Schizochytrium limacinum engineering strain based on RNA inhibition and lipid droplet regulation for high yield of beta-carotene, method and application

Abstract

The application belongs to the field of bioengineering and microbial pharmaceutical technology, and discloses an engineering strain of Schizochytrium sp. for high-yield β-carotene based on RNA inhibition and lipid droplet regulation, a method and application. The engineering strain is obtained by overexpressing endogenous geranylgeranyl pyrophosphate synthase (GGPPS) and silencing the orfA gene of the oil synthesis PKS pathway by RNA interference plasmid tGly-orfA, with Schizochytrium sp. HX-308 as the starting strain. The application significantly improves the synthesis efficiency and intracellular accumulation of β-carotene in Schizochytrium sp. through multidimensional synergistic regulation of precursor supply enhancement, competition branch silencing and product storage optimization, and provides efficient strains and technical support for the industrialized production of medicinal-grade natural β-carotene.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering and microbial pharmaceutical technology, and in particular to a Schizochytrium strain, method and application of high β-carotene production based on RNA inhibition and lipid droplet regulation. Background Technology

[0002] Beta-carotene is a natural fat-soluble carotenoid. As an essential precursor to vitamin A, it plays an irreplaceable role in preventing night blindness, dry eye syndrome, and maintaining retinal function. At the same time, it has extremely strong antioxidant activity, which can scavenge free radicals in the body and inhibit lipid peroxidation. It has clear medicinal and health value in the fields of adjuvant treatment of cardiovascular diseases, protection against oxidative damage from radiotherapy and chemotherapy for tumors, and anti-aging of the skin. It is widely used in the pharmaceutical, food, cosmetic, and feed industries.

[0003] Currently, the supply of β-carotene on the market is mainly divided into two categories: chemical synthesis and natural extraction. Although chemical synthesis yields high output, the product contains a large number of cis isomer impurities, posing potential health risks with long-term use and failing to meet the requirements for high purity and safety of pharmaceutical raw materials. Natural extraction mainly uses plants such as Dunaliella salina and carrots as raw materials, but it suffers from problems such as long fermentation cycles, low extraction rates, high raw material costs, and significant susceptibility to environmental and seasonal influences, making it difficult to achieve stable and large-scale industrial production.

[0004] In recent years, the development of synthetic biology technology has promoted research on heterologous synthesis of β-carotene by microorganisms. Commonly used hosts include Escherichia coli and Saccharomyces cerevisiae. However, these hosts have problems such as weak lipid synthesis capacity, insufficient lipid droplet storage space, and the tendency for intracellular accumulation of β-carotene to cause cytotoxicity, making it difficult to break through the industrialization bottleneck in terms of yield. Schizochytrium sp. is a type of marine oil-producing microorganism that has achieved commercial application. Its safety has been certified by FDA GRAS and evaluated by the European Union EFSA. It has advantages such as fast growth rate, strong lipid synthesis capacity, high intracellular lipid droplet content, and high-density fermentation, making it an ideal chassis host for heterologous synthesis of lipid-soluble β-carotene.

[0005] However, current research on β-carotene production by *Schizochytrium* still faces key bottlenecks: First, *Schizochytrium* naturally synthesizes polyunsaturated fatty acids efficiently via the PKS pathway, sharing core precursors such as acetyl-CoA and malonyl-CoA with β-carotene synthesis, leading to insufficient β-carotene synthesis flux due to precursor competition. Second, although *Schizochytrium* has high lipid droplet content, current modifications have not achieved synergistic regulation of lipid droplet synthesis and β-carotene accumulation, resulting in underutilization of product storage space and the potential for intracellular free β-carotene to cause membrane damage and cytotoxicity. Third, existing engineered strains exhibit poor genetic stability and complex fermentation processes, making it difficult to meet the core requirements of the pharmaceutical industry for strain stability, process controllability, and product safety. Therefore, developing a genetically stable, high-yield, and industrially adaptable engineered strain of *Schizochytrium* for high β-carotene production has significant scientific research value and promising industrial application prospects. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a Schizochytrium strain, method and application that produces high β-carotene based on RNA inhibition and lipid droplet regulation.

[0007] The technical solution adopted by this invention to solve its technical problem is: A Schizochytrium strain that produces high levels of β-carotene based on RNA inhibition and lipid droplet regulation is described. The strain is obtained by overexpressing endogenous gerany gerany pyrophosphate synthase GGPPS and silencing the orfA gene in the lipid synthesis PKS pathway using the RNA interference plasmid tGly-orfA. The gene sequence of the GGPSS gene is SEQ ID No. 12, and the shRNA interference target sequence of the orfA gene is SEQ ID No. 22.

[0008] Furthermore, the preservation number of the Schizochytrium HX-308 is CCTCC No. M209059.

[0009] The method for constructing the engineered strain of Schizochytrium as described above includes the following steps: S1. Construction of recombinant plasmid pZPK-NeoR-GGPSS Using plasmid pZPK as a backbone, NeoR expression cassette and GGPSS expression cassette were inserted into the plasmid backbone to obtain recombinant plasmid pZPK-NeoR-GGPSS; S2. Construction of RNA interference plasmid pZPK-Zeocin-tGly-orfA Using plasmid pZPK as a backbone, a Zeocin expression cassette and a shRNA interference expression cassette targeting the orfA gene were inserted into the plasmid backbone to obtain the RNA interference plasmid pZPK-Zeocin-tGly-orfA; S3. Construction of engineered strains of Schizochytrium, which produce high levels of β-carotene Recombinant plasmids pZPK-NeoR-GGPSS and pZPK-Zeocin-tGly-orfA were introduced into Schizochytrium HX-308 cells, and the engineered strain of Schizochytrium was obtained after double antibiotic screening and molecular verification.

[0010] Further, in step S1, the promoter of the NeoR expression cassette is the P2845 promoter of Schizochytrium, whose gene sequence is SEQ ID No. 6, and the terminator is the T2845 terminator of Schizochytrium, whose gene sequence is SEQ ID No. 9; the promoter of the GGPSS expression cassette is the P3626 promoter of Schizochytrium, whose gene sequence is SEQ ID No. 15, and the terminator is the trpc terminator of Schizochytrium, whose gene sequence is SEQ ID No. 18. In step S2, the promoter of the Zeocyn expression cassette is the P2845 promoter of Schizochytrium, whose gene sequence is SEQ ID No. 6, and the terminator is the T2845 terminator of Schizochytrium, whose gene sequence is SEQ ID No. 9; the promoter of the shRNA interference expression cassette is the P2520 promoter of Schizochytrium, whose gene sequence is SEQ ID No. 25, and the terminator is the CYC1 terminator, whose gene sequence is SEQ ID No. 28.

[0011] Furthermore, in step S3, the import is achieved through an electroconversion method.

[0012] The application of the engineered strains of Schizochytrium as described above in the fermentation production of β-carotene.

[0013] The method for producing β-carotene by fermentation using the engineered strain of Schizochytrium as described above involves fermentation in a shaker at a temperature of 26–30°C for 96–120 h and a rotation speed of 160–200 rpm. Oleic acid OA at a final concentration of 1.5–2.5 mM is added after 12–36 h of fermentation, and the glucose concentration in the fermentation medium is 60–100 g / L.

[0014] Furthermore, the specific steps are as follows: (1) Activate the engineered strain of Schizochytrium. Inoculate the engineered strain of Schizochytrium into seed culture medium and culture it with shaking at 28℃±0.5℃ and 180r / min for 24h to obtain the primary seed liquid. Transfer the primary seed liquid to fresh seed culture medium at an inoculation amount of 2% and amplify it under the same culture conditions for 24h to obtain the secondary seed liquid. Transfer the secondary seed liquid to seed culture medium at an inoculation amount of 2% and culture it under the same parameters for 24h to obtain the fermentation seed liquid. (2) Fermentation of recombinant bacteria: 10% of the fermentation seed liquid was inoculated into the fermentation medium and cultured in a shaker at 28℃ and 180r / min. Oleic acid with a final concentration of 2mM was added after 24h of fermentation. The total fermentation cycle was 120h, and fermentation products containing β-carotene were obtained.

[0015] Further, the seed culture medium has a pH of 6.0-6.5 and comprises: glucose 40-60 g / L, yeast extract 4-6 g / L, sodium sulfate 5-8 g / L, magnesium sulfate 2-4 g / L, ammonium sulfate 4-8 g / L, potassium chloride 1-2 g / L, calcium chloride 0.1-0.2 g / L, potassium sulfate 0.5-1 g / L, potassium dihydrogen phosphate 0.5-2 g / L, monosodium glutamate 8-12 g / L, and heptathione. The concentrations of zinc sulfate hydrate (1–5 mg / L), cobalt chloride hexahydrate (0.01–0.1 mg / L), copper sulfate pentahydrate (2–6 mg / L), nickel sulfate hexahydrate (1–2 mg / L), ferric sulfate heptahydrate (8–15 mg / L), calcium pantothenate (2–4 mg / L), manganese chloride tetrahydrate (3–5 mg / L), and sodium molybdate dihydrate (0.04 mg / L) were determined by water. The mixture was sterilized by autoclaving at 121°C for 60 minutes. The fermentation medium has a pH of 6.0–6.5 and comprises: 60–80 g / L glucose, 8–12 g / L yeast extract, 5–10 g / L sodium sulfate, 2–4 g / L magnesium sulfate, 4–8 g / L ammonium sulfate, 1–2 g / L potassium chloride, 0.1–0.2 g / L calcium chloride, 0.5–1 g / L potassium sulfate, 0.5–2 g / L potassium dihydrogen phosphate, 10–15 g / L monosodium glutamate, and 1–5 mg / L zinc sulfate heptahydrate. The following ingredients were used: cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, ferric sulfate heptahydrate 8–15 mg / L, calcium pantothenate 2–4 mg / L, manganese chloride tetrahydrate 3–5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 4–10 mg / L, and water as the solvent. The mixture was sterilized by high-pressure steam at 121°C for 60 minutes.

[0016] Furthermore, the total oil content in the fermentation product of the engineered strain of Schizochytrium for the production of β-carotene was 24.2 g / L, and the β-carotene yield was 19.8 mg / L.

[0017] The advantages and positive effects of this invention are as follows: 1. This invention significantly improves the synthesis efficiency and intracellular accumulation of β-carotene in Schizochytrium through multi-dimensional synergistic regulation of precursor supply enhancement, competitive pathway silencing, and product storage optimization, providing efficient strains and technical support for the industrial production of pharmaceutical-grade natural β-carotene.

[0018] 2. This invention significantly enhances β-carotene production through synergistic regulation, overcoming core technological bottlenecks: This invention employs a synergistic strategy of "precursor enhancement - competitive blocking - storage optimization," simultaneously overexpressing GGPP synthase, silencing the orfA gene, and regulating lipid droplet synthesis with oleic acid, thereby significantly improving β-carotene synthesis efficiency. Shake-flask fermentation results show that the engineered strain yielded 19.8 mg / L, a 100.4% increase compared to single-gene modified strains, addressing the industry pain point of low biosynthetic efficiency in existing microbial hosts.

[0019] 3. The product of this invention is safe and compliant, and conforms to pharmaceutical raw material production standards: This invention uses commercially available Schizochytrium HX-308, which has passed FDA GRAS certification and EU EFSA safety evaluation, as the chassis. The strain does not produce fungal toxins and has no risk of endotoxins. The fermentation product has no chemical synthesis by-product residues, and the heavy metal and solvent residues meet the limits of pharmaceutical raw materials in the Pharmacopoeia of the People's Republic of China. It avoids the safety risks and quality fluctuations of existing processes and can be directly used for the production of pharmaceutical vitamin A precursor raw materials.

[0020] 4. The process of this invention is robust and easy to scale up, with outstanding industrial cost advantages: The fermentation process of this invention is simple to operate, the parameters are controllable, and it is easy to scale up. The fermentation cycle is only 120 hours, which is much shorter than the 15-20 day production cycle of natural extraction methods, greatly reducing time and energy costs; it can meet the core requirements of industrial continuous fermentation and pharmaceutical raw material production GMP standards; at the same time, it can achieve simultaneous extraction of lipids and β-carotene, significantly simplifying downstream purification steps and further reducing industrial production costs.

[0021] 5. This invention has a wide range of applications and strong technical scalability: The starting strain used in this invention is a commercially available food-grade safe strain, and the product has no pathogenicity or allergenic risk. It can be directly applied to multiple fields such as pharmaceuticals, functional foods, cosmetics, and feed additives. At the same time, the synergistic modification strategy established in this invention can be directly extended to the construction of engineered strains for other fat-soluble high-value-added compounds such as astaxanthin, lycopene, and squalene. The technology has outstanding versatility and industrial expansion value. Attached Figure Description

[0022] Figure 1 This is the pzpk-NeoR-GGPSS spectrum of the plasmid in this invention; Figure 2 This is the pzpk-Zeocin-tGly-orfA spectrum in this invention; Figure 3 The images show the liquid chromatograms of the experimental and control groups of the high-carotene-producing engineered strain BC-03 in this invention.

[0023] The Schizochytrium sp. HX-308 strain used in this invention is a strain already existing in the art. This strain has been deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC No. M209059, as disclosed in Chinese patent publication CN116478835A. It is currently stored at -80 °C in 50% (v / v) glycerol. Detailed Implementation

[0024] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.

[0025] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.

[0026] A Schizochytrium strain that produces high levels of β-carotene based on RNA inhibition and lipid droplet regulation is described. The strain is obtained by overexpressing endogenous gerany gerany pyrophosphate synthase GGPPS and silencing the orfA gene in the lipid synthesis PKS pathway using the RNA interference plasmid tGly-orfA. The gene sequence of the GGPSS gene is SEQ ID No. 12, and the shRNA interference target sequence of the orfA gene is SEQ ID No. 22.

[0027] Furthermore, the preservation number of the Schizochytrium HX-308 is CCTCC No. M209059.

[0028] The method for constructing the engineered strain of Schizochytrium as described above includes the following steps: S1. Construction of recombinant plasmid pZPK-NeoR-GGPSS Using plasmid pZPK as a backbone, NeoR expression cassette and GGPSS expression cassette were inserted into the plasmid backbone to obtain recombinant plasmid pZPK-NeoR-GGPSS; S2. Construction of RNA interference plasmid pZPK-Zeocin-tGly-orfA Using plasmid pZPK as a backbone, a Zeocin expression cassette and a shRNA interference expression cassette targeting the orfA gene were inserted into the plasmid backbone to obtain the RNA interference plasmid pZPK-Zeocin-tGly-orfA; S3. Construction of engineered strains of Schizochytrium, which produce high levels of β-carotene Recombinant plasmids pZPK-NeoR-GGPSS and pZPK-Zeocin-tGly-orfA were introduced into Schizochytrium HX-308 cells, and the engineered strain of Schizochytrium was obtained after double antibiotic screening and molecular verification.

[0029] Further, in step S1, the promoter of the NeoR expression cassette is the P2845 promoter of Schizochytrium, whose gene sequence is SEQ ID No. 6, and the terminator is the T2845 terminator of Schizochytrium, whose gene sequence is SEQ ID No. 9; the promoter of the GGPSS expression cassette is the P3626 promoter of Schizochytrium, whose gene sequence is SEQ ID No. 15, and the terminator is the trpc terminator of Schizochytrium, whose gene sequence is SEQ ID No. 18. In step S2, the promoter of the Zeocyn expression cassette is the P2845 promoter of Schizochytrium, whose gene sequence is SEQ ID No. 6, and the terminator is the T2845 terminator of Schizochytrium, whose gene sequence is SEQ ID No. 9; the promoter of the shRNA interference expression cassette is the P2520 promoter of Schizochytrium, whose gene sequence is SEQ ID No. 25, and the terminator is the CYC1 terminator, whose gene sequence is SEQ ID No. 28.

[0030] Furthermore, in step S3, the import is achieved through an electroconversion method.

[0031] The application of the engineered strains of Schizochytrium as described above in the fermentation production of β-carotene.

[0032] The method for producing β-carotene by fermentation using the engineered strain of Schizochytrium as described above involves fermentation in a shaker at a temperature of 26–30°C for 96–120 h and a rotation speed of 160–200 rpm. Oleic acid OA at a final concentration of 1.5–2.5 mM is added after 12–36 h of fermentation, and the glucose concentration in the fermentation medium is 60–100 g / L.

[0033] Furthermore, the specific steps are as follows: (1) Activate the engineered strain of Schizochytrium. Inoculate the engineered strain of Schizochytrium into seed culture medium and culture it with shaking at 28℃±0.5℃ and 180r / min for 24h to obtain the primary seed liquid. Transfer the primary seed liquid to fresh seed culture medium at an inoculation amount of 2% and amplify it under the same culture conditions for 24h to obtain the secondary seed liquid. Transfer the secondary seed liquid to seed culture medium at an inoculation amount of 2% and culture it under the same parameters for 24h to obtain the fermentation seed liquid. (2) Fermentation of recombinant bacteria: 10% of the fermentation seed liquid was inoculated into the fermentation medium and cultured in a shaker at 28℃ and 180r / min. Oleic acid with a final concentration of 2mM was added after 24h of fermentation. The total fermentation cycle was 120h, and fermentation products containing β-carotene were obtained.

[0034] Further, the seed culture medium has a pH of 6.0-6.5 and comprises: glucose 40-60 g / L, yeast extract 4-6 g / L, sodium sulfate 5-8 g / L, magnesium sulfate 2-4 g / L, ammonium sulfate 4-8 g / L, potassium chloride 1-2 g / L, calcium chloride 0.1-0.2 g / L, potassium sulfate 0.5-1 g / L, potassium dihydrogen phosphate 0.5-2 g / L, monosodium glutamate 8-12 g / L, and heptathione. The concentrations of zinc sulfate hydrate (1–5 mg / L), cobalt chloride hexahydrate (0.01–0.1 mg / L), copper sulfate pentahydrate (2–6 mg / L), nickel sulfate hexahydrate (1–2 mg / L), ferric sulfate heptahydrate (8–15 mg / L), calcium pantothenate (2–4 mg / L), manganese chloride tetrahydrate (3–5 mg / L), and sodium molybdate dihydrate (0.04 mg / L) were determined by water. The mixture was sterilized by autoclaving at 121°C for 60 minutes. The fermentation medium has a pH of 6.0–6.5 and comprises: 60–80 g / L glucose, 8–12 g / L yeast extract, 5–10 g / L sodium sulfate, 2–4 g / L magnesium sulfate, 4–8 g / L ammonium sulfate, 1–2 g / L potassium chloride, 0.1–0.2 g / L calcium chloride, 0.5–1 g / L potassium sulfate, 0.5–2 g / L potassium dihydrogen phosphate, 10–15 g / L monosodium glutamate, and 1–5 mg / L zinc sulfate heptahydrate. The following ingredients were used: cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, ferric sulfate heptahydrate 8–15 mg / L, calcium pantothenate 2–4 mg / L, manganese chloride tetrahydrate 3–5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 4–10 mg / L, and water as the solvent. The mixture was sterilized by high-pressure steam at 121°C for 60 minutes.

[0035] Furthermore, the total oil content in the fermentation product of the engineered strain of Schizochytrium for the production of β-carotene was 24.2 g / L, and the β-carotene yield was 19.8 mg / L.

[0036] Specifically, the relevant preparation and testing methods are as follows: The Schizochytrium sp. HX-308 used in this invention is the strain Schizochytrium sp. HX-308, which has been deposited at the China Center for Type Culture Collection (CCTCC) with accession number M209059, and is a strain disclosed in the prior art.

[0037] A Schizochytrium strain exhibiting high β-carotene production through synergistic silencing of the orfA gene and lipid droplet regulation is disclosed. This strain was obtained by overexpressing the endogenous GGPP synthase gene GGPSS from Schizochytrium HX-308, and simultaneously silencing the orfA gene via the PKS pathway using the RNA interference plasmid tGly-orfA. The gene sequence of the GGPSS gene is SEQ ID No. 12, and the shRNA interference target sequence of the orfA gene is SEQ ID No. 22.

[0038] Furthermore, the promoter of the GGPSS expression cassette is the P3626 promoter of Schizochytrium (SEQ ID No. 15), and the terminator is the trpc terminator of Schizochytrium (SEQ ID No. 18); the promoter of the shRNA interference expression cassette is the P2520 promoter of Schizochytrium (SEQ ID No. 25), and the terminator is the CYC1 terminator (SEQ ID No. 28).

[0039] The method for constructing the genetically engineered strain as described above includes the following steps: 1. Construction of recombinant plasmid pzpk-NeoR-GGPSS.

[0040] 2. Construction of RNA interference plasmid tGly-orfA.

[0041] 3. Construction of engineered strains of Schizochytrium, which produce high levels of β-carotene.

[0042] Furthermore, in step S3, the import is achieved through electroconversion.

[0043] The application of the genetically engineered strains described above in the fermentation production of β-carotene, and the corresponding fermentation production methods.

[0044] Specifically, the relevant preparation and testing methods are as follows: Example 1: Construction of recombinant plasmid pzpk-NeoR-GGPSS This embodiment describes a method for constructing the recombinant plasmid pzpk-NeoR-GGPSS, which includes the following steps performed sequentially: S1. Construction of recombinant plasmid pzpk-NeoR S1.1 Using plasmid pbacNeoR as a template, PCR amplification was performed using NeoR-F (gene sequence as shown in SEQ ID No. 1) and NeoR-R (gene sequence as shown in SEQ ID No. 2) as primers to obtain the NeoR gene (neomycin resistance gene). The nucleotide sequence of the NeoR gene is shown in SEQ ID No. 3. The PCR procedure is as follows: denaturation at 98℃ for 10 seconds, annealing at 57℃ for 10 seconds, extension at 72℃ for 1 minute, repeated for 35 cycles. The NeoR-F gene sequence is shown in SEQ ID No. 1, specifically as follows: caataatattgaaaaaggaagagtatgattgaacaagatggattgc The NeoR-R gene sequence is shown in SEQ ID No. 2, specifically as follows: gagtaaacttggtctgacagtcagaagaactcgtcaagaag The NeoR gene sequence is shown in SEQ ID No. 3, specifically: Atgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctga S1.2 Using the Schizochytrium HX-308 genome as a template, and P2845-F (gene sequence shown in SEQ ID No.4) and P2845-R (gene sequence shown in SEQ ID No.5) as primers for PCR amplification to obtain the promoter P2845 (SEQ ID No.6); S1.3 Using the genome of Schizochytrium HX-308 as a template, PCR amplification was performed using T2845-F (gene sequence as shown in SEQ ID No. 7) and T2845-R (gene sequence as shown in SEQ ID No. 8) as primers to obtain the terminator T2845 (SEQ ID No. 9).

[0045] S1.4 The pZPK plasmid (disclosed in Chinese patent publication CN116478835A) was digested with restriction endonuclease XbaI. The digested pZPK plasmid backbone, promoter P2845, terminator T2845 and NeoR gene were cloned in one step using the ClonExpress MultiS One Step Cloning Kit to construct the pzpk-NeoR plasmid.

[0046] The P2845-F gene sequence is shown in SEQ ID No. 4, and is as follows: gatccaagctcaagctgccatttctcgacacttgtctccg The P2845-R gene sequence is shown in SEQ ID No. 5, specifically as follows: aatccatcttgttcaatcatcttttctctcgcctctcgct The gene sequence of promoter P2845 is shown in SEQ ID No. 6, specifically as follows: The T2845-F gene sequence is shown in SEQ ID No. 7, specifically as follows: ggccaagcaaatgcaatagaaagtcgcacgcgagctttttac The T2845-R gene sequence is shown in SEQ ID No. 8, specifically as follows: gctctagggtagccttatcgaccgacggcttgacctgttg The T2845 terminator gene sequence is shown in SEQ ID No. 9, specifically as follows: aaagtcgcacgcgagctttttacttttcctattattattttttttcttcctccgatccctcttgttgcaccagaaaacaacgcagaaacacgggagcttgacagcgtgaccacaggaaagatactat ggatgagaacggaacgccaggtggaatacagaagtcgagggcatatctttgcgagcaacacatgttcgagccgcggaatcgaccccggacgccatggctggctggctggctgactggctgactgatccatg ctcatgaaagcatggcaactcttgctggcgccggggcctctgtcgctcttgccgcttccgtgccacgttttgcctggacttgctccctttgtttgtttctcgcttccaggtccttctcgcgttctgc ctcttcctcttccctttcccagtcctcttcttcaatatccatgtcgtcgtcttcgaatgcaaagtcacgcgaatcagagccaaattgtgctgcaaattcagcatactgctctagggtagccttatcg S2. Validation of the basic vector for recombinant plasmid pzpk-NeoR The circular recombinant vector pzpk-NeoR was transformed into Escherichia coli DH5α competent cells. The cells were screened by adding LB plates containing G418 at a concentration of 500 μg / mL and verified by colony PCR and sequencing to obtain the positive recombinant plasmid pzpk-NeoR.

[0047] PCR amplification of each element of the S3. GGPSS expression cassette S3.1 Using the genome of Schizochytrium HX-308 as a template, PCR amplification was performed using GGPSS-F (gene sequence shown in SEQ ID No. 10) and GGPSS-R (gene sequence shown in SEQ ID No. 11) as primers to obtain the GGPSS gene (SEQ ID No. 12). S3.2 Using the genome of Schizochytrium HX-308 as a template, PCR amplification was performed using P3626-F (gene sequence shown in SEQ ID No. 13) and P3626-R (gene sequence shown in SEQ ID No. 14) as primers to obtain promoter P3626 (SEQ ID No. 15); S3.3 Using the genome of Schizochytrium HX-308 as a template, PCR amplification was performed using Tprc-F (gene sequence shown in SEQ ID No. 16) and Tprc-R (gene sequence shown in SEQ ID No. 17) as primers to obtain the terminator Tprc (SEQ ID No. 18). S3.4 Use a DNA gel extraction kit to purify and recover each of the above PCR amplification fragments, and check their concentration and purity before use.

[0048] The GGPSS-F gene sequence is shown in SEQ ID No. 10, and is as follows: cgagcttggccatgagcgtcggtctcgtggaaaaggccat The GGPSS-R gene sequence is shown in SEQ ID No. 11, specifically as follows: atggccttttccacgagaccgacgctcatggccaagctcg The GGPSS gene sequence is shown in SEQ ID No. 12, and is as follows: The P3626-F gene sequence is shown in SEQ ID No. 13, specifically as follows: ggcatgaatgaacctgcacgcattttgttgctcaacttgg The P3626-R gene sequence is shown in SEQ ID No. 14, specifically as follows: tttccttgcggctgatttgagttgattccttgtcggttag The P3626 gene sequence is shown in SEQ ID No. 15, specifically as follows: The Tprc-F gene sequence is shown in SEQ ID No. 16, specifically as follows: cacttaacgttatactgaaatcatcaaacagcttgacgaatc The Tprc-R gene sequence is shown in SEQ ID No. 17, specifically as follows: gatttcgaggtttatacctacgatgaatgtgtgtcctgta The Tprc gene sequence is shown in SEQ ID No. 18, specifically as follows: cacttaacgttatactgaaatcatcaaacagcttgacgaatctggatataagatcgttggtgtcgatgtcagctccggagttgagacaaatggtgttcaggatctcgataagatacgttcatttgtccaagcagcaaagag tgccttctagtgatttaatagctccatgtcaacaagaataaaacgcgttttcgggtttacctcttccagatacagctcatctgcaatgcattaatgcattgactgcaacctagtaacgcctttcaggctccggcgaagag aagaatagcttagcagagctattttcattttcgggagacgagatcaagcagatcaacggtcgtcaagagacctacgagactgaggaatccgctcttggctccacgcgactatatatttgtctctaattgtactttgacat gctcctcttctttactctgatagcttgactatgaaaattccgtcaccagcccctgggttcgcaaagataattgcatgtttcttccttgaactctcaagcctacaggacacacattcatcgtaggtataaacctcgaaatc S4. One-step cloning construction of recombinant plasmid pzpk-NeoR-GGPSS S4.1 The pzpk-NeoR plasmid was linearized by restriction endonuclease PmeI. The digestion system is shown in Table 1. After digestion at 37℃ for 4 h, the linearized vector backbone was recovered by gel extraction. Table 1. pzpk-NeoR plasmid digestion system

[0049] S4.2 The linearized pzpk-NeoR vector backbone, along with the P3626 promoter, GGPSS gene, and trpc terminator, were seamlessly cloned using a one-step cloning kit. The cloning system is shown in Table 2. The reaction was carried out at 50℃ for 20 min to complete the construction of the recombinant plasmid. Table 2 One-step cloning system

[0050] S4.3 The recombinant product was transformed into *E. coli* DH5α competent cells. Positive clones were screened using LB agar plates containing 500 μg / mL G418. The sequences were verified by colony PCR, restriction enzyme digestion, and sequencing, showing a 100% sequence accuracy, thus yielding the positive recombinant plasmid pzpk-NeoR-GGPSS. (See figure) Figure 1 .

[0051] The PrimeSTAR Max DNA polymerase used for PCR amplification was purchased from TAKARA, and the one-step cloning kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0052] Example 2: Construction of RNA interference plasmid tGly-orfA This embodiment describes a method for constructing the RNA interference plasmid tGly-orfA targeting the orfA gene, including the following steps performed sequentially: S1. Construction of recombinant plasmid pzpk-Zeocin S1.1 Using plasmid pPICZαA as a template, PCR amplification was performed using Zeocin-F (gene sequence shown in SEQ ID No. 19) and Zeocin-R (gene sequence shown in SEQ ID No. 20) as primers to obtain the Zeocin gene (bleomycin resistance gene). The nucleotide sequence of the Zeocin gene is shown in SEQ ID No. 21. The PCR procedure is as follows: denaturation at 98℃ for 10 seconds, annealing at 57℃ for 10 seconds, extension at 72℃ for 1 minute, repeated for 35 cycles. The Zeocin-F gene sequence is shown in SEQ ID No. 19, specifically as follows: gacaaggtgaggaactaaaccatggccaagttgaccagtgc The Zeocin-R gene sequence is shown in SEQ ID No. 20, specifically as follows: gtgggccgccgtcggacgtgtcagtcctgctcctcggccac The Zeocin gene sequence is shown in SEQ ID No. 21, specifically as follows: atggccaagttgaccagtgccgttccggtgctcaccgcgcgcgacgtcgccggagcggtcgagttctggaccgaccggctcgggttctcccgg gacttcgtggaggacgacttcgccggtgtggtccgggacgacgtgaccctgttcatcagcgcggtccaggaccaggtggtgccggacaacaccc tggcctgggtgtgggtgcgcggcctggacgagctgtacgccgagtggtcggaggtcgtgtccacgaacttccgggacgcctccgggccggccat gaccgagatcggcgagcagccgtgggggcgggagttcgccctgcgcgacccggccggcaactgcgtgcacttcgtggccgaggagcaggactga S1.2 The pZPK plasmid was digested with the restriction endonuclease XbaI. The digested pZPK plasmid backbone, promoter P2845, terminator T2845 and Zeocin gene were cloned in one step using the ClonExpress MultiS One Step Cloning Kit to construct the pzpk-Zeocin plasmid.

[0053] S2. Validation of the basic vector for recombinant plasmid pzpk-Zeocin The circular recombinant vector was transformed into Escherichia coli DH5α competent cells. The cells were screened by adding LB plates containing 100 μg / mL Zeocin resistance and verified by colony PCR and sequencing to obtain the positive recombinant plasmid pzpk-Zeocin.

[0054] S3. Design and synthesis of shRNA interference sequences A target shRNA interference sequence (SEQ ID No. 22) was designed targeting the conserved coding region of the orfA gene in Schizochytrium HX-308. The sequence includes forward and reverse complementary sequences and a stem-loop structure. A full-length shRNA sequence was chemically synthesized with enzyme cleavage sites at both ends.

[0055] The shRNA gene sequence is shown in SEQ ID No. 22, and is as follows: ttttttcatttgtcatcttcagcctgtcacaatctctcaattgtggacacagcgtcatcgctcatcaatccaagcaggaaagatcctgcctcggaagctagcgctggtggtttagtggtggtaaaatagctgtttgccatgcggctgccccgggttcgattcccggccagcgct S4. PCR amplification of each element of the interference expression cassette S4.1 Using the genome of Schizochytrium HX-308 as a template, PCR amplification was performed using P2520-F (gene sequence shown in SEQ ID No. 23) and P2520-R (gene sequence shown in SEQ ID No. 24) as primers to obtain the P2520 promoter (SEQ ID No. 25). S4.2 Using the Yeast lipolyticis Po1f genome as a template, PCR amplification was performed using CYC1-F (gene sequence shown in SEQ ID No. 26) and CYC1-R (gene sequence shown in SEQ ID No. 27) as primers to obtain the terminator CYC1 (gene sequence shown in SEQ ID No. 28).

[0056] The P2520-F gene sequence is shown in SEQ ID No. 23, and is as follows: gatccaagctcaagctgccagcaaccaaagcaaccagagc The P2520-R gene sequence is shown in SEQ ID No. 24, specifically as follows: gcaagaaatcgggcagacattgttcctgctgctgctgctg The gene sequence of promoter P2520 is shown in SEQ ID No. 25, specifically as follows: The CYC1-F gene sequence is shown in SEQ ID No. 26, specifically as follows: ccattgagatgttgttgtagtcatgtaattagttatgtcac The CYC1-R gene sequence is shown in SEQ ID No. 27, specifically as follows: gagtcgacctgcagcatgcagcaaattaaagccttcgagc The CYC1 gene sequence of the terminator is shown in SEQ ID No. 28, specifically as follows: Tcatgtaattagttatgtcacgcttacattcacgccctccccccacatccgctctaaccgaaaaggaaggagttagacaacctgaagtctaggtccctatttatttttttatagttatgttagt attaagaacgttatttatatttcaaatttttcttttttttctgtacagacgcgtgtacgcatgtaacattatactgaaaaccttgcttgagaaggttttgggacgctcgaaggctttaatttgc S5. One-step cloning construction of recombinant plasmid pzpk-Zeocin-tGly-orfA S5.1 The pzpk-Zeocin plasmid was linearized and digested with the restriction endonuclease PstI at 37°C for 4 hours. The linearized vector backbone was then recovered by gel extraction. The reaction system and conditions were the same as those in Table 1 of Example 1. S5.2 The linearized pzpk-Zeocin vector backbone, P2520 promoter, shRNA sequence, and CYC1 terminator were seamlessly cloned using a one-step cloning kit. The reaction system and conditions were the same as those in Table 2 of Example 1. S5.3 The recombinant product was transformed into *E. coli* DH5α competent cells. Positive clones were screened using LB agar plates containing 200 μg / mL bleomycin. Colony PCR and sequencing confirmed that the shRNA sequence insertion direction and sequence accuracy were 100%, thus yielding the RNA interference plasmid pzpk-Zeocin-tGly-orfA. (See figure below.) Figure 2 .

[0057] Example 3 Construction and Validation of High-β-Carotene-Producing Schizochytrium Engineered Strains This embodiment describes a method for constructing an engineered strain of Schizochytrium, comprising the following steps performed sequentially: S1. Preparation of Schizochytrium competent cells S1.1 A single colony of *Schizochytrium* HX-308 activated on GPY plates was inoculated into 50 mL of sterile seed culture medium and cultured at 28℃±0.5℃ with shaking at 170 r / min for 24 h. The seed culture medium had a pH of 6.0–6.5 and included: glucose 40–60 g / L, yeast extract 4–6 g / L, sodium sulfate 5–8 g / L, magnesium sulfate 2–4 g / L, ammonium sulfate 4–8 g / L, potassium chloride 1–2 g / L, calcium chloride 0.1–0.2 g / L, potassium sulfate 0.5–1 g / L, potassium dihydrogen phosphate 0.5–2 g / L, monosodium glutamate 8–12 g / L, zinc sulfate heptahydrate 1–5 mg / L, cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, and ferric sulfate heptahydrate 8–15 mg / L. mg / L, calcium pantothenate 2-4 mg / L, manganese chloride tetrahydrate 3-5 mg / L, sodium molybdate dihydrate 0.04 mg / L, solvent: water; sterilized by autoclaving at 121℃ for 60 min; S1.2 Transfer 5% inoculum to 50 mL of fresh seed culture medium and culture under the same conditions until the logarithmic growth phase (OD200). 600 =1.5-2.0); S1.3 Take 25 mL of logarithmic growth phase bacterial culture, centrifuge at 4000 rpm at room temperature for 2 min, and discard the supernatant; S1.4 The bacterial cells were resuspended in 25 mL of pretreatment solution (pH 6.5 Tris-HCl buffer containing 20 mM dithiothreitol and 0.1 M calcium chloride) and incubated at 30 °C for 30 min to promote cell wall relaxation. S1.5 Wash twice with pre-cooled sterile water, centrifuge at 4000 rpm and 4℃ for 2 min, and discard the supernatant; S1.6 Wash once with 1M pre-cooled sterile sorbitol solution containing 0.1M calcium chloride, centrifuge under the same conditions, and discard the supernatant. S1.7 Resuspend the bacterial cells in 200 μL of the above sorbitol solution, dispense 100 μL / tube, and store in an ice-water bath for later use.

[0058] S2. Electroporation and positive strain screening of Schizochytrium S2.1 Take 100 μL of competent cells and mix them with the following plasmids: 10 μL of pzpk-NeoR-GGPSS plasmid (for constructing a single-gene overexpression strain), 10 μL of pzpk-Zeocin-tGly-orfA plasmid (for constructing an RNA interference strain), or add 10 μL each of the above two plasmids simultaneously (for constructing an overexpression + RNA interference strain). Transfer the mixture to a 2 mm pre-chilled electroporator cuvette and incubate in an ice-water bath for 30 min. S2.2 Electroporation conversion, parameter settings: constant voltage 2.0kV, single pulse time 5ms; S2.3 Immediately after the electric shock, add 1 mL of pre-cooled recovery medium (seed medium containing 1 M sorbitol), mix well, transfer to 5 mL of seed medium, and incubate at 28℃ and 180 rpm for 3 h. S2.4 Take 200 μL of revived bacterial solution and spread it on GPY plates containing 50 mg / L G418, 50 mg / L bleomycin, and 50 mg / L G418 + 50 mg / L bleomycin, respectively. Incubate at 28℃ for 48-72 h to obtain single colonies.

[0059] S3. Preservation of engineered strains S3.1 Select single colonies with a diameter ≥2 mm and inoculate them into seed culture media containing 50 mg / L G418, 50 mg / L bleomycin, and 50 mg / L G418 + 50 mg / L bleomycin, respectively, and incubate at 28℃ and 180 rpm for 24 h. S3.2 The single-gene modified strain overexpressing GGPSS was named Schizochytrium sp. BC-01, the RNA interference gene modified strain was named Schizochytrium sp. BC-02, and the modified strain simultaneously overexpressing GGPSS and RNA interference was named Schizochytrium sp. BC-03. All the above strains were stored at -80℃ for long-term storage.

[0060] Example 4: Application of β-carotene production by fermentation of engineered strains of Schizochytrium This embodiment describes the application of the constructed engineered strain Schizochytrium sp. BC-03 in the fermentation production of β-carotene, including the following steps performed sequentially: S1. Recombinant bacterial activation and seed culture preparation The engineered strain BC-03 was inoculated into a 250 mL Erlenmeyer flask containing 50 mL of seed culture medium and cultured at 28℃±0.5℃ and 180 r / min for 24 h to obtain the primary seed culture. The culture was then transferred to fresh seed culture medium at a 2% inoculation rate and cultured under the same conditions for 24 h to obtain the secondary seed culture. The culture was then transferred and cultured for 24 h in the same manner to obtain the tertiary fermentation seed culture. The seed culture medium has a pH of 6.0-6.5 and comprises: 40-60 g / L glucose, 4-6 g / L yeast extract, 5-8 g / L sodium sulfate, 2-4 g / L magnesium sulfate, 4-8 g / L ammonium sulfate, 1-2 g / L potassium chloride, 0.1-0.2 g / L calcium chloride, 0.5-1 g / L potassium sulfate, 0.5-2 g / L potassium dihydrogen phosphate, 8-12 g / L monosodium glutamate, 1-5 mg / L zinc sulfate heptahydrate, 0.01-0.1 mg / L cobalt chloride hexahydrate, 2-6 mg / L copper sulfate pentahydrate, 1-2 mg / L nickel sulfate hexahydrate, 8-15 mg / L ferric sulfate heptahydrate, 2-4 mg / L calcium pantothenate, 3-5 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate, with water as the solvent; it is sterilized by autoclaving at 121°C for 60 minutes. S2. Shake-flask fermentation culture The tertiary seed culture was inoculated at a 10% inoculation rate into 500 mL Erlenmeyer flasks containing 100 mL of fermentation medium and cultured on a shaker at 28 °C and 180 rpm for a total fermentation period of 120 h. Control groups were set up as the starting strain HX-308, the single-gene modified strain BC-01 overexpressing only GGPSS, and the RNA interference gene modified strain BC-02, with three biological replicates for each group. The fermentation medium has a pH of 6.0-6.5 and comprises: glucose 60-80 g / L, yeast extract 8-12 g / L, sodium sulfate 5-10 g / L, magnesium sulfate 2-4 g / L, ammonium sulfate 4-8 g / L, potassium chloride 1-2 g / L, calcium chloride 0.1-0.2 g / L, potassium sulfate 0.5-1 g / L, potassium dihydrogen phosphate 0.5-2 g / L, monosodium glutamate 10-15 g / L, zinc sulfate heptahydrate 1-5 mg / L, cobalt chloride hexahydrate 0.01-0.1 mg / L, copper sulfate pentahydrate 2-6 mg / L, nickel sulfate hexahydrate 1-2 mg / L, ferric sulfate heptahydrate 8-15 mg / L, calcium pantothenate 2-4 mg / L, manganese chloride tetrahydrate 3-5 mg / L, sodium molybdate dihydrate 0.04 mg / L, and vitamin B6. 4–10 mg / L, with water as the solvent; sterilized by high-pressure steam at 121°C for 60 minutes.

[0061] S3. Product Extraction and Quantitative Detection S3.1 Take 50 mL of fermentation broth, centrifuge at 8000×g for 10 min to collect the cells, wash twice with sterile water, freeze-dry and grind into cell powder; S3.2 Add 10 mL of acetone-hydrochloric acid mixture (95:5, v / v, volume ratio) to the bacterial powder, add 0.1% BHT for antioxidant, extract in a 60℃ water bath in the dark for 30 min, shaking 3 times during the extraction, centrifuge at 12000×g for 10 min and collect the supernatant. Repeat the extraction twice and combine the supernatants. S3.3 The mixture was concentrated to dryness by rotary evaporation, diluted to 5 mL with chromatographically pure methanol, filtered through a 0.22 μm organic filter membrane, and then quantitatively detected by HPLC. S3.4 HPLC detection conditions: C18 column (4.6 mm × 150 mm, 5 μm), mobile phase acetonitrile-methanol-isopropanol = 50:30:20 (v / v, volume ratio), flow rate 1.0 mL / min, column temperature 40 ℃, detection wavelength 450 nm, injection volume 20 μL, external standard method for quantification.

[0062] S4. Fermentation results are shown in Table 3: Table 3

[0063] After 120 hours of fermentation, the β-carotene production of the starting strain HX-308 was 4.13 mg / L, that of the engineered strain BC-01 was 9.88 mg / L, and that of the engineered strain BC-02 was 2.13 mg / L. The β-carotene production of the engineered strain BC-03 constructed in this invention reached 19.53 mg / L, representing a 67.3% increase compared to the single-gene modified strain. These results demonstrate that the engineered strains constructed in this invention can efficiently synthesize β-carotene and possess significant potential for industrial application. Furthermore, it can be seen that the overexpression of GGPSS and the RNA interference gene in the engineered strain BC-03 has a synergistic effect, jointly increasing the β-carotene production of the constructed engineered strain.

[0064] Example 5: Optimization experiment of oleic acid (OA) concentration on β-carotene production in engineered strains This embodiment aims to determine the optimal oleic acid concentration for the engineered Schizochytrium sp. BC-03 strain constructed in this invention, verify the promoting effect of lipid droplet regulation strategy on intracellular accumulation of β-carotene, determine the effective and controllable range of oleic acid addition in the fermentation process, and provide precise process parameter support for the industrial fermentation production of β-carotene by the strain.

[0065] 1. Basic experimental conditions The test strain used in this embodiment is the Schizochytrium sp. BC-03 engineered strain constructed in Example 3; the seed culture medium and fermentation culture medium formulations are completely consistent with those in Example 4; the strain activation, seed liquid preparation process, fermentation temperature, rotation speed, inoculum size, and total fermentation cycle are all the same as in Example 4; oleic acid is added uniformly at 24h of fermentation; and three biological replicates are set up for all groups to eliminate the influence of operational errors on the experimental results.

[0066] 2. Experimental group design This experiment included one blank control group and five concentration experimental groups. Using a single-factor variable method, only the final concentration of oleic acid in the fermentation system was adjusted, while all other fermentation parameters remained completely consistent. The specific groupings are as follows: Control group: Oleic acid final concentration 0 mM, added with an equal volume of sterile water after 24 h of fermentation; Experimental group 1: final oleic acid concentration 0.5 mM; Experimental group 2: final oleic acid concentration 1 mM; Experimental group 3: final oleic acid concentration 2mM; Experimental group 4: final oleic acid concentration 3mM; Experimental group 5: final oleic acid concentration 4mM.

[0067] 3. Detection Indicators and Methods Fermentation was terminated after 120 hours, and samples from each group were collected simultaneously for the following key indicators: β-Carotene yield: The same acetone-hydrochloric acid extraction method and HPLC quantitative detection method as in Example 4 were used to calculate the final β-carotene yield of each group using the external standard method. Intracellular total lipid content: Intracellular total lipid was extracted using the acid-heat method, and the total lipid content was calculated by weighing to verify the regulatory effect of oleic acid on lipid droplet synthesis.

[0068] 4. Experimental Results and Analysis The liquid chromatograms of each group after fermentation are shown below. Figure 3 As shown in Table 4, the core detection data for each group after fermentation are as follows: Table 4

[0069] Experimental results showed that oleic acid addition had a significant bidirectional regulatory effect on cell growth, lipid synthesis, and β-carotene accumulation of the engineered strain of this invention. Within the concentration range of 0–2 mM, both total lipid content and β-carotene yield showed a continuous upward trend with increasing final oleic acid concentration. The 2 mM oleic acid addition group reached its peak values ​​for all indicators, with β-carotene yield increasing by 29.4% compared to the 0 mM blank control group, 100.4% compared to the engineered strain BC-01 without oleic acid addition, and 379% compared to the starting strain HX308 without oleic acid addition. This verifies that oleic acid-mediated lipid droplet regulation can effectively expand the intracellular storage capacity of β-carotene, thereby improving product synthesis efficiency.

[0070] When the final concentration of oleic acid exceeded 2 mM, the total fat content and β-carotene production both showed a significant downward trend. The β-carotene production in the 4 mM concentration group was lower than that in the blank control group, proving that high concentrations of oleic acid can produce lipotoxicity to the Schizochytrium engineered strain, inhibiting the normal growth and metabolism of the bacteria, which is not conducive to the synthesis of the target product.

[0071] Compared with existing technologies, the core advantages of this invention lie in four aspects: strategic innovation, enhanced effectiveness, deeper understanding of mechanisms, and simplified process. A detailed comparison is as follows: Existing patents mostly employ a single strategy. For example, Chinese patent publication CN117821531A optimizes fermentation solely through staged temperature control and the addition of NADPH oxidase inhibitors; Chinese patent publication CN116478835A knocks out a single transcription factor; and Chinese patent publication CN117821551A relies solely on starvation stress caused by sugar restriction to induce synthesis. In contrast, this invention uniquely employs a triple synergistic regulation of "precursor enhancement—competitive blocking—storage optimization," integrating exogenous oleic acid-mediated lipid droplet expansion with a strain metabolic engineering system for the first time.

[0072] With the addition of 2 mM oleic acid, this invention increases β-carotene yield by 379% compared to the wild type. In comparison, the combined process in Chinese patent publication CN117821531A only improves yield by about 30%; while another Chinese patent publication CN116478835A reports a 3.9-fold increase, the improvement is at the same level as this invention, and the effect is similar.

[0073] Existing patents for Schizochytrium do not cover lipid droplet regulation and lipotoxicity research. This invention is the first to systematically reveal the bidirectional regulatory effect of oleic acid, clarify the complete dose-response relationship between low concentration (0–2 mM) promoting and high concentration (>2 mM) inhibiting due to lipotoxicity, and precisely define the lipotoxicity threshold.

[0074] This invention only requires adding a fixed final concentration of oleic acid to the culture medium, making the operation extremely simple. It also provides a clearly defined optimal concentration (2 mM) and an effective compatibility range (1.5–2.5 mM), facilitating scale-up and standardization. In contrast, Chinese patent publication CN117821531A requires three-stage temperature control combined with an inhibitor, and Chinese patent publication CN117821551A requires precise determination of the timing for glycoside withdrawal. Both of these methods involve complex processes and significant challenges in batch stability control, highlighting the significant advantage of the simplicity of this invention.

[0075] In summary, the optimal final concentration of oleic acid added to the high-yield β-carotene engineered strain constructed in this invention is 2 mM, and the effective suitable concentration range is 1.5~2.5 mM. Under these parameters, the synergistic regulation of lipid droplet synthesis and β-carotene accumulation can be achieved, providing precise and controllable process parameter support for the industrial-scale production of the strain. It also verifies the scientificity and effectiveness of the synergistic strategy of "precursor enhancement-competitive blocking-storage optimization" in this invention.

[0076] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.

Claims

1. A Schizochytrium strain that produces high levels of β-carotene based on RNA inhibition and lipid droplet regulation, characterized in that: The engineered strain was obtained by overexpressing endogenous gerany gerany pyrophosphate synthase GGPPS and silencing the orfA gene in the lipid synthesis PKS pathway using the RNA interference plasmid tGly-orfA. The gene sequence of the GGPSS gene is SEQ ID No. 12, and the shRNA interference target sequence of the orfA gene is SEQ ID No.

22.

2. The engineered strain of Schizochytrium according to claim 1, characterized in that: The preservation number of the Schizochytrium HX-308 is CCTCC No. M209059.

3. The method for constructing the engineered strain of Schizochytrium as described in claim 1 or 2, characterized in that: Includes the following steps: S1. Construction of recombinant plasmid pZPK-NeoR-GGPSS Using plasmid pZPK as a backbone, NeoR expression cassette and GGPSS expression cassette were inserted into the plasmid backbone to obtain recombinant plasmid pZPK-NeoR-GGPSS; S2. Construction of RNA interference plasmid pZPK-Zeocin-tGly-orfA Using plasmid pZPK as a backbone, a Zeocin expression cassette and a shRNA interference expression cassette targeting the orfA gene were inserted into the plasmid backbone to obtain the RNA interference plasmid pZPK-Zeocin-tGly-orfA; S3. Construction of engineered strains of Schizochytrium, which produce high levels of β-carotene Recombinant plasmids pZPK-NeoR-GGPSS and pZPK-Zeocin-tGly-orfA were introduced into Schizochytrium HX-308 cells, and the engineered strain of Schizochytrium was obtained after double antibiotic screening and molecular verification.

4. The construction method according to claim 3, characterized in that: In step S1, the promoter of the NeoR expression cassette is the P2845 promoter of Schizochytrium, whose gene sequence is SEQ ID No. 6, and the terminator is the T2845 terminator of Schizochytrium, whose gene sequence is SEQ ID No. 9; the promoter of the GGPSS expression cassette is the P3626 promoter of Schizochytrium, whose gene sequence is SEQ ID No. 15, and the terminator is the trpc terminator of Schizochytrium, whose gene sequence is SEQ ID No.

18. In step S2, the promoter of the Zeocyn expression cassette is the P2845 promoter of Schizochytrium, whose gene sequence is SEQ ID No. 6, and the terminator is the T2845 terminator of Schizochytrium, whose gene sequence is SEQ ID No. 9; the promoter of the shRNA interference expression cassette is the P2520 promoter of Schizochytrium, whose gene sequence is SEQ ID No. 25, and the terminator is the CYC1 terminator, whose gene sequence is SEQ ID No.

28.

5. The construction method according to claim 3, characterized in that: In step S3, the import is achieved through electroconversion.

6. The application of the engineered strain of Schizochytrium as described in claim 1 or 2 in the fermentation production of β-carotene.

7. A method for producing β-carotene by fermentation using the Schizochytrium engineered strain as described in claim 1 or 2, characterized in that: Fermentation was carried out in a shaker at a temperature of 26–30℃ for 96–120 h and a rotation speed of 160–200 rpm. Oleic acid OA was added at a final concentration of 1.5–2.5 mM after 12–36 h of fermentation. The glucose concentration in the fermentation medium was 60–100 g / L.

8. The method according to claim 7, characterized in that: The specific steps are as follows: (1) Activate the engineered strain of Schizochytrium. Inoculate the engineered strain of Schizochytrium into seed culture medium and culture it with shaking at 28℃±0.5℃ and 180r / min for 24h to obtain the primary seed liquid. Transfer the primary seed liquid to fresh seed culture medium at an inoculation amount of 2% and amplify it under the same culture conditions for 24h to obtain the secondary seed liquid. Transfer the secondary seed liquid to seed culture medium at an inoculation amount of 2% and culture it under the same parameters for 24h to obtain the fermentation seed liquid. (2) Fermentation of recombinant bacteria: 10% of the fermentation seed liquid was inoculated into the fermentation medium and cultured on a shaker at 28℃ and 180r / min. Oleic acid with a final concentration of 2mM was added after 24h of fermentation. The total fermentation cycle was 120h, and fermentation products containing β-carotene were obtained.

9. The method according to claim 8, characterized in that: The seed culture medium has a pH of 6.0-6.5 and comprises: 40-60 g / L glucose, 4-6 g / L yeast extract, 5-8 g / L sodium sulfate, 2-4 g / L magnesium sulfate, 4-8 g / L ammonium sulfate, 1-2 g / L potassium chloride, 0.1-0.2 g / L calcium chloride, 0.5-1 g / L potassium sulfate, 0.5-2 g / L potassium dihydrogen phosphate, 8-12 g / L monosodium glutamate, 1-5 mg / L zinc sulfate heptahydrate, 0.01-0.1 mg / L cobalt chloride hexahydrate, 2-6 mg / L copper sulfate pentahydrate, 1-2 mg / L nickel sulfate hexahydrate, 8-15 mg / L ferric sulfate heptahydrate, 2-4 mg / L calcium pantothenate, 3-5 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate, with water as the solvent; it is sterilized by autoclaving at 121°C for 60 minutes. The fermentation medium has a pH of 6.0-6.5 and comprises: glucose 60-80 g / L, yeast extract 8-12 g / L, sodium sulfate 5-10 g / L, magnesium sulfate 2-4 g / L, ammonium sulfate 4-8 g / L, potassium chloride 1-2 g / L, calcium chloride 0.1-0.2 g / L, potassium sulfate 0.5-1 g / L, potassium dihydrogen phosphate 0.5-2 g / L, monosodium glutamate 10-15 g / L, zinc sulfate heptahydrate 1-5 mg / L, cobalt chloride hexahydrate 0.01-0.1 mg / L, copper sulfate pentahydrate 2-6 mg / L, nickel sulfate hexahydrate 1-2 mg / L, ferric sulfate heptahydrate 8-15 mg / L, calcium pantothenate 2-4 mg / L, manganese chloride tetrahydrate 3-5 mg / L, sodium molybdate dihydrate 0.04 mg / L, and vitamin B6. 4–10 mg / L, with water as the solvent; sterilized by high-pressure steam at 121°C for 60 minutes.

10. The method according to any one of claims 7 to 9, characterized in that: The total oil content of the fermentation product of the engineered strain of Schizochytrium for the production of β-carotene was 24.2 g / L, and the yield of β-carotene was 19.8 mg / L.

Images