Use of transcription factor tead4 in preventing and treating cisplatin-induced hearing loss

CN122499298APending Publication Date: 2026-08-04THE SECOND AFFILIATED HOSPITAL OF ANHUI MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
THE SECOND AFFILIATED HOSPITAL OF ANHUI MEDICAL UNIV
Filing Date
2026-05-11
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

[0003]以往的研究主要在于解决顺铂处理所造成的氧化应激水平及炎症反应增加,目前为止顺铂的治疗也是使用一些抗氧化剂和抗炎因子,但是由于顺铂损伤的隐蔽性和迟发性,这些药物的治疗效果并不显著

Benefits of technology

1)本发明揭示了在顺铂模型中激活线粒体自噬可以预防顺铂造成的听力损失和耳蜗细胞损伤;

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122499298A_ABST
    Figure CN122499298A_ABST
Patent Text Reader

Abstract

This invention discloses the application of transcription factor TEAD4 in the prevention and treatment of cisplatin-induced hearing loss, belonging to the field of hearing loss treatment technology. Specifically, this invention relates to the application of TEAD4-targeting agonists or USP30-targeting inhibitors in the preparation of drugs for the prevention or treatment of platinum-based chemotherapy-induced hearing loss. The TEAD4-targeting agonists are substances capable of increasing TEAD4 gene expression or protein activity, including expression vectors containing the TEAD4 gene sequence, recombinant viruses, or recombinant plasmids; the USP30-targeting inhibitors are substances capable of reducing USP30 gene expression or protein activity, including the small molecule compound FT3967385, specific small interfering RNA targeting the USP30 gene, or short hairpin RNA. This invention reveals that activating mitophagy in a cisplatin model can prevent cisplatin-induced hearing loss and cochlear cell damage, and that regulating TEAD4 and USP30 at the cellular, cochlear explant, and in vivo levels significantly prevents cisplatin-induced hearing loss and cochlear cell damage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of hearing loss treatment technology, specifically to the application of transcription factor TEAD4 in the prevention and treatment of cisplatin-induced hearing loss. Background Technology

[0002] Chemotherapy drugs (such as cisplatin) are the most representative ototoxic drugs. Although indispensable in anti-cancer treatment, their severe ototoxic side effects cause irreversible hearing loss in millions of patients worldwide every year. This damage is insidious and delayed-onset; by the time symptoms appear, hair cells have often died in large numbers, missing the golden window for intervention. Even more serious is the long-standing clinical dilemma of "high demand, low supply" in my country, where there is still a lack of approved drugs for the prevention or treatment of drug-induced hair cell damage. Therefore, overcoming the challenge of preventing and treating drug-induced hearing loss is a key breakthrough in reducing the incidence of sensorineural hearing loss and alleviating the disability burden on families and society. The ototoxicity caused by cisplatin mainly triggers oxidative stress, inflammatory responses, and apoptosis cascades within cochlear hair cells. Although cellular processes such as mitochondrial autophagy are known to play important roles, the precise molecular regulatory network remains incompletely elucidated.

[0003] Previous research has primarily focused on addressing the increased oxidative stress and inflammatory response caused by cisplatin treatment. Current cisplatin treatments utilize antioxidants and anti-inflammatory agents, but due to the insidious and delayed nature of cisplatin-induced damage, the therapeutic effects of these drugs are not significant. Numerous studies have demonstrated the involvement of various cellular processes such as autophagy and apoptosis in cisplatin-induced damage, but the specific mechanisms of action remain unclear. Therefore, no specific drugs have yet been discovered for treating or preventing cisplatin-induced damage.

[0004] On the other hand, in existing technologies, TEAD4 is a key transcription factor downstream of the Hippo signaling pathway, often co-activated with YAP / TAZ to regulate cell proliferation, differentiation, apoptosis, and tumorigenesis. In cancers (such as nasopharyngeal carcinoma and ovarian cancer), it often functions as an oncogene or master regulator. The applications of TEAD4, particularly in the treatment or prevention of cisplatin-induced hearing loss, require further investigation. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention proposes the application of transcription factor TEAD4 in the prevention and treatment of cisplatin-induced hearing loss.

[0006] The objective of this invention can be achieved through the following technical solutions: A first aspect of the present invention relates to the use of an agonist that upregulates TEAD4 or an inhibitor that downregulates USP30 in the preparation of a medicament for the prevention or treatment of hearing loss induced by platinum-based chemotherapy drugs.

[0007] Optionally, the agonist that targets and upregulates TEAD4 is a substance that can increase TEAD4 gene expression or protein activity, including expression vectors containing the TEAD4 gene sequence, recombinant viruses, or recombinant plasmids; the inhibitor that targets and downregulates USP30 is a substance that can reduce USP30 gene expression or protein activity, including the small molecule compound FT3967385, specific small interfering RNA targeting the USP30 gene, or short hairpin RNA.

[0008] Optionally, the recombinant virus containing the TEAD4 gene sequence is an adeno-associated virus vector.

[0009] Optionally, the intracellular mechanism of action of the drug includes: inhibiting USP30-mediated removal of the K48-linked ubiquitin chain on UBXD1, promoting the translocation of UBXD1 and VCP proteins to mitochondria, thereby activating mitophagy and reducing oxidative stress and apoptosis levels.

[0010] Optionally, the hearing loss is caused by the platinum-based chemotherapy drug cisplatin.

[0011] A second aspect of the invention relates to a pharmaceutical composition comprising the above-described agonist that upregulates TEAD4 or an inhibitor that downregulates USP30.

[0012] Optionally, the dosage form of the pharmaceutical composition is configured for local administration to the inner ear.

[0013] A third aspect of the present invention relates to a method for in vitro screening of potential candidate drugs for the prevention or treatment of platinum-based chemotherapy-induced hearing loss, comprising the following steps: (1) Contact the candidate drug with in vitro cultured auditory cells or isolated cochlear explant models that have been damaged by cisplatin stress; (2) Detect the gene expression level or protein activity of TEAD4 and / or USP30 in the cells or tissues; (3) Compared with the control group without the addition of candidate drugs, select candidate drugs that can significantly upregulate TEAD4 expression / activity and / or significantly downregulate USP30 expression / activity.

[0014] Optionally, step (2) may further include: detecting the K48 ubiquitination level of UBXD1 in cells, the mitochondrial translocation abundance of UBXD1, or the expression level of mitophagy markers.

[0015] A fourth aspect of the present invention relates to the use of the TEAD4 gene or its expression product, and the USP30 gene or its expression product as combined biomarkers in the preparation of a detection kit for in vitro assessment of the degree of ototoxicity of platinum-based drugs or the state of cochlear cell damage.

[0016] The beneficial effects of this invention are: 1) This invention reveals that activating mitophagy in a cisplatin model can prevent cisplatin-induced hearing loss and cochlear cell damage; 2) This invention reveals that at the cellular, cochlear explant, and in vivo levels, regulating TEAD4 and USP30 significantly prevents cisplatin-induced hearing loss and cochlear cell damage. 3) This invention systematically elucidates the mechanism of action of the TEAD4-USP30-UBXD1 axis in the cisplatin-induced damage model, providing a new target for the prevention and treatment of drug-induced deafness in clinical practice. Attached Figure Description

[0017] The invention will now be further described with reference to the accompanying drawings.

[0018] Figure 1 The role and mechanism of the TEAD4-USP30-UBXD1 axis in the cisplatin damage model in the embodiments of this application; Figure 2 The cisplatin treatment in the embodiments of this application resulted in an increase in USP30 expression; Figure 3 Inhibiting USP30 expression can promote the clearance of damaged mitochondria; Figure 4 Inhibiting USP30 expression can promote mitophagy. Figure 5 In this embodiment, suppressing USP30 can reduce HEI-OC1 damage caused by cisplatin; Figure 6 Inhibition of USP30 in the embodiments of this application can reduce cisplatin-induced hair cell damage. Figure 7 In this embodiment of the application, USP30 can interact with UBXD1, and cisplatin causes UBXD1 to degrade via autophagy. Figure 8 In this application example, USP30 inhibits mitochondrial translocation of UBXD1 to VCP by removing the K48 ubiquitin chain of UBXD1. Figure 9 In the embodiments of this application, cisplatin treatment resulted in increased USP30 transcription levels and decreased expression of transcription factor TEAD4. Figure 10 The transcription factor TEAD4 in this application example binds. Usp30 Transcription of USP30 is inhibited within 2000bp upstream of the promoter. Figure 10 In this embodiment of the application, upregulating TEAD4 activates mitophagy, reducing cisplatin-induced oxidative stress and apoptosis; Figure 11 In this application example, TEAD4 upregulation at the cellular level promotes mitophagy in HEI-OC1 cells; Figure 12 In this application example, upregulating TEAD4 at the cellular level reduced cisplatin-induced HEI-OC1 cell damage. Figure 13 In this embodiment of the application, upregulating TEAD4 at the in vivo level can salvage hearing loss caused by cisplatin.

[0019] Figure 14 In this embodiment of the application, upregulating TEAD4 at the in vivo level can salvage hair cell loss and synaptic damage caused by cisplatin. Detailed Implementation

[0020] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] Example 1. Overall mechanism of action of the TEAD4-USP30-UBXD1 axis in a cisplatin-induced damage model. like Figure 1 As shown, this invention systematically elucidates the core regulatory role and mechanism of the TEAD4-USP30-UBXD1 axis in a cisplatin (CDDP) injury model. TEAD4, as an upstream regulator, inhibits USP30 expression, thereby affecting UBXD1 and its mediated mitophagy, ultimately protecting cochlear hair cells.

[0022] Example 2. Cisplatin damage caused an increase in USP30 expression, and inhibition of USP30 activated mitophagy.

[0023] To verify the target value of USP30 in cisplatin-induced damage, this invention investigated the expression of USP30 and its effect on mitophagy.

[0024] HEI-OC1 cell model establishment steps: HEI-OC1 cells were co-cultured with different concentrations of cisplatin for 24 hours. CCK-8 assays showed a dose-dependent decrease in cell viability, with the 20 μM cisplatin treatment group showing a cell survival rate of approximately 50%. Based on this result, a 20 μM cisplatin concentration was used in subsequent experiments. Western blot and TUNEL staining confirmed that cisplatin exposure significantly increased the apoptosis level of HEI-OC1 cells.

[0025] In vivo mouse model construction steps: To establish an acute cisplatin-induced hearing loss model in mice, 30-day-old C57BL / 6J mice were randomly divided into two groups (control group and treatment group). All mice received an intraperitoneal injection of furosemide (200 mg / kg). 30 minutes later, the control group mice were injected intraperitoneally with saline, while the treatment group mice were injected intraperitoneally with cisplatin (0.5 mg / kg-1 mg / kg). One hour after the second injection, both groups were injected intraperitoneally again with 500 μL of saline. On day 7 after cisplatin administration, all experimental indicators were measured. Auditory brainstem response and myoosin7a staining results showed that an acute cisplatin-induced hearing loss model could be successfully established with 0.5 mg / kg.

[0026] Cochlear explant model: The basilar membrane of the cochlea of ​​mice 3 days after birth was cultured in vitro and incubated for 24 hours with different concentrations of cisplatin. Immunofluorescence staining and hair cell counting showed that cisplatin concentrations exceeding 150 μM caused dose-dependent hair cell damage in the apical, middle, and basal gyri. Western blot results showed that the level of activated caspase-3 protein was significantly increased after treatment with 150 μM cisplatin.

[0027] like Figure 2 As shown in the AF western blot and grayscale results, the expression level of USP30 was significantly increased in cell models, cochlear explant models and in vivo mouse models after cisplatin injury.

[0028] Furthermore, this invention utilizes the small molecule inhibitor FT3967385 (FT385) of USP30 for intervention. The results are as follows... Figure 3 and Figure 4 As shown, treatment with FT3967385 significantly increased the level of mitochondrial autophagy in both cell and cochlear explant models, demonstrating that inhibiting USP30 is an effective way to reactivate damaged mitochondrial autophagy.

[0029] Further Western blot experiments, such as Figure 3 A, B and their corresponding quantitative results Figure 2 As shown in D and E, cisplatin led to a significant accumulation of mitochondrial matrix / inner membrane proteins (such as HSP60, TOM20, and COXIV) in HEI-OC1 cells and cochlear explants, indicating impaired mitophagy; while FT3967385 treatment significantly reduced the accumulation of these proteins. Nucleus / cytoplasm separation experiments (such as...) Figure 3 (As shown in C and F in the figure) further revealed that cisplatin reduced the level of the autophagy marker LC3B-II in the mitochondrial components, while FT3967385 pretreatment restored its enrichment in the mitochondrial components.

[0030] In addition, the mCherry-LC3B / GFP-LC3B / BFP-mito multicolor fluorescence system and COX8-mCherry / COX8-EGFP dual fluorescent probes (such as...) were used. Figure 4 As shown in the figure, it is intuitively demonstrated that cisplatin damage leads to the obstruction of the fusion process of mitochondrial delivery to lysosomes (reduction of mitochondrial autophagosomes), while inhibiting USP30 can strongly promote the delivery and degradation of damaged mitochondria.

[0031] In this embodiment, FT3967385 originates from MedChemExpress (HY-145337). Those skilled in the art will understand that, in addition to the specific substances in the examples, other nucleic acid constructs that can specifically upregulate TEAD4 expression, or compounds that specifically inhibit USP30 activity (listing one or two similar compounds), can be used to achieve the purpose of this invention.

[0032] Example 3. Inhibition of USP30 significantly reduced cisplatin-induced oxidative stress and apoptosis. Based on the activation of mitophagy, this invention further evaluated the cell's survival status. For example... Figure 5 As shown in the AD diagram, reactive oxygen species staining and oxidative stress marker (4-HNE) Western blot results revealed that cisplatin damage significantly increased the oxidative stress level in HEI-OC1 cells. Furthermore, as... Figure 6 As shown in F and G, cisplatin also caused a dramatic increase in oxidation levels in cochlear cells. In contrast, as... Figure 5 (AD) Figure 6 As shown in (F, G), pretreatment or cotreatment with a small molecule inhibitor of USP30 significantly reduced oxidative stress levels in cells and cochlear explants. TUNEL staining results and their quantification (e.g., Figure 5 Inhibition of USP30 (as shown in E and G in the figure) significantly reduced cisplatin-induced apoptosis. Furthermore, Myosin7a immunofluorescence staining of cochlear explants (as shown in the figure)... Figure 6 As shown in the AD diagram, the hair cell morphology of the apical, middle, and basal cochlear rings is fully displayed. The results clearly show that cisplatin caused severe hair cell disorder and extensive loss, while the addition of the USP30 inhibitor effectively protected the morphology and number of hair cells in each region.

[0033] Western blot quantitative analysis (such as...) Figure 5 F, H and Figure 6Figures E and G in the diagram confirm the significant inhibitory effect of FT3967385 on the increase of cleaved-CASP3. This result indicates that inhibiting the activation of mitophagy by USP30 can effectively translate into resistance to cellular oxidative stress and apoptosis.

[0034] Example 4. Molecular mechanism by which USP30 inhibits mitophagy via deubiquitination. To further explore the specific pathways by which USP30 inhibits mitophagy, this embodiment further verifies the mechanism.

[0035] like Figure 7 As shown in Figure A, immunoprecipitation combined with protein proteometry (IP-Mass) analysis revealed that UBXD1 and VCP interact with USP30. Further verification via Co-IP (co-immunoprecipitation) yielded the following results. Figure 7 As shown in Figure B, USP30 and UBXD1 interact. This was confirmed by western blot and quantitative analysis. Figure 7 CF studies showed that cisplatin treatment significantly decreased UBXD1 protein expression, and this decrease was attributed to UBXD1 degradation via autophagy. Subsequently, regulation of the K48 ubiquitin chain significantly affected the mitochondrial translocation of UBXD1.

[0036] Next, we found that inhibiting USP30 reduced the ubiquitination level of UBXD1. Figure 8 A) Experiments combining specific ubiquitin chain mutants (e.g.) Figure 8 (As shown in B) further confirms that USP30 specifically removes the K48-linked ubiquitin chain on UBXD1. Western blot validation of cytoplasmic / mitochondrial component separation (as shown in B) Figure 8 As shown in C, D, J, and K), it conclusively demonstrates that FT3967385 treatment promotes the significant enrichment of UBXD1 and downstream VCP in mitochondrial components. Immunofluorescence co-localization assays (such as...) Figure 8 As shown in EI, it intuitively reflects that inhibiting USP30 can significantly promote the colocalization and translocation of UBXD1 to mitochondria (labeled with TOM20).

[0037] Based on the above molecular evidence, this embodiment draws the following conclusion: USP30, by abnormally removing the K48 ubiquitin chain of UBXD1, hinders the recruitment of the UBXD1-VCP complex to mitochondria, thereby blocking the degradation of mitochondrial outer membrane proteins and the initiation of the mitophagy pathway from the source.

[0038] Example 5. TEAD4 as an upstream transcriptional repressor of USP30 Having clarified the pathogenic mechanism of USP30, this embodiment further traces upstream to find the core regulatory factors.

[0039] like Figure 9 As shown in A, B, and C, cisplatin treatment led to an increase in USP30 mRNA levels in all three models: cellular, cochlear explant, and in vivo injury. Figure 9 The results of the dual-luciferase assay for D showed that cisplatin treatment led to Usp30 The transcriptional activity was significantly increased.

[0040] We predicted TEAD4 to be a transcription factor for USP30 using the JASPAR database. Figure 9 As shown in the DJ, the expression level of TEAD4 protein in all three models was significantly reduced, and the two showed a negative correlation.

[0041] To confirm whether this negative correlation is due to direct transcriptional regulation, [further investigation was conducted]. Tead4 Experiments related to overexpression regulation. For example... Figure 10 As shown in A, B, C, and D, overexpression of Tead4 significantly reduced both USP30 mRNA and protein levels. Furthermore, in the cisplatin-induced injury model, overexpression of Tead4 significantly decreased USP30 mRNA levels. Figure 10 G) Further CUT-Tag experimental results (such as) Figure 10 As shown in D, E, and F, it is conclusive that the transcription factor TEAD4 directly binds 2000 bp before the transcription start site of USP30. In summary, this demonstrates that TEAD4 is a key transcriptional repressor of USP30.

[0042] To demonstrate the causal relationship of transcriptional regulation, validation was performed in an in vitro cell model; Western blot and quantitative results (e.g.) Figure 10 As shown in AD (in the diagram), overexpression of TEAD4 (Flag-Tead4) can strongly suppress and even reverse the abnormal increase in USP30 protein and mRNA levels induced by cisplatin. At the molecular binding mechanism level, this embodiment provides a series of primers targeting the first 2000 bp region of the USP30 promoter transcription start site (TSS). Subsequent CUT&Tag-qPCR / ChIP-qPCR experiments provided conclusive evidence: overexpression of TEAD4 resulted in a high enrichment of DNA fragments in the regions corresponding to primers 8, 9, and 10, physically confirming that TEAD4 exerts its targeted transcriptional repression effect by directly binding to specific regions of the USP30 promoter.

[0043] The primer sequences are as follows: Primer 8: SEQ ID No.1:Forward_TGTGGTGCACGCGTGTATATG; SEQ ID No.2:Reverse_GCACACACGCATGCACATTT; Primer 9: SEQ ID No.3:Forward_ GAGTGTAAGTGCAGGCATATGC SEQ ID No.4:Reverse_ATGTGGGGTTAGCAAGATGG Primer 10: SEQ ID No.5:Forward_CATGAACCAAGCTCCGTCCT SEQ ID No.6:Reverse_ATAGTGAACGGACGACCCCT Example 6. Upregulating TEAD4 to activate mitophagy and resist cisplatin toxicity Based on the above regulatory relationship, this invention verifies the therapeutic potential of directly regulating TEAD4. For example... Figure 11 As shown in A and B, overexpression of TEAD4 significantly increased the number of intracellular mitochondrial autophagosomes. The dual-fluorescent probe COX8-mCherry / EGFP experiment clearly demonstrated that upregulation of TEAD4 maintained efficient delivery of damaged mitochondria to lysosomes even under cisplatin pressure. This restoration of autophagic flux was accompanied by a significant reduction in the accumulation of mitochondrial proteins (TOM20, COXIV) (e.g., ...). Figure 11 (As shown in C and D in the figure), the above results indicate that by targeting and upregulating the expression of TEAD4, the transcription of downstream USP30 can be effectively inhibited, thereby successfully activating mitophagy.

[0044] like Figure 12 As shown, this activation of mitophagy ultimately resulted in a significant reduction in cisplatin-induced cellular oxidative stress and a reversal of apoptosis levels.

[0045] The Cox8-EGFP-mCherry tool, developed by Shanghai Hanheng Biotechnology, works by fusing the leader peptide sequence of the mitochondrial inner membrane protein Cox8 with the EGFP-mCherry fluorescent tandem sequence. In the cytoplasm, both red and green fluorescent proteins are expressed simultaneously, resulting in a yellow color. If mitophagy occurs, the green fluorescent protein is quenched in the autolysosomes due to their acidic environment, leaving only a red fluorescent signal. Therefore, the level of mitophagy can be measured by counting the number of red fluorescent spots.

[0046] Antibodies involved: anti-UBXD1 (1:200, Proteintech, 14706-1-AP); anti-VCP (1:200, Abcam, ab109240); anti-Myosin7a (1:1000, Proteus Bioscience, 25-6790).

[0047] The specific antibody information used in each embodiment of this application is shown in the table below: Example 7: In vivo upregulation of TEAD4 to salvage cisplatin-induced hearing loss, hair cell and synaptic damage. To verify the actual therapeutic effect of this mechanism in preclinical animal models, this invention conducted experiments in C57BL / 6J wild-type mice at the in vivo level.

[0048] like Figure 13 As shown in Figure A, three days after birth, mice were precisely injected via the posterior semicircular canal with AAV-ie-Control (control group) and AAV-ie-Tead4 virus (overexpression group). ABR audiometry was performed on the mice at 4 weeks of age (e.g.,...). Figure 13 As shown in Figure B), it was confirmed that simple viral injection had no adverse effect on the basic hearing of mice, and cisplatin modeling was subsequently performed.

[0049] Seven days after model creation, both functional and morphological assessments were conducted. Regarding auditory function, such as... Figure 13 The auditory brainstem response (BE) test and CAP audiometry results shown in the figure indicate that upregulation of TEAD4 can significantly salvage the hearing threshold elevation and CAP threshold reduction caused by cisplatin, thus exerting a hearing protective effect. In terms of histological morphology, such as... Figure 14 The cochlear immunofluorescence staining results shown in Figure A indicate that upregulation of TEAD4 significantly prevented cisplatin-induced cochlear hair cell loss. Precise statistical analysis of the number of surviving hair cells (Myosin7a+) in different regions of the cochlea was also conducted. Figure 14 (C represents the middle circle, and D represents the bottom circle) This shows that cisplatin damage leads to extremely severe loss of hair cells in the middle and bottom circles of the cochlea; while the AAV-Tead4 injection group showed excellent protective effects in these key hearing frequency bands (middle and bottom circles), and the number of surviving hair cells was salvaged with extremely high statistical significance.

[0050] like Figure 14 B in the middle circle and for the middle circle ( Figure 14 E in the middle), bottom ring ( Figure 14Quantitative analysis of the number of CTBP2 fluorescent spots on inner hair cells (IHC) in the F) showed that cisplatin not only caused hair cell death but also resulted in a large-scale loss of basal ribbon synapses in surviving hair cells. In contrast, in the TEAD4 overexpression in vivo treatment group, the number of synapses in the middle and basal circles of the cochlea (e.g., Figure 14 As shown in E and F in the figure, TEAD4 was maintained and protected with extremely significant efficacy, confirming that TEAD4 has a comprehensive protective effect against cisplatin ototoxicity, including the rescue of neural connections.

[0051] Among them: 1. Specific definition of AAV-ie serotype: AAV-ie stands for AAV-inner ear. It is a novel synthetic AAV serotype obtained by modifying the capsid protein of existing adeno-associated virus (AAV). Its core defining characteristic is its ability to efficiently and safely infect inner ear tissue cells, especially cochlear support cells.

[0052] Core Definitions and Biological Characteristics Target Specificity: AAV-ie is defined as an inner ear-targeting AAV variant. Compared to traditional serotypes (such as AAV1, AAV8, AAV9, etc.), AAV-ie is specifically optimized for the complex structures of the inner ear.

[0053] Highly effective infection capability: Supporting cells: This is the most prominent feature of AAV-ie. In in vitro experiments, it can infect mouse cochlear supporting cells with a rate of up to 90%; in in vivo experiments (via round window injection), the infection rate can also reach 77%, far exceeding that of traditional serotypes (usually below 20%).

[0054] Hair cells and neurons: In addition to supporting cells, AAV-ie can also efficiently infect inner ear hair cells and spiral neurons (SGNs), showing broad inner ear cell tropism.

[0055] Safety: Studies have confirmed that AAV-ie injection does not affect the morphology of normal hair cells, nor does it cause an increase in the hearing threshold in mice, proving its safety as a carrier.

[0056] Technology Construction and Production: AAV-ie is not a naturally occurring virus, but rather a product of genetic engineering. Matrix origin: It is constructed using AAV-DJ (a synthetic serotype) as its Matrix.

[0057] Key modification: AAV-ie was obtained by inserting an amino acid fragment containing the DGTLAVPFK sequence (a short peptide with cell-penetrating properties) between amino acids N589 and R590 of the VP1 subunit of the AAV-DJ capsid protein.

[0058] 2. Promoter type: A broad-spectrum CAG promoter is used. 3. Species origin (human or mouse) and specific nucleotide sequence information of the TEAD4 gene. TEAD gene species origin: mouse Gene ID: 21679 SEQ ID No. 7: ATTACCTCCAACGAGTGGAGCTCTCCCGACTCCCCCGAGGGGAGCAGCATCTCTGGGGGCAGCCAGGCAC TGGACAAGCCCATCGACAATGATGCAGAGGGTGTATGGAGCCCCGAAATTGAGCGAAGCTTCCAGGAGGC CCTGGCCATCTACCCACCCTGCGGCCGCCGCAAAATTATCCTGACGGAGGAAGGCAAGATGTATGGTCGG AATGAGCTGATCGCACGCCATATCAAGCTCAGGACAGGGAAGACGCGCACAAGGAAGCAGGTCTCCAGCC ACATCCAGGTGCTTGCCCGTCGAAAAGCCCGGGAGATCCAGGCCAAACTCAAGGACCAGGCAGCTAAGAA CAAGGCCCTGCAGAGCATGGCTGCCATGTCGTCCGCACAGATCGTCTCGGCCACAGCCTTCCACAGTAAA ATGGCTCTTGCCCGGGGCCCTGGCTACCCAGCAATCTCAGGGTTTTGGCAAGGAGCTTTGCCAGGCCAAC In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0059] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.

Claims

1. Application of agonists that upregulate TEAD4 or inhibitors that downregulate USP30 in the preparation of drugs for the prevention or treatment of hearing loss induced by platinum-based chemotherapy.

2. The use of the TEAD4-targeting agonist or USP30-targeting inhibitor according to claim 1 in the preparation of a medicament for the prevention or treatment of platinum-based chemotherapy-induced hearing loss, characterized in that... The agonist that targets and upregulates TEAD4 is a substance that can increase TEAD4 gene expression or protein activity, including expression vectors containing the TEAD4 gene sequence, recombinant viruses, or recombinant plasmids; the inhibitor that targets and downregulates USP30 is a substance that can reduce USP30 gene expression or protein activity, including the small molecule compound FT3967385, specific small interfering RNA targeting the USP30 gene, or short hairpin RNA.

3. The use of the TEAD4-targeting agonist or USP30-targeting inhibitor according to claim 2 in the preparation of a medicament for the prevention or treatment of platinum-based chemotherapy-induced hearing loss, characterized in that... The recombinant virus containing the TEAD4 gene sequence is an adeno-associated virus vector.

4. The use of the TEAD4-targeting agonist or USP30-targeting inhibitor according to any one of claims 1 to 3 in the preparation of a medicament for the prevention or treatment of platinum-based chemotherapy-induced hearing loss, characterized in that... The intracellular mechanism of action of the drug includes: inhibiting USP30-mediated removal of the K48-linked ubiquitin chain on UBXD1, promoting the translocation of UBXD1 and VCP proteins to mitochondria, thereby activating mitophagy and reducing oxidative stress and apoptosis levels.

5. The use of the TEAD4-targeting agonist or USP30-targeting inhibitor according to any one of claims 1 to 4 in the preparation of a medicament for the prevention or treatment of platinum-based chemotherapy-induced hearing loss, characterized in that... The hearing loss was caused by the platinum-based chemotherapy drug cisplatin.

6. A pharmaceutical composition, characterized in that, The agonist that upregulates TEAD4 or the inhibitor that downregulates USP30 as described in claim 1 or 2.

7. The pharmaceutical composition according to claim 6, characterized in that, The dosage form of the pharmaceutical composition is configured for local administration to the inner ear.

8. A method for in vitro screening of potential candidate drugs for the prevention or treatment of platinum-based chemotherapy-induced hearing loss, characterized in that, Includes the following steps: (1) Contact the candidate drug with in vitro cultured auditory cells or isolated cochlear explant models that have been damaged by cisplatin stress; (2) Detect the gene expression level or protein activity of TEAD4 and / or USP30 in the cells or tissues; (3) Compared with the control group without the addition of candidate drugs, select candidate drugs that can significantly upregulate TEAD4 expression / activity and / or significantly downregulate USP30 expression / activity.

9. The method for in vitro screening of potential candidate drugs for the prevention or treatment of platinum-based chemotherapy-induced hearing loss according to claim 8, characterized in that, Step (2) further includes: detecting the K48 ubiquitination level of UBXD1 in cells, the mitochondrial translocation abundance of UBXD1, or the expression level of mitophagy markers.

10. Application of TEAD4 gene or its expression product, USP30 gene or its expression product as combined biomarkers in the preparation of a detection kit for in vitro assessment of the degree of ototoxicity of platinum drugs or the state of cochlear cell damage.