IL-6, and the right figure shows cytokine TNF-α.
[0036] Figure 5 The effect of engineered bacterial shadow AO-BGs on M2 type RAW264.7 cells was evaluated by RT-qPCR; the top left, top right, bottom left, and bottom right are cytokines Arg-1, CD206, TNF-α, and IL-6, respectively.
[0037] Figure 6 The effects of engineered bacterial shadowing (AO-BGs) on M0 / M2 type RAW264.7 cells were detected by enzyme-linked immunosorbent assay (ELISA). The levels of TNF-α (top left) and IL-6 (top right) cytokines in M0 type RAW264.7 cells after sample treatment were shown. The levels of TNF-α (bottom left) and IL-6 (bottom right) cytokines in M2 type RAW264.7 cells after sample treatment were shown.
[0038] Figure 7 To test the toxicity of different concentrations of engineered bacterial shadow AO-BGs to different cells using the CCK-8 assay; A: RAW264.7 cells; B: B16-OVA cells; C: NIH / 3T3 cells.
[0039] Figure 8 Evaluation of the in vivo antitumor therapeutic effect of engineered bacteria AO-BGs; Left figure: Tumor volume of B16-OVA tumor-bearing mice; Right figure: Survival curves of B16-OVA tumor-bearing mice during treatment.
[0040] Figure 9 RT-qPCR was used to evaluate the polarization of macrophages in mouse tumor tissues. IL-6 (top left), iNOS (top center), IL-12 (top right), and IL-1β (bottom left) are markers of M1 macrophages; IL-10 (bottom center) and Arg-1 (bottom right) are markers of M2 macrophages.
[0041] Figure 10 The levels of cytokines in the body were detected by ELISA after drug administration; left: IL-6; middle: IL-1β; right: TNF-α. Detailed Implementation
[0042] To enable those skilled in the art to better understand the core technology of this invention, the invention will be further described below in conjunction with the accompanying drawings and specific embodiments. It should be understood that, unless otherwise specified, the experimental methods used in the following embodiments are conventional methods.
[0043] Experimental materials: *Escherichia coli* Nissle 1917 (EcN), obtained from the American Technology and Research Center for Biological Standards (ATCC); EcN / ∆tnaA::T7 RNAP can be found in Chinese Patent Application Publication No. CN118028207 A; pRSFDuet-1-CsgA-GS-OVA plasmid was synthesized by Genewiz; arac-ParaBAD-ID52-E-W4A plasmid can be found in Chinese Patent CN 118344442 A; mouse melanoma B16-OVA cells, obtained from the American Technology and Research Center for Biological Standards (ATCC); RAW264.7 cells, obtained from Shanghai Fuheng Biotechnology Co., Ltd. Plasmids pRSF-Duet-1 and pCas9 were purchased from Wuhan Miaoling Biotechnology Co., Ltd., and plasmid pTargetF was purchased from Hangzhou Baosai Biotechnology Co., Ltd.
[0044] Main reagents: Yeast extract and tryptone were purchased from Thermo Fisher Scientific, USA; chloramphenicol, kanamycin, arabinose, etc., were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.; Tris-HCl buffer and PBS solution were purchased from Shanghai Baisai Biotechnology Co., Ltd.; mannitol was purchased from Tianjin Zhiyuan Chemical Reagent Co., Ltd.; DL 2000 DNAMaker was purchased from Sangon Biotech (Shanghai) Co., Ltd.; 2 × ES Taq MasterMix (Dye) was purchased from Kangwei Century Biotechnology Co., Ltd.; plasmid extraction kit, DNA purification and recovery kit, and RNA extraction kit were purchased from Nanjing Novizan Biotechnology Co., Ltd.; qPCR SYBR Green Master Mix was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; OVA 257-264 Peptide lyophilized powder, Sangon Biotech (Shanghai) Co., Ltd.; fetal bovine serum, RPMI 1640 medium, DMEM high glucose medium, Penicillin / Streptomycin, and 0.25% Trypsin-EDTA were purchased from Gibco.
[0045] Example 1: Based on OVA 257-264 Preparation of bacterial shadow tumor vaccines with antigenic peptides
[0046] 1.1 Knockout of the CsgA gene fragment in wild-type EcN strains
[0047] 1.1.1 Construction and Identification of pTargetF-CsgA Plasmid
[0048] The N20 sequence was designed based on the CsgA protein gene sequence of *E. coli* Nissle 1917 (GenBank accession number: XIE57941.1), and the sgRNA for knocking out the csgA gene was designed based on the pTargetF plasmid sequence. Primers for the pTargetF knockout plasmid fragment were designed, with both upper and lower primers containing the gRNA sequence, to obtain the linearized pTargetF fragment. Using the EcN genome as a template, primers were used to amplify the upstream and downstream homologous arms of the target gene. The primer sequences are as follows:
[0049] Table 1 Primers for PCR amplification of linearized pTargetF fragment and upstream and downstream fragments of csgA gene.
[0050]
[0051] A PCR system was prepared, and PCR amplification was performed using plasmid pTargetF and the EcN genome as templates to synthesize linearized pTargetF fragments and upstream and downstream fragments of the csgA gene. The PCR system and procedure are as follows:
[0052] Table 2. Amplification system and reaction procedure for linearized pTargetF fragment and upstream and downstream fragments of CsgA gene.
[0053]
[0054] The three nucleic acid fragments were recovered, and a seamless cloning homologous recombination method was used to perform a recombination reaction on the obtained fragments. The reaction system is as follows:
[0055] Table 3. Recombination and ligation reaction system of linearized pTargetF fragment and upstream and downstream fragments of CsgA gene.
[0056]
[0057] The reaction was carried out at 50°C for 20 minutes, and then immediately placed on ice for 2 minutes.
[0058] The recombinant ligation product was transformed into E. coli DH5α competent cells, and spectinomycin was used as the resistance screening agent. The next day, single clones were picked and colony PCR was performed using specific primers. Positive clones with the correct band size were sequenced. The plasmid of the correctly sequenced positive clone was the successfully constructed knockout plasmid, named pTargetF-CsgA.
[0059] 1.1.2 Knockout of the csgA gene fragment in EcN / ΔtnaA::T7 RNAP strain
[0060] EcN / ΔtnaA::T7 RNAP competent cells were prepared, and the pCas9 plasmid was transformed into EcN / ΔtnaA::T7 RNAP competent cells by electroporation, followed by 2.0 kV electroporation. The next day, single clones were picked, and colony PCR was performed using specific primers. Positive clones with the correct band size were sequenced for verification, and positive transformants were stored in glycerol tubes.
[0061] Take 10-20 μL of the above strain and inoculate it into spectinomycin-resistant liquid LB medium. Incubate overnight at 30°C with shaking. The next day, transfer it to fresh medium at a ratio of 1:100 and incubate at 30°C and 200 rpm until OD600 = 0.2-0.3. Add L-arabinose to a final concentration of 0.5 mg / L to induce recombinant enzyme. Incubate for another hour until OD600 = 0.6-0.8. Prepare competent cells and store them in a -80°C freezer.
[0062] Take 100 μL of the above competent cells and add 5-10 μL of pTargetF-CsgA plasmid, place on ice for 5 min; place in the cup of an electroporator (Bio-Rad), electroporate at 2.0 kV, after electroporation, quickly add 1 mL of LB medium, incubate at 30℃ and 220 rpm for 1-1.5 h for recovery, centrifuge at 5000 rpm for 3 min, discard part of the supernatant, resuspend the remaining bacteria, spread on a plate containing kanamycin / spectinomycin double antibody, and incubate overnight at 30℃; the next day, pick single clones, perform colony PCR with specific primers, sequence and verify positive clones with the correct band size, and save positive transformants to glycerol tubes;
[0063] The knockout strain was passaged in LB medium containing 1 mM IPTG until it stopped growing on spectinomycin-resistant LB agar, thus eliminating the pTargetF-CsgA plasmid. The strain was then passaged again at 42°C until it stopped growing on kanamycin-resistant LB agar, thus eliminating the pCas plasmid. The resulting E. coli-deficient strain was named EcN / ΔtnaA::T7RNAP / ΔCsgA.
[0064] 1.2 Construction of recombinant plasmid pRSFDuet-1-CsgA-GS-OVA
[0065] Using pRSF-Duet-1 plasmid and the EcN genome as templates, respectively, seamless cloning homologous recombination was employed to design upstream and downstream primers (including homologous arms). The primer sequences are as follows:
[0066] Table 4. Linearized pRSF-Duet-1 fragments and CsgA fusion GS linkers and tumor-associated antigens (antigen peptide gene sequences are shown in SEQ ID NO:1) in the EcN genome. 257-264 Primers for PCR amplification of short peptide fragments and verification primers
[0067]
[0068] Using the EcN genome as a template, the linearized fragment CsgA-GS-OVA was obtained by PCR amplification using primers CsgA-GO-FF / R with upstream and downstream homologous arms. Using plasmid pRSF-Duet-1 as a template, the linearized plasmid pRSF-Duet-1 was obtained by PCR amplification using primers pRSF-ZF / R. A seamless cloning homologous recombination method was used to recombinant the obtained fragments. The recombination ligation product was transformed into E. coli DH5α competent cells. Positive clones were screened using primers YZ-AO-F / R to obtain the recombinant plasmid pRSF-CsgA-GS-OVA. Figure 1 The PCR amplification system and procedure described above are referenced in Table 3.
[0069] 1.3 Preparation of recombinant engineered bacteria
[0070] Take 10 μL of recombinant plasmid pRSF-CsgA-GS-OVA and add it to 100 μL of EcN / ΔtnaA::T7 RNAP / ΔCsgA competent cells. Transform the host bacteria by electroporation. The next day, single clones are picked and colony PCR is performed using specific primers. Positive clones with the correct band size are sequenced for verification. Positive transformants are stored in glycerol tubes to obtain the recombinant engineered bacteria EcN / ΔtnaA::T7 RNAP / ΔCsgA / pRSF-CsgA-GS-OVA.
[0071] The recombinant engineered bacteria were prepared into competent cells again. The arac-ParaBAD-ID52-E-W4A plasmid was transformed into EcN / ΔtnaA::T7 RNAP / ΔCsgA::CsgA-GS-OVA by electroporation. The next day, single clones were picked and colony PCR was performed using specific primers. Positive clones with the correct band size were sequenced for verification. Positive transformants were stored in glycerol tubes to obtain the recombinant engineered bacteria EcN / ΔtnaA::T7 RNAP / ΔCsgA / pRSF-CsgA-GS-OVA+arac-ParaBAD-ID52-E-W4A.
[0072] 1.4 Expression Validation of CsgA-GS-OVA
[0073] (1) Western Blot identification: 20 μg of the bacterial vaccine was transferred to a PVDF membrane after SDS-PAGE electrophoresis and incubated overnight with anti-His tag antibody (1:5000 dilution). The membrane was then incubated with HRP-labeled secondary antibody (1:10000 dilution) for 1-2 h. ECL staining was performed, and a specific band appeared at approximately 15 kDa, consistent with the theoretical molecular weight of the CsgA-GS-OVA fusion protein, indicating successful expression of the fusion protein on the bacterial surface. Figure 2 );
[0074] (2) Transmission electron microscopy observation: Fresh seed liquid was taken and divided into wild-type group (EcN / ΔtnaA::T7 RNAP), mutant group (EcN / ΔtnaA::T7 RNAP / ΔCsgA), and recombinant engineered group (EcN / ΔtnaA::T7 RNAP / ΔCsgA / pRSF-CsgA-GS-OVA) and OD was measured. 600 The bacterial culture was diluted to OD value using LB liquid medium with the corresponding resistance. 600=1.0, take 10 μL of the diluted bacterial suspension and spot it on resistant LB solid medium, and incubate at 26℃ for 72 h to induce expression; gently blow off the E. coli colonies on the plate with 1×PBS, centrifuge at 4000 rpm for 1 min to remove impurities in the medium, and wash twice with 1×PBS; add 5 mL of 2.5% glutaraldehyde electron microscopy fixative and fix overnight (more than 8 h) at 4℃; the next day, centrifuge at 3000 rpm for 5 min at 4℃, discard the supernatant and remove the fixative; soak the bacterial suspension in 5 mL of deionized water for 5 min, centrifuge at 3000 rpm for 5 min at 4℃, discard the supernatant, and repeat 3 times; resuspend the bacterial cells again with an appropriate amount of 1×PBS solution to prepare a bacterial suspension; take 10 μL of the bacterial suspension, drop it onto a copper grid, stain with phosphotungstic acid and observe. In the wild-type group, pili were normally distributed, while in the mutant group, the EcN surface was smooth and without any fibrous material. In the recombinant engineered group, most of the EcN fields showed clustered pili, indicating that the fusion protein was successfully displayed on the EcN outer membrane. Figure 3 ).
[0075] 1.5 Preparation of Recombinant Engineered Bacterial Shadows
[0076] Pick single colonies of EcN / ΔtnaA::T7 RNAP / ΔCsgA / pRSF-CsgA-GS-OVA + arac-ParaBAD-ID52-E-W4A from a plate and incubate in the corresponding LB broth for 10-16 hours; transfer the cultured bacteria to a fresh medium and continue culturing until the bacterial OD... 600 When the concentration of the sample is 0.8-1.2, 1 mM IPTG is added to induce the expression of W4A lysate protein (CsgA-GS-OVA is constitutive expression). After lysis for 1-2 h, the bacterial cell pellet is collected by centrifugation at 4000 rpm for 15 min. β-propiolactone is added at a volume ratio of 1:1000 (bacterial cell pellet to β-propiolactone), and the bacteria are inactivated at 4℃ for 12 h. The inactivated bacterial solution is placed in a water bath at 37℃ for 3 h to hydrolyze the remaining β-propiolactone. The bacterial cell pellet is collected by centrifugation at 4000 rpm for 15 min, washed 2-3 times with 1×PBS, and finally 20% mannitol solution is added. The sample is pre-frozen at -80°C for 24 h, then freeze-dried in a vacuum freeze dryer and stored at -80℃ for later use to obtain Escherichia coli serotype (EcN-AO).
[0077] Example 2: Evaluation of the in vitro stimulatory effect of engineered bacterial imager (EcN-AO) on immune cells
[0078] To investigate the regulatory effect of EcN-AO on RAW264.7 macrophages, RAW264.7 cells were 2 × 10⁻⁶ cells / cells. 5 / wells were seeded into 12-well plates, and the following groups were set up: Control group (DMEM basal medium), OVA group (antigen peptide alone), BGs group (bacterial shadow group alone), OVA + BGs group (antigen peptide and bacterial shadow physically mixed and administered), and AO-BGs group (CsgA fusion antigen peptide co-expression) (bacterial shadow drug concentration was 10 μg / ml, and OVA short peptide concentration was 1 μg / ml). The plates were incubated for 24 h (n=3), and then centrifuged (500× g, 5 min). After centrifugation, the supernatant of the medium was collected and stored at -80℃ for cytokine detection.
[0079] The collected cells were used to detect genes related to macrophage polarization: M1 macrophage marker genes (TNF-α, IL-6) and M2 macrophage marker genes (Arg-1, CD206). Specifically, total RNA was extracted from the cells using an RNA extraction kit, reverse transcribed into cDNA using reverse transcriptase, and then, using the cDNA as a template, a qPCR reaction system was prepared according to the SYBR Green qPCR Supermix instructions. Real-time quantitative PCR was used for detection. β-actin was used as an internal control gene, and the reaction was performed according to a 2... -△△Ct The relative expression levels of the target gene mRNA were calculated using a method similar to that used in traditional Chinese medicine. The concentrations of IL-6 and TNF-α in the culture supernatant were detected using an ELISA kit. Results showed that, compared with the groups treated alone or in combination with OVA short peptide and BGs, BGs-AO had a superior effect in regulating the polarization of RAW264.7 macrophages to M1 (p < 0.001). Figure 4-5 The secretion of cytokines IL-6 and TNF-α was also significantly increased (p < 0.001). Figure 6 ).
[0080] The cytotoxicity of BGs and BGs-AO to RAW264.7, B16-OVA, and NIH / 3T3 cells was investigated using the CCK-8 assay. RAW264.7, B16-OVA, and NIH / 3T3 cells were cultured at 5 × 10⁻⁶ cells / mL. 3Cells were seeded in 96-well plates and incubated overnight. Then, 100 μL of DMEM, BGs, and BGs-AO (concentrations: 0.1 to 1000 μg / mL) were added. After 24 h of incubation, 10 µL of CCK-8 solution was added and incubated for 2 h. The absorbance of cells at 450 nm was measured using a microplate reader. Cell viability was defined as the ratio of the absorbance of each sample to the absorbance of the DMEM group. Within the tested concentration range, BGs and BGs-AO showed no significant cytotoxicity to any of these three cell types. Figure 7 ).
[0081] Example 3: Efficacy of EcN-AO Vaccine In Vivo Immunotherapy
[0082] Six- to eight-week-old female C57BL / 6 mice were subcutaneously injected with 2×10⁻⁶ cells on the right back. 5 A mouse model bearing tumor was established using B16-OVA melanoma cells. Mice were randomly divided into 5 groups of 5 mice each: a model control group (subcutaneously injected with PBS), an antigen peptide OVA group (subcutaneously injected with OVA), and a control group (…). 257-264 The dosage was 40 μg / animal. The empty bacterial vector (BGs) group (subcutaneous injection of empty bacterial vector, dosage 0.5 mg / animal) and the antigen peptide mixed empty bacterial vector (BGs + OVA) group (subcutaneous injection of OVA) were also included. 257-264 Physically mixed empty bacterial vectors were administered at doses of 40 μg and 0.5 mg / animal, respectively. The engineered bacterial vector vaccine BGs-AO group was administered the vaccine subcutaneously at a dose of 0.5 mg / animal, with subcutaneous injections on days 4, 8, and 12.
[0083] Tumor volume (volume = length × width² / 2) was measured every two days, and mouse survival time was recorded. Results showed that the tumor volume of mice in the engineered bacterial shadow vaccine BGs-AO group was (51.6 ± 18.2) mm³ 17 days after vaccination, significantly smaller than that of the model control group (413.0 ± 149.3) mm³, the antigen peptide OVA group (229.3 ± 149.3) mm³, the empty bacterial shadow BGs group (152.3 ± 56.57) mm³, and the antigen peptide mixed empty bacterial shadow BGs + OVA group (109.43 ± 37.74) mm³ (p < 0.05). Figure 8 A); Mice in the engineered bacterial shadow vaccine BGs-AO group did not die or reach the ethical endpoint of tumor volume during treatment, and their survival time was significantly longer than that of the model control group (25 days), the antigen peptide OVA group (34 days), the empty bacterial shadow BGs group (42 days), and the antigen peptide mixed empty bacterial shadow BGs+ OVA group (44 days), indicating that the BGs-AO vaccine can effectively inhibit melanoma growth and prolong the survival of tumor-bearing mice. Figure 8B).
[0084] Total RNA was extracted from mouse tumor tissue using the Trizol method, and cDNA was synthesized by reverse transcription. RT-qPCR was then performed to detect the relative expression levels of macrophage polarization-related genes—M1 macrophage marker genes (iNOS, IL-6) and M2 macrophage marker genes (Arg-1, IL-10)—using β-actin as an internal reference gene. The results showed that the relative expression levels of iNOS and IL-6 in the BGs-AO group were 3.0 ± 0.7 times and 135.7 ± 115.3 times that of the model control group, respectively, while the relative expression levels of Arg-1 and IL-10 were only 0.10 ± 0.05 times and 0.38 ± 0.1 times that of the model control group, respectively. This indicates that BGs-AO can significantly promote macrophage polarization towards the M1 phenotype in the tumor microenvironment. Figure 9 ).
[0085] Orbital venous blood was collected from mice, and plasma was separated by centrifugation. The levels of inflammatory factors IL-6, TNF-α, and IL-1β in the plasma were detected using an ELISA kit. The results showed that the plasma IL-6 concentration in the BGs-AO group was (386.6±115.0) pg / mL, TNF-α concentration was (1513±545.9) pg / mL, and IL-1β concentration was (1071±81.9) pg / mL, all significantly higher than those in the model control group (IL-6: 27.49±8.843 pg / mL; TNF-α: 813.6±54.22 pg / mL; IL-1β: 178.7±21.95 pg / mL), and also higher than the concentrations of the individual antigen peptide, bacterial shadow, and the combined groups of both. Figure 10 This indicates that BGs-AO can regulate the body's systemic inflammatory response and enhance anti-tumor immune effects.
[0086] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
[0087] The sequences used in this invention are as follows:
[0088] SEQ ID NO:1:AGCATCATCAACTTCGAGAAGCTG
[0089] SEQ ID NO:2: GGCGGCGGTAGCGGTGGCGGTAGCGGAGGCGGTAGC
[0090] SEQ ID NO:3:GAAGAAATACGATATTCCGGTGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
[0091] SEQ ID NO:4:ATCATCAGTATGAAAAGAAACGTTTTAGAGCTAGAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
[0092] SEQ ID NO NO:5:ATGAAACTTTTAAAAGTAGCAGCAATTGCAGCAATCGTATTCTCCGGTAGCGCTCTGGCAGGTGTTGTTCCTCAGTACGGCGGCGGCGGTGGCAACCACGGTGGTGGCGGTAATAACAGCGGTCCGAATTCAGAGCTGAATATTTACCAGTACGGTGCGGTAACTCTGCTCTTGCTCTGCAAGCTGACGCCCGTAACTCTGATCTGACCATTACCCAGCACGGCGGCGGTAATGGCGCAGATGTGGGCCAAGGTTCTGATGACAGCTCA ATCGATCTGACTCAGCGTGGTTTCGGCAACAGCGCTACTCTTGATCAGTGGAATGGTAAAGATTCTACTATGACTGTTAAAACGTTCGGTGGCGGTAACGGTGCTGCTGTTGACCAGACTGCATCTAACTCCAGCGTTAACGTCACTCAGGTTGGCTTTGGTAAACGCGACCGCTCATCAGTACGGCGGCGGTAGCGGTGGCGGTAGCGGAGGCGGTAGCAGCATCAACTTCGAGAAGCTGGGCAGCCACCATCATCACCATCACTAA
Claims
1. A fungal shadow tumor vaccine based on a CsgA fimbrial antigen display system, characterized in that, The method includes bacterial shadows as a carrier and a fusion antigen molecule displayed by the carrier; the fusion antigen molecule comprises a CsgA protein derived from Escherichia coli Nissle1917 and a target tumor antigen peptide, wherein the CsgA protein acts as an outer membrane anchoring molecule to mediate the display of the target tumor antigen peptide on the surface of the bacterial shadow.
2. The bacterial tumor vaccine according to claim 1, characterized in that, The bacterial shadow is a cell-free shell carrier formed by treating Gram-negative bacteria with a phage lysis gene, while retaining an intact outer membrane structure; the phage lysis gene is selected from the mutant ID52-E-W4A of the E gene of ID52 phage.
3. The bacterial tumor vaccine according to claim 1, characterized in that, The target tumor antigen peptide includes one or more of solid tumor antigen peptides and blood tumor antigen peptides.
4. The bacterial shadow tumor vaccine according to claim 1, 2, or 3, characterized in that, The CsgA protein and the target tumor antigen peptide are linked by a (GGGS)3 linker to form a peptide bond, thereby constituting a CsgA-antigen peptide fusion protein; the amino acid sequence of the (GGGS)3 linker is shown in SEQ ID NO:
2.
5. The preparation method according to claim 4, characterized in that, The Escherichia coli Nissle 1917 is EcN / ΔtnaA::T7 RNAP.
6. The method for preparing the bacterial tumor vaccine according to any one of claims 1-5, characterized in that, Includes the following steps: (1) Construction of knockout mutant strain: The gene encoding CsgA protein in the genome of Escherichia coli Nissle 1917 was knocked out to obtain EcNΔcsgA mutant strain; (2) Construction of recombinant expression vector: The gene encoding CsgA protein and the gene encoding the target tumor antigen peptide were cloned in tandem into the expression vector to obtain a recombinant plasmid containing the CsgA-antigen peptide fusion gene; (3) Preparation of recombinant engineered bacteria: The recombinant plasmid described in step (2) is transformed into competent cells of the EcNΔcsgA mutant strain in step (1), and recombinant engineered bacteria that stably express CsgA-antigen peptide fusion protein are screened to obtain the recombinant engineered bacteria. (4) Preparation of bacterial shadows: The recombinant engineered bacteria described in step (3) are lysed using a phage lysis gene-mediated method to remove cell contents and obtain bacterial shadows that retain and display fusion antigen molecules; (5) Separation and purification: The bacterial shadow obtained in step (4) is separated and purified to obtain the bacterial shadow tumor vaccine.
7. The preparation method according to claim 6, characterized in that, The lysis treatment conditions described in step (4) are 37 ± 3℃ for 1 ± 0.5 h of induction culture.
8. The preparation method according to claim 7, characterized in that, The purification process in step (4) includes centrifugation to collect the bacterial shadow precipitate, washing with PBS buffer, adding β-propiolactone to the bacterial shadow precipitate to inactivate it, and washing with PBS buffer.
9. The use of the bacterial tumor vaccine according to any one of claims 1-5 in the preparation of tumor immunotherapy drugs.
10. The application according to claim 9, characterized in that, The immunotherapy drugs exert their therapeutic effects by promoting dendritic cell maturation, enhancing cross-antigen presentation, and inducing macrophage polarization toward the M1 phenotype; the tumors include lung cancer, breast cancer, melanoma, colon cancer, leukemia, lymphoma, and multiple myeloma.