Saccharomyces cerevisiae for producing purpuratexanthin and neoxanthin and application thereof

Abstract

The present application relates to a kind of new yellow and purple yellow producing saccharomyces cerevisiae and its application, belong to genetic engineering technical field.The present application first finds that the iron redox protein of different sources will influence the yield of new yellow and purple yellow to RFNR1-FD3, simultaneously by overexpressing new yellow and purple yellow synthesis related enzyme, and using promoter to strengthen the expression of enzyme, and increase the copy number of key enzyme, obtain a kind of new yellow and purple yellow can be simultaneously high yield saccharomyces cerevisiae.The present application is optimized, and the saccharomyces cerevisiae of the present application can produce 152.31mg / L of purple yellow at most, 16.54mg / L of new yellow, with wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a brewer's yeast that produces apurpuric and neoxanthin and its applications. Background Technology

[0002] Saccharomyces cerevisiae is a widely used Generally Recognized As Safe (GRAS) model microorganism in the fermentation industry and a typical food-safe strain. It possesses numerous advantages, including a clear genetic background, convenient gene manipulation, simple nutritional requirements, and strong production robustness. Furthermore, the mevalonic acid (MVA) pathway of Saccharomyces cerevisiae can provide precursors for the synthesis of terpenoids, thus making it an excellent platform for the heterologous production of high-value-added terpenoids.

[0003] Violaxanthin and neoxanthin are plant-derived orange carotenoids with significant antioxidant and anti-photodamage activities, playing important roles in various industries such as food and medicine. They are also precursors for the synthesis of fucoxanthin, a high-value oxygenated tetraterpenoid carotenoid, demonstrating enormous commercial value and application potential. Currently, the industrial production of violaxanthin and neoxanthin mainly relies on extraction from natural resources such as plants and algae. However, this method faces problems such as low content, high cost, and severe seasonal and geographical limitations, making it difficult to meet the demands of the international market. Although previous studies have achieved heterologous de novo synthesis of violaxanthin and neoxanthin in microbial chassis, there is still room for further improvement in yield levels. Therefore, achieving efficient synthesis and increasing the yield of violaxanthin and neoxanthin in different microbial chassis through engineering modification strategies has significant application value and practical significance for promoting the heterologous green manufacturing of violaxanthin, neoxanthin, and fucoxanthin. Summary of the Invention

[0004] Therefore, the technical problem to be solved by the present invention is to overcome the problem of low synthesis yield of neoxanthin and violet-xanthin in the prior art.

[0005] To address the aforementioned technical problems, this invention provides a *Saccharomyces cerevisiae* strain that produces neoxanthin and purpuricin, and their applications. This invention first discovered that ferrooxidase proteins from different sources affect the yield of RFNR1-FD3, specifically neoxanthin and purpuricin. Furthermore, by overexpressing enzymes related to neoxanthin and purpuricin synthesis, enhancing enzyme expression using promoters, and increasing the copy number of key enzymes, a *Saccharomyces cerevisiae* strain capable of simultaneously producing high yields of both neoxanthin and purpuricin was obtained. After optimization, the *Saccharomyces cerevisiae* strain of this invention can produce up to 152.31 mg / L of purpuricin and 16.54 mg / L of neoxanthin, demonstrating broad application prospects.

[0006] The first objective of this invention is to provide a *Saccharomyces cerevisiae* strain that produces neoxanthin and purpuric xanthin, wherein the *Saccharomyces cerevisiae* strain enhances the expression of truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, and endoplasmic reticulum size regulator INO2; and heterologously expresses geranylgeranyl diphosphate synthase CrtE, phytoene dehydrogenase CrtI, 15-cis-phytoene synthase CrtB, bifunctional lycopene cyclase / phytoene synthase CrtYB, β-carotene hydroxylase CrtZ, truncated mutant t24ZEP of zeaxanthin cyclooxygenase, mutant purpuric xanthin decyclooxygenase-like protein MBP-t19VDL1, crtZ, and ferrooxidase pairs RFNR1 and FD3, while simultaneously knocking out the transcriptional repressor ROX1 of the ergosterol biosynthesis gene and the galactose / lactose metabolism regulator GAL80.

[0007] Among them, the ferrooxidoreduction protein RFNR1-FD3 is derived from Arabica thaliana.

[0008] Furthermore, the *Saccharomyces cerevisiae* strain also heterologously expressed acetaldehyde dehydrogenase EutE and downregulated the expression of squalene synthase ERG9; wherein, through P... GAL7 The promoter enhances the expression of acetaldehyde dehydrogenase EutE by increasing P ERG9 Natural promoter replaced with P HXT1 The promoter downregulates the expression of squalene synthase ERG9, whose Gene ID is 856597 and whose NCBI number is WP_001075673.1.

[0009] Furthermore, the recombinant brewing yeast is obtained through P GPD Promoter enhancement expression of truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1;

[0010] Through P PGK1 The promoter enhances the expression of the endoplasmic reticulum size regulator INO2;

[0011] Through P TEF1 The promoters enhanced the expression of farnesyl pyrophosphate synthase ERG20, isopentenyl pyrophosphate isomerase IDI1, and 15-cis-hydrolycopene synthase CrtB, respectively.

[0012] Through P GAL1,10 The bidirectional promoters enhance the expression of RFNR1 and FD3 by phytoene dehydrogenase CrtI, gerany-gerany diphosphate synthase CrtE, t24ZEP, and ferrooxidase protein, respectively.

[0013] Through PGAL7 The promoters enhanced the expression of bifunctional lycopene cyclase / hydrolycopene synthase CrtYB, β-carotene hydroxylase CrtZ, truncation mutant t24ZEP of zeaxanthin cyclooxygenase, and mutant MBP-t19VDL1 of zeaxanthin decyclooxygenase-like protein, respectively.

[0014] Furthermore, the copy number of the β-carotene hydroxylase CrtZ is 3, the copy number of the truncated mutant t24ZEP of zeaxanthin cyclooxygenase is 3, the copy number of the zeaxanthin decyclooxygenase-like protein mutant MBP-t19VDL1 is 6, and the copy number of the ferrooxidase protein RFNR1-FD3 is 1.

[0015] Furthermore, the copy number of the β-carotene hydroxylase CrtZ is 3, the copy number of the truncated mutant t24ZEP of zeaxanthin cyclooxygenase is 3, the copy number of the zeaxanthin decyclooxygenase-like protein mutant MBP-t19VDL1 is 6, the copy number of the ferrooxidase RFNR1-FD3 is 1, and the copy number of the acetaldehyde dehydrogenase EutE is 1.

[0016] Further, the Gene ID of the truncated 3-hydroxy-3-methylglutaryl-CoA reductase is 42650, the Gene ID of the isopentenyl pyrophosphate isomerase IDI1 is 855986, the Gene ID of the farnesyl pyrophosphate synthase ERG20 is 853272, the Gene ID of the endoplasmic reticulum size regulator INO2 is 851701, the Gene ID of the transcriptional repressor of the ergosterol biosynthesis gene is 856178, the Gene ID of the geraniol-geraniol diphosphate synthase CrtE is 45505274, the Gene ID of the phytoene dehydrogenase CrtI is 37729024, and the Gene ID of the 15-cis-phytoene synthase CrtB is... The GenBank accession number for the bifunctional lycopene cyclase / hydrolycopene synthase CrtYB is ALK24266.1; the Gene ID for the galactose / lactose metabolism regulator protein GAL80 is 854954; the GenBank accession number for the β-carotene hydroxylase CrtZ is CRH37458.1; the GenBank accession number for the truncated mutant t24ZEP of zeaxanthin cyclooxygenase is AAR11195.1; the GenBank accession number for the mutant MBP-t19VDL1 of zeaxanthin decyclooxygenase is EEC48043.1; the NCBI accession number for the ferric oxide-reduction protein RFNR1 is NP_567293.1; and the GenBank accession number for the ferric oxide-reduction protein FD3 is OAP10276.1.

[0017] Furthermore, the brewing yeast strain is brewing yeast BY 4741 as the starting strain.

[0018] Furthermore, the *Saccharomyces cerevisiae* strain was prepared through gene recombination: 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 was integrated into the ROX1 enzyme site on the *Saccharomyces cerevisiae* genome; and integrated into the ERG20 site on the *Saccharomyces cerevisiae* genome, wherein the Gene ID of the ERG20 site is 853272;

[0019] The isopentenyl pyrophosphate isomerase IDI1 was integrated into the 911b site on the Saccharomyces cerevisiae genome, located on chromosome 9, with the guide sequence GTAATATTGTCTTGTTTCCC.

[0020] P TEF1 The promoter-enhanced expression of farnesyl pyrophosphate synthase ERG20 was integrated into the ERG20 site on the Saccharomyces cerevisiae genome, and the Gene ID of the ERG20 site was 853272.

[0021] The natural promoter of the endoplasmic reticulum size regulator INO2 on the Saccharomyces cerevisiae genome was replaced with P. PGK1 The promoter, the Gene ID of the INO2 site is 851701;

[0022] Geraniol-geraniol diphosphate synthase CrtE, derived from Taxus x media, was integrated into loci 308a, 416d, and 1014a on the Saccharomyces cerevisiae genome, respectively. Locus 308a is located on chromosome 3 with the guide sequence CACTTGTCAAACAGAATATA; locus 416d is located on chromosome 4 with the guide sequence TAGTGCACTTACCCCACGTT; and locus 1014a is located on chromosome 10 with the guide sequence TTATGTGCGTATTGCTTTCA.

[0023] The phytopene dehydrogenase CrtI from Blakeslea trispora was integrated into loci 308a, 416d, and 1014a on the Saccharomyces cerevisiae genome. Locus 308a is located on chromosome 3 with the guide sequence CACTTGTCAAACAGAATATA; locus 416d is located on chromosome 4 with the guide sequence TAGTGCACTTACCCCACGTT; and locus 1014a is located on chromosome 10 with the guide sequence TTATGTGCGTATTGCTTTCA.

[0024] The 15-cis-hydrolycopene synthase CrtB from Pantoea agglomerans was integrated upstream of the ERG9 site promoter in the Saccharomyces cerevisiae genome, where the Gene ID of the ERG9 site is 856597.

[0025] The bifunctional lycopene cyclase / hydrophobic lycopene synthase CrtYB from Phaffia rhodozyma was integrated into the 1309a site on the Saccharomyces cerevisiae genome, which is located on chromosome 13 and has the guide sequence CCTGTGGTGACTACGTATCC.

[0026] The β-carotene hydroxylase CrtZ from Erwinia uredovora was integrated into the 208a, 720a, and NSIX-2 loci on the Saccharomyces cerevisiae genome. The 208a locus is located on chromosome 2 with the guide sequence GTCCGCTAAACAAAAGATCT; the 720a locus is located on chromosome 7 with the guide sequence CAACAATTGTTACAATAGTA; and the NSIX-2 locus is located on chromosome 9 with the guide sequence CAGGAGATCCGCAGACAGGAAAAGTTCGAGGCCAAACAAAAACCGCAG.

[0027] The truncated mutant t24ZEP of zeaxanthin cyclooxygenase from *Vitis vinifera* was integrated into the 1622b, 720a, and NSIX-2 loci on the *Saccharomyces cerevisiae* genome. The 1622b locus is located on chromosome 16 with the guide sequence TAAAGCCACCACATCGCAAA; the 720a locus is located on chromosome 7 with the guide sequence CAACAATTGTTACAATAGTA; and the NSIX-2 locus is located on chromosome 9 with the guide sequence CAGGAGATCCGCAGACAGGAAAAGTTCGAGGCCAAACAAAAACCGCAG.

[0028] The violetin decyclooxygenase-like protein mutant MBP-t19VDL1 from *Phaeodactylum tricornutum* was integrated into the *Saccharomyces cerevisiae* genome at the YPRCδ15c, 106a, SAP155c, 1114a, 1414a, and NSXV-3 loci. The YPRCδ15c locus is located on chromosome 16 with the guide sequence AATCGAACAACAGAGCATA; the 106a locus is located on chromosome 1 with the guide sequence ATACGGTCAGGGTAGCGCCC; and the SAP155c locus is located on chromosome 6. The 1114a locus is located on chromosome 11, with the guide sequence ATGAAAGACAACTATAGGGC; the 1414a locus is located on chromosome 14, with the guide sequence GCGCCACAGTTTCAAGGGTC; the NSXV-3 locus is located on chromosome 15, with the guide sequence TTTTGAATGGGAAGAAGACACATAGCCCCCAGTAAACGAAAAAAGAAATCAAAAAGG.

[0029] The ferrooxidative protein RFNR1-FD3 from Arabiapsis thaliana was integrated into the 1021b site on the Saccharomyces cerevisiae genome, located on chromosome 10, with the guide sequence CCTCTGTGTGGTGGTAATTG.

[0030] The acetaldehyde dehydrogenase EutE from Escherichia coli was integrated into the NSVIII-1 site on the Saccharomyces cerevisiae genome. This site is located on chromosome 8 and the guide sequence is AAACAGCACAATAAAGCCCGTCATTTTCGTACCCGCTCATTT.

[0031] A second objective of this invention is to provide a microbial inoculant containing the aforementioned Saccharomyces cerevisiae.

[0032] A third objective of this invention is to provide the application of the above-mentioned Saccharomyces cerevisiae and the above-mentioned microbial agents in the preparation of auroxins and / or neoxanthins.

[0033] A fourth objective of this invention is to provide a method for preparing azoxanthin and / or neoxanthin, wherein the method involves inoculating the aforementioned Saccharomyces cerevisiae or the above-mentioned microbial agents into a culture medium for fermentation.

[0034] Compared with the prior art, the above-described technical solution of the present invention has the following advantages:

[0035] This invention constructs a *Saccharomyces cerevisiae* strain capable of synthesizing neoxanthin and purpuric xanthin. When used for 250 mL shake-flask fermentation, the neoxanthin yield reaches 16.54 mg / L, and the purpuric xanthin yield reaches 152.31 mg / L. The recombinant strain constructed by this invention achieves heterologous synthesis of neoxanthin in the yeast chassis, demonstrating broad application prospects. Attached Figure Description

[0036] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0037] Figure 1 It is the neoxanthin yield (mg / L) in recombinant Saccharomyces cerevisiae.

[0038] Figure 2 It is the azadirachtin yield (mg / L) in recombinant brewer's yeast.

[0039] Figure 3 It is the biomass (OD) of the recombinant Saccharomyces cerevisiae after the reaction is completed. 600 ). Detailed Implementation

[0040] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0041] The BY4741 strain involved in the following examples was purchased from Beijing Huayueyang Biotechnology Co., Ltd.

[0042] The culture media involved in the following examples are as follows:

[0043] LB liquid medium: contains 10 g tryptone, 10 g NaCl and 5 g yeast extract per liter.

[0044] SD-His medium: Each liter contains 50 mg of uracil, 50 mg of tryptophan, 50 mg of leucine, 6.7 g of amino-free yeast nitrogen source, and 20 g of anhydrous glucose.

[0045] SD-His-Leu medium: contains 50 mg uracil, 50 mg tryptophan, 6.7 g amino-free yeast nitrogen source, and 20 g anhydrous glucose per liter.

[0046] SD-His-Leu-Trp medium: contains 50 mg uracil, 6.7 g amino-free yeast nitrogen source, and 20 g anhydrous glucose per liter.

[0047] SD-Ura plates: YNB medium 6.7 g / L, glucose 20 g / L, L-tryptophan 50 mg / L, L-leucine 50 mg / L, L-histidine 50 mg / L, agar powder 20 g / L.

[0048] SD-His plates: YNB medium 6.7 g / L, glucose 20 g / L, L-tryptophan 50 mg / L, L-leucine 50 mg / L, uracil 50 mg / L, agar powder 20 g / L.

[0049] SD-His-Leu plates: YNB medium 6.7 g / L, glucose 20 g / L, L-tryptophan 50 mg / L, uracil 50 mg / L, agar powder 20 g / L.

[0050] SD-His-Leu-Trp plates: YNB medium 6.7 g / L, glucose 20 g / L, uracil 50 mg / L, agar powder 20 g / L.

[0051] YPD solid plates: 1% yeast extract, 2% peptone, 2% glucose, 1.5% agar powder.

[0052] The detection methods involved in the following embodiments are as follows:

[0053] Detection of the content of purpuric and neoxanthin:

[0054] 600 μL of the fermented bacterial broth was added to a disruption tube, along with an equal volume of ethyl acetate as the extraction phase. The cells were disrupted by grinding with glass beads. After centrifugation, 400 μL of the supernatant ethyl acetate was extracted, diluted with 400 μL of pure methanol, and filtered through a membrane before being transferred to a liquid chromatography bottle. Agilent 6495 triple quadrupole liquid chromatography-mass spectrometry system and an Agilent ZORBAX Eclipse Plus C18 column (2.1 × 50 mm, 1.8 μm) were used with a gradient elution program and multiple reaction monitoring (MRM) mode to detect oxanthin and neoxanthin. The elution program is shown in Table 1, and the detected ion information is shown in Table 2.

[0055] Table 1 Gradient System Program

[0056]

[0057] Mobile phase A consisted of ultrapure water supplemented with 10 mM ammonium formate and 0.1% formic acid, while mobile phase B consisted of LC-MS grade acetonitrile supplemented with 0.1% formic acid. After ultrasonic degassing, LC-MS detection was performed. HPLC conditions were as follows: an Agilent 6495 triple quadrupole liquid chromatography-mass spectrometry system was used for detection; the column was an Agilent ZORBAX Eclipse Plus C18 column (2.1 × 50 mm, 1.8 μm); the column temperature was 25℃; and the flow rate was 0.3 mL / min. -1 The injection volume was 1 μL.

[0058] Table 2 Monitoring Ion Information

[0059]

[0060] Recombinant brewer's yeast OD 600 Detection methods:

[0061] Yeast seed culture, after 16-24 h of cultivation, was inoculated at a rate of 1% into 250 mL shake flasks containing 25 mL of YPD medium and incubated at 30℃ and 220 rpm. Samples were taken and diluted appropriately before measuring OD using a UV spectrophotometer. 600 .

[0062] The plasmids involved in the following examples were constructed in E. coli JM109. After the plasmids were constructed, they were used as templates to amplify expression frames. Simultaneously, homologous arms upstream and downstream of the integration site and auxotrophic markers containing LoxP sites at both ends were amplified. The plasmids were then transformed into chassis strains for engineering modification.

[0063] The primer sequences involved in the following examples are shown in Table 3.

[0064] Table 3 Primers and their sequences

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071] Example 1: Construction of Saccharomyces cerevisiae strain YF02

[0072] The method for constructing Saccharomyces cerevisiae YF02 is disclosed in the patent with publication number CN120137810A.

[0073] Example 2: Construction of Saccharomyces cerevisiae strain YF15

[0074] 1. TargetP-2.0 was used to predict the chloroplast-localizing peptide of VDL1 protein. The results showed that the 19 amino acids at the N-terminus were chloroplast-localizing peptides. In addition, to promote its soluble expression in Saccharomyces cerevisiae, a maltose-binding protein tag MBP and a linker were fused to the N-terminus of the truncated protein (the sequence is described in the invention patent with publication number CN120137810A).

[0075] Artificially synthesized gene fragment P GAL7 -MBP-t19VDL1-T CYC1 (The nucleotide sequence is shown in SEQ ID NO. 1); using the Saccharomyces cerevisiae BY4741 genome as a template, the gene fragment YPRCδ15c-UP was amplified using primers YPRCδ15c-UP-F and YPRCδ15c-UP-R with the primer sequences described in Table 3; the gene fragment YPRCδ15c-DOWN was amplified using primers YPRCδ15c-DOWN-F and YPRCδ15c-DOWN-R.

[0076] Using plasmid pMHyLp-Trp as a template, the YPRCδ15c-Trp fragment was amplified using primers YPRCδ15c-loxT-F and YPRCδ15c-loxT-R.

[0077] 2. The four segments P from step 1 GAL7 -MBP-t19VDL1-T CYC1 YPRCδ15c-UP, YPRCδ15c-DOWN, and YPRCδ15c-Trp were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment YPRCδ15c-P containing the upstream and downstream homologous arms of YPRCδ15c. GAL7 -MBP-t19VDL1-T CYC1 ;

[0078] 3. Transform the fusion gene fragment obtained in step 2 into competent cells of the YF02 strain prepared in Example 1. Incubate on SD-Trp plates at 30°C for 2-3 days. Perform single-colony PCR verification using primers δ15c-YZ-MBP-t19-F and δ15c-YZ-MBP-t19-R. Select single colonies with correct bands to obtain strain YF02-ΔYPRCδ15c-P. GAL7 -MBP-t19VDL1-TCYC1 -Trp.

[0079] 4. Prepare competent cells from the strain obtained in step 3, transform them into the pY26-Cre plasmid, and culture them on SD-Ura plates at 30℃ for 2-3 days. Inoculate single colonies into YPD medium and culture for 15-24 h. Streak the colonies onto YPD plates containing 1 mg / mL of 5-fluoroorotic acid and culture at 30℃ for 2-3 days. Perform TLC verification on SD-Ura, SD-Trp, and YPD solid plates. Only single colonies growing on YPD medium are considered the correct *Saccharomyces cerevisiae* strain BY4741 ΔROX1-ΔGAL80-P. GPD -tHMG1-T ADH1 -Δ911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -Δ308a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ416d-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ1309a-P GAL7 -CrtYB-T CYC1 -Δ1014a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ208a-P GAL7 -CrtZ-T CYC1 -Δ1622b-P GAL7 -t24ZEP-T CYC1 -ΔYPRCδ15c-P GAL7 -MBP-t19VDL1- T CYC1 It was named Saccharomyces cerevisiae YF15.

[0080] Example 3: Construction of Saccharomyces cerevisiae strain YF18

[0081] 1. Artificially synthesized gene fragment P GAL7 -MBP-t19VDL1-T CYC1(The nucleotide sequence is shown in SEQ ID NO. 1); Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment 106a-UP was amplified using primers 106a-UP-F and 106a-UP-R with the primer sequences described in Table 3;

[0082] The gene fragment 106a-DOWN was amplified using primers 106a-DOWN-F and 106a-DOWN-R.

[0083] Using plasmid pMHyLp-Leu as a template, the 106a-Leu fragment was amplified using primers 106a-loxL-F and 106a-loxL-R.

[0084] 2. The four segments P from step 1 GAL7 -MBP-t19VDL1-T CYC1 106a-UP, 106a-DOWN, and 106a-Leu were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment 106a-P containing the upstream and downstream homologous arms of 106a. GAL7 -MBP-t19VDL1-T CYC1 ;

[0085] 3. Transform the fusion gene fragment obtained in step 2 into competent cells of the YF15 strain prepared in Example 2. Incubate on SD-Leu plates at 30°C for 2-3 days. Perform single-colony PCR verification using primers 106a-YZ-MBP-t19-F and 106a-YZ-MBP-t19-R. Select single colonies with correct bands to obtain strain YF15-Δ106a-P. GAL7 -MBP-t19VDL1-T CYC1 -Leu.

[0086] 4. Prepare competent cells from the strain obtained in step 3, transform them into the pY26-Cre plasmid, and culture them on SD-Ura plates at 30℃ for 2-3 days. Inoculate single colonies into YPD medium and culture for 15-24 h. Streak the colonies onto YPD plates containing 1 mg / mL of 5-fluoroorotic acid and culture at 30℃ for 2-3 days. Perform TLC verification on SD-Ura, SD-Leu, and YPD solid plates. Only single colonies growing on YPD medium are considered the correct *Saccharomyces cerevisiae* strain BY4741 ΔROX1-ΔGAL80-P. GPD -tHMG1-T ADH1 - Δ911b- P TEF1 - IDI1- T CYC1 - P GPD -tHMG1-T ADH1-P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-TERG9-Δ308a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ416d-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ1309a-P GAL7 -CrtYB-T CYC1 -Δ1014a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ208a-P GAL7 -CrtZ-T CYC1 -Δ1622b-P GAL7 -t24ZEP-T CYC1 -ΔYPRCδ15c-P GAL7 -MBP-t19VDL1- T CYC1 -Δ106a-P GAL7 -MBP-t19VDL1- T CYC1 It was named Saccharomyces cerevisiae YF18.

[0087] Example 4: Construction of Saccharomyces cerevisiae strain YF19

[0088] 1. Artificially synthesized gene fragment T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 (The nucleotide sequence is shown in SEQ ID NO.2); Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment 720a-UP was amplified using primers 720a-UP-F and 720a-UP-R with the primer sequences described in Table 3;

[0089] The gene fragment 720a-DOWN was amplified using primers 720a-DOWN-F and 720a-DOWN-R; the 720a-Trp fragment was amplified using plasmid pMHyLp-Trp as a template and primers 720a-loxT-F and 720a-loxT-R.

[0090] 2. Take the four segments T from step 1. CYC1 -crtZ-P GAL1,10 -t24ZEP-TADH1 720a-UP, 720a-DOWN, and 720a-Trp were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment 720a-T containing the upstream and downstream homologous arms of 720a. CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 ;

[0091] 3. Transform the fusion gene fragment obtained in step 2 into the competent cells of the YF18 strain prepared in Example 3, and culture them on SD-Trp plates at 30°C for 2-3 days. Perform single-colony PCR verification using primers 720a-YZ-CrtZ-ZEP-F and 720a-YZ-CrtZ-ZEP-R. Select single colonies with correct bands to obtain strain YF18-Δ720a-T. CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -Trp.

[0092] 4. Prepare competent cells from the strain obtained in step 3, transform them into the pY26-Cre plasmid, and culture them on SD-Ura plates at 30℃ for 2-3 days. Inoculate single colonies into YPD medium and culture for 15-24 h. Streak the colonies onto YPD plates containing 1 mg / mL of 5-fluoroorotic acid and culture at 30℃ for 2-3 days. Perform TLC verification on SD-Ura, SD-Trp, and YPD solid plates. Only single colonies growing on YPD medium are considered the correct *Saccharomyces cerevisiae* strain BY4741 ΔROX1- ΔGAL80-P. GPD -tHMG1-T ADH1 -Δ911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -Δ308a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ416d-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ1309a-P GAL7-CrtYB-T CYC1 -Δ1014a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ208a-P GAL7 -CrtZ-T CYC1 -Δ1622b-P GAL7 -t24ZEP-T CYC1 -ΔYPRCδ15c-P GAL7 -MBP-t19VDL1-T CYC1 -Δ106a-P GAL7 -MBP-t19VDL1-T CYC1 -Δ720a-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 It was named Saccharomyces cerevisiae YF19.

[0093] Example 5: Construction of Saccharomyces cerevisiae strain YF20

[0094] 1. Artificially synthesized gene fragment T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 (The nucleotide sequence is shown in SEQ ID NO.2); Using the Saccharomyces cerevisiae BY4741 genome as a template, the gene fragment NSIX-2-UP was amplified using the primer sequences described in Table 3 with primers NSIX-2-UP-F and NSIX-2-UP-R;

[0095] The gene fragment NSIX-2-DOWN was amplified using primers NSIX-2-DOWN-F and NSIX-2-DOWN-R; the NSIX-2-His fragment was amplified using plasmid pMHyLp-His as a template and primers NSIX-2-loxH-F and NSIX-2-loxH-R.

[0096] 2. Take the four segments T from step 1. CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 NSIX-2-UP, NSIX-2-DOWN, and NSIX-2-His were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment NSIX-2-T containing the upstream and downstream homologous arms of NSIX-2. CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 ;

[0097] 3. Transform the fusion gene fragment obtained in step 2 into competent cells of the YF19 strain prepared in Example 4, and culture them on SD-His plates at 30°C for 2-3 days. Perform single-colony PCR verification using primers NSIX-2-YZ-CrtZ-ZEP-F and NSIX-2-YZ-CrtZ-ZEP-R; select single colonies with correct bands to obtain strain YF19-ΔNSIX-2-T. CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -His.

[0098] 4. Prepare competent cells from the strain obtained in step 3, transform them into the pY26-Cre plasmid, and culture them on SD-Ura plates at 30℃ for 2-3 days. Inoculate single colonies into YPD medium and culture for 15-24 h. Streak the colonies onto YPD plates containing 1 mg / mL of 5-fluoroorotic acid and culture at 30℃ for 2-3 days. Perform TLC verification on SD-Ura, SD-His, and YPD solid plates. Only single colonies growing on YPD medium are considered the correct *Saccharomyces cerevisiae* strain BY4741 ΔROX1-ΔGAL80-P. GPD -tHMG1-T ADH1 -Δ911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-TERG9-Δ308a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ416d-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ1309a-P GAL7 -CrtYB-T CYC1 -Δ1014a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ208a-P GAL7 -CrtZ-T CYC1 -Δ1622b-P GAL7 -t24ZEP-T CYC1 -ΔYPRCδ15c-PGAL7 -MBP-t19VDL1-T CYC1 -Δ106a-P GAL7 -MBP-t19VDL1-T CYC1 -Δ720a-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -ΔNSIX-2-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 It was named Saccharomyces cerevisiae YF20.

[0099] Example 6: Construction of Saccharomyces cerevisiae strain YF21

[0100] 1. Artificially synthesized gene fragment T CYC1 -RFNR1-P GAL1,10 -FD3-T ADH1 (The nucleotide sequence is shown in SEQ ID NO. 3); Using the Saccharomyces cerevisiae BY4741 genome as a template, the gene fragment 1021b-UP was amplified using primers 1021b-UP-F and 1021b-UP-R with the primer sequences described in Table 3;

[0101] The gene fragment 1021b-DOWN was amplified using primers 1021b-DOWN-F and 1021b-DOWN-R; the 1021b-His fragment was amplified using plasmid pMHyLp-His as a template and primers 1021b-loxH-F and 1021b-loxH-R.

[0102] 2. Take the four segments T from step 1. CYC1 -RFNR1-P GAL1,10 -FD3-T ADH1 1021b-UP, 1021b-DOWN, and 1021b-His were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment 1021b-T containing the upstream and downstream homologous arms of 1021b. CYC1 -RFNR1-P GAL1,10 -FD3-T ADH1 ;

[0103] 3. Transform the fusion gene fragment obtained in step 2 into the competent cells of strain YF20 prepared in Example 5, and culture them on SD-His plates at 30°C for 2-3 days. Perform single-colony PCR verification using primers 1021b-YZ-RFNR-FD3-F and 1021b-YZ-RFNR-FD3-R. Select single colonies with correct bands to obtain strain YF20-Δ1021b-T.CYC1 -RFNR1-P GAL1,10 -FD3-T ADH1 -His.

[0104] 4. Prepare competent cells from the strain obtained in step 3, transform them into the pY26-Cre plasmid, and culture them on SD-Ura plates at 30℃ for 2-3 days. Inoculate single colonies into YPD medium and culture for 15-24 h. Streak the colonies onto YPD plates containing 1 mg / mL of 5-fluoroorotic acid and culture at 30℃ for 2-3 days. Perform TLC verification on SD-Ura, SD-His, and YPD solid plates. Only single colonies growing on YPD medium are considered the correct *Saccharomyces cerevisiae* strain BY4741 ΔROX1-ΔGAL80-P. GPD -tHMG1-T ADH1 -Δ911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-TERG9-Δ308a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ416d-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ1309a-P GAL7 -CrtYB-T CYC1 -Δ1014a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ208a-P GAL7 -CrtZ-T CYC1 -Δ1622b-P GAL7 -t24ZEP-T CYC1 -ΔYPRCδ15c-P GAL7 -MBP-t19VDL1-T CYC1 -Δ106a-P GAL7 -MBP-t19VDL1-T CYC1 -Δ720a-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1-ΔNSIX-2-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -Δ1021b-T CYC1 -RFNR1-P GAL1,10 -FD3-T ADH1 It was named Saccharomyces cerevisiae YF21.

[0105] Example 7: Construction of Saccharomyces cerevisiae strain YF22

[0106] 1. Artificially synthesized gene fragment P GAL7 -MBP-t19VDL1-T CYC1 (The nucleotide sequence is shown in SEQ ID NO. 1); Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment 1114a-UP was amplified using primers 1114a-UP-F and 1114a-UP-R with the primer sequences described in Table 3;

[0107] Gene fragment 1114a-DOWN was amplified using primers 1114a-DOWN-F and 1114a-DOWN-R;

[0108] Using plasmid pMHyLp-Trp as a template, the 1114a-Trp fragment was amplified using primers 1114a-loxT-F and 1114a-loxT-R.

[0109] 2. The four segments P from step 1 GAL7 -MBP-t19VDL1-T CYC1 1114a-UP, 1114a-DOWN, and 1114a-Trp were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment 1114a-P containing the upstream and downstream homologous arms of 1114a. GAL7 -MBP-t19VDL1-T CYC1 ;

[0110] 3. Transform the fusion gene fragment obtained in step 2 into the competent cells of the YF21 strain prepared in Example 6, and culture them on SD-Trp plates at 30°C for 2-3 days. Perform single-colony PCR verification using primers 1114a-YZ-MBP-t19-F and 1114a-YZ-MBP-t19-R. Select single colonies with correct bands to obtain strain YF21-Δ1114a-P. GAL7 -MBP-t19VDL1-T CYC1 -Trp.

[0111] 4. Prepare competent cells from the strain obtained in step 3, transform them into the pY26-Cre plasmid, and culture them on SD-Ura plates at 30℃ for 2-3 days. Inoculate single colonies into YPD medium and culture for 15-24 h. Streak the colonies onto YPD plates containing 1 mg / mL of 5-fluoroorotic acid and culture at 30℃ for 2-3 days. Perform TLC verification on SD-Ura, SD-Trp, and YPD solid plates. Only single colonies growing on YPD medium are considered the correct *Saccharomyces cerevisiae* strain BY4741 ΔROX1-ΔGAL80-P. GPD -tHMG1-T ADH1 - Δ911b- P TEF1 - IDI1-T CYC1 - P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-TERG9-Δ308a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ416d-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ1309a-P GAL7 -CrtYB-T CYC1 -Δ1014a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ208a-P GAL7 -CrtZ-T CYC1 -Δ1622b-P GAL7 -t24ZEP-T CYC1 -ΔYPRCδ15c-P GAL7 -MBP-t19VDL1-T CYC1 -Δ106a-P GAL7 -MBP-t19VDL1-T CYC1 -Δ720a-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -ΔNSIX-2-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -Δ1021b-TCYC1 -RFNR1-P GAL1,10 -FD3-T ADH1 -Δ1114a-P GAL7 -MBP-t19VDL1- T CYC1 It was named Saccharomyces cerevisiae YF22.

[0112] Example 8: Construction of Saccharomyces cerevisiae strain YF23

[0113] 1. Artificially synthesized gene fragment P GAL7 -MBP-t19VDL1- T CYC1 (The nucleotide sequence is shown in SEQ ID NO. 1); using the Saccharomyces cerevisiae BY4741 genome as a template, the gene fragment SAP155c-UP was amplified using primers SAP155c-UP-F and SAP155c-UP-R with the primer sequences described in Table 3; the gene fragment SAP155c-DOWN was amplified using primers SAP155c-DOWN-F and SAP155c-DOWN-R.

[0114] Using plasmid pMHyLp-Leu as a template, the SAP155c-Leu fragment was amplified using primers SAP155c-loxL-F and SAP155c-loxL-R.

[0115] 2. The four segments P from step 1 GAL7 -MBP-t19VDL1-T CYC1 SAP155c-UP, SAP155c-DOWN, and SAP155c-Leu were subjected to fusion PCR. The correct bands obtained from gel chromatography were excised and recovered to yield the fusion gene fragment SAP155c-P containing the upstream and downstream homologous arms of SAP155c. GAL7 -MBP-t19VDL1-T CYC1 ;

[0116] 3. Transform the fusion gene fragment obtained in step 2 into competent cells of the YF22 strain prepared in Example 7. Incubate on SD-Leu plates at 30°C for 2-3 days. Perform single-colony PCR verification using primers SAP155c-YZ-MBP-t19-F and SAP155c-YZ-MBP-t19-F. Select single colonies with correct bands to obtain strain YF22-ΔSAP155c-P. GAL7 -MBP-t19VDL1-T CYC1 -Leu.

[0117] 4. Prepare competent cells from the strain obtained in step 3, transform them into the pY26-Cre plasmid, and culture them on SD-Ura plates at 30℃ for 2-3 days. Inoculate single colonies into YPD medium and culture for 15-24 h. Streak the colonies onto YPD plates containing 1 mg / mL of 5-fluoroorotic acid and culture at 30℃ for 2-3 days. Perform TLC verification on SD-Ura, SD-Leu, and YPD solid plates. Only single colonies growing on YPD medium are considered the correct *Saccharomyces cerevisiae* strain BY4741 ΔROX1-ΔGAL80-P. GPD -tHMG1-T ADH1 -Δ911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-TERG9-Δ308a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ416d-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ1309a-P GAL7 -CrtYB-T CYC1 -Δ1014a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ208a-P GAL7 -CrtZ-T CYC1 -Δ1622b-P GAL7 -t24ZEP-T CYC1 -ΔYPRCδ15c-P GAL7 -MBP-t19VDL1-T CYC1 -Δ106a-P GAL7 -MBP-t19VDL1-T CYC1 -Δ720a-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -ΔNSIX-2-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -Δ1021b-TCYC1 -RFNR1-P GAL1,10 -FD3-T ADH1 -Δ1114a-P GAL7 -MBP-t19VDL1-T CYC1 -ΔSAP155c-P GAL7 -MBP-t19VDL1- T CYC1 It was named Saccharomyces cerevisiae YF23.

[0118] Example 9: Construction of Saccharomyces cerevisiae strain YF24

[0119] 1. Artificially synthesized gene fragment P GAL7 -MBP-t19VDL1- T CYC1 (The nucleotide sequence is shown in SEQ ID NO. 1); Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment 1414a-UP was amplified using primers 1414a-UP-F and 1414a-UP-R with the primer sequences described in Table 3;

[0120] The gene fragment 1414a-DOWN was amplified using primers 1414a-DOWN-F and 1414a-DOWN-R; the 1414a-Leu fragment was amplified using plasmid pMHyLp-Leu as a template and primers 1414a-loxL-F and 1414a-loxL-R.

[0121] 2. The four segments P from step 1 GAL7 -MBP-t19VDL1- T CYC1 1414a-UP, 1414a-DOWN, and 1414a-Leu were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment 1414a-P containing the upstream and downstream homologous arms of 1414a. GAL7 -MBP-t19VDL1-T CYC1 ;

[0122] 3. Transform the fusion gene fragment obtained in step 2 into competent cells of strain YF23 prepared in Example 8, and culture them on SD-Leu plates at 30°C for 2-3 days. Perform single-colony PCR verification using primers 1414a-YZ-MBP-t19-F and 1414a-YZ-MBP-t19-F. Select single colonies with correct bands to obtain strain YF23-Δ1414a-P. GAL7 -MBP-t19VDL1-T CYC1 -Leu.

[0123] 4. Prepare competent cells from the strain obtained in step 3, transform them into the pY26-Cre plasmid, and culture them on SD-Ura plates at 30℃ for 2-3 days. Inoculate single colonies into YPD medium and culture for 15-24 h. Streak the colonies onto YPD plates containing 1 mg / mL of 5-fluoroorotic acid and culture at 30℃ for 2-3 days. Perform TLC verification on SD-Ura, SD-Leu, and YPD solid plates. Only single colonies growing on YPD medium are considered the correct *Saccharomyces cerevisiae* strain BY4741 ΔROX1- ΔGAL80-P. GPD -tHMG1-T ADH1 -Δ911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-TERG9-Δ308a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ416d-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ1309a-P GAL7 -CrtYB-T CYC1 -Δ1014a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ208a-P GAL7 -CrtZ-T CYC1 -Δ1622b-P GAL7 -t24ZEP-T CYC1 -ΔYPRCδ15c-P GAL7 -MBP-t19VDL1-T CYC1 -Δ106a-P GAL7 -MBP-t19VDL1-T CYC1 -Δ720a-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -ΔNSIX-2-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -Δ1021b-TCYC1 -RFNR1-P GAL1,10 -FD3-T ADH1 -Δ1114a-P GAL7 -MBP-t19VDL1-T CYC1 -ΔSAP155c-P GAL7 -MBP-t19VDL1-T CYC1 -Δ1414a-P GAL7 -MBP-t19VDL1- T CYC1 It was named Saccharomyces cerevisiae YF24.

[0124] Example 10: Construction of Saccharomyces cerevisiae strain YF25

[0125] 1. Artificially synthesized gene fragment P GAL7 -MBP-t19VDL1-T CYC1 (The nucleotide sequence is shown in SEQ ID NO. 1); Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment NSXV-3-UP was amplified using the primer sequences described in Table 3 with primers NSXV-3-UP-F and NSXV-3-UP-R;

[0126] The gene fragment NSXV-3-DOWN was amplified using primers NSXV-3-DOWN-F and NSXV-3-DOWN-R; the NSXV-3-Trp fragment was amplified using plasmid pMHyLp-Trp as a template and primers NSXV-3-loxT-F and NSXV-3-loxT-R.

[0127] 2. The four segments P from step 1 GAL7 -MBP-t19VDL1- T CYC1 NSXV-3-UP, NSXV-3-DOWN, and NSXV-3-Trp were subjected to fusion PCR. The correct bands obtained from the gel were excised and recovered to obtain the fusion gene fragment NSXV-3-P containing the upstream and downstream homologous arms of NSXV-3. GAL7 -MBP-t19VDL1-T CYC1 ;

[0128] 3. Transform the fusion gene fragment obtained in step 2 into competent cells of strain YF24 prepared in Example 9. Culture on SD-Trp plates at 30°C for 2-3 days. Perform single-colony PCR verification using primers NSXV-3-YZ-MBP-t19-F and NSXV-3-YZ-MBP-t19-R. Select single colonies with correct bands to obtain strain YF24-ΔNSXV-3-P. GAL7 -MBP-t19VDL1-T CYC1-Trp.

[0129] 4. Prepare competent cells from the strain obtained in step 3, transform them into the pY26-Cre plasmid, and culture them on SD-Ura plates at 30℃ for 2-3 days. Inoculate single colonies into YPD medium and culture for 15-24 h. Streak the colonies onto YPD plates containing 1 mg / mL of 5-fluoroorotic acid and culture at 30℃ for 2-3 days. Perform TLC verification on SD-Ura, SD-Trp, and YPD solid plates. Only single colonies growing on YPD medium are considered the correct *Saccharomyces cerevisiae* strain BY4741 ΔROX1-ΔGAL80-P. GPD -tHMG1-T ADH1 -Δ911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-TERG9-Δ308a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ416d-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ1309a-P GAL7 -CrtYB-T CYC1 -Δ1014a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ208a-P GAL7 -CrtZ-T CYC1 -Δ1622b-P GAL7 -t24ZEP-T CYC1 -ΔYPRCδ15c-P GAL7 -MBP-t19VDL1-T CYC1 -Δ106a-P GAL7 -MBP-t19VDL1-T CYC1 -Δ720a-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -ΔNSIX-2-T CYC1 -crtZ-P GAL1,10-t24ZEP-T ADH1 -Δ1021b-T CYC1 -RFNR1-P GAL1,10 -FD3-T ADH1 -Δ1114a-P GAL7 -MBP-t19VDL1-T CYC1 -ΔSAP155c-P GAL7 -MBP-t19VDL1-T CYC1 -Δ1414a-P GAL7 -MBP-t19VDL1-T CYC1 -ΔNSXV-3-P GAL7 -MBP-t19VDL1- T CYC1 It was named Saccharomyces cerevisiae YF25.

[0130] Example 11: Construction of Saccharomyces cerevisiae strain YF26

[0131] 1. Artificially synthesized gene fragment P GAL7 -EutE-T CYC1 (The nucleotide sequence is shown in SEQ ID NO. 4); Using the Saccharomyces cerevisiae BY4741 genome as a template, the gene fragment NSVIII-1-UP was amplified using the primer sequences described in Table 3 with primers NSVIII-1-UP-F and NSVIII-1-UP-R;

[0132] The gene fragment NSVIII-1-DOWN was amplified using primers NSVIII-1-DOWN-F and NSVIII-1-DOWN-R.

[0133] Using plasmid pMHyLp-Leu as a template, the NSVIII-1-Leu fragment was amplified using primers NSVIII-1-loxL-F and NSVIII-1-loxL-R.

[0134] 2. The four segments P from step 1 GAL7 -EutE- T CYC1 NSVIII-1-UP, NSVIII-1-DOWN, and NSVIII-1-Leu were subjected to fusion PCR. The correct bands obtained from the gel were excised and recovered to obtain the fusion gene fragment NSVIII-1-P containing the upstream and downstream homologous arms of NSVIII-1. GAL7 -EutE-T CYC1 ;

[0135] 3. Transform the fusion gene fragment obtained in step 2 into competent cells of the YF25 strain prepared in Example 10. Incubate on SD-Leu plates at 30°C for 2-3 days. Perform single-colony PCR verification using primers NSVIII-1-YZ-EutE-F and NSVIII-1-YZ-EutE-R. Select single colonies with correct bands to obtain strain YF25-ΔNSVIII-1-P. GAL7 -EutE-T CYC1 -Leu.

[0136] 4. Prepare competent cells from the strain obtained in step 3, transform them into the pY26-Cre plasmid, and culture them on SD-Ura plates at 30℃ for 2-3 days. Inoculate single colonies into YPD medium and culture for 15-24 h. Streak the colonies onto YPD plates containing 1 mg / mL of 5-fluoroorotic acid and culture at 30℃ for 2-3 days. Perform TLC verification on SD-Ura, SD-Leu, and YPD solid plates. Only single colonies growing on YPD medium are considered the correct *Saccharomyces cerevisiae* strain BY4741 ΔROX1- ΔGAL80-P. GPD -tHMG1-T ADH1 -Δ911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-TERG9-Δ308a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ416d-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ1309a-P GAL7 -CrtYB-T CYC1 -Δ1014a-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Δ208a-P GAL7 -CrtZ-T CYC1 -Δ1622b-P GAL7 -t24ZEP-T CYC1 -ΔYPRCδ15c-P GAL7-MBP-t19VDL1-T CYC1 -Δ106a-P GAL7 -MBP-t19VDL1-T CYC1 -Δ720a-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -ΔNSIX-2-T CYC1 -crtZ-P GAL1,10 -t24ZEP-T ADH1 -Δ1021b-T CYC1 -RFNR1-P GAL1,10 -FD3-T ADH1 -Δ1114a-P GAL7 -MBP-t19VDL1-T CYC1 -ΔSAP155c-P GAL7 -MBP-t19VDL1-T CYC1 -Δ1414a-P GAL7 -MBP-t19VDL1-T CYC1 -ΔNSXV-3-P GAL7 -MBP-t19VDL1-T CYC1 -ΔNSVIII-1-P GAL7 -EutE-T CYC1 It was named Saccharomyces cerevisiae YF26.

[0137] Example 12: Yields of apocynin and neoxanthin from recombinant strains under shake-flask fermentation conditions

[0138] 1. The above-mentioned recombinant Saccharomyces cerevisiae strains Y5C, YF01, YF02, YF15, and YF18-YF26 were cultured at 30℃ and 220 rpm for 16-24 h to prepare seed culture. The prepared seed culture was inoculated into 250 mL Erlenmeyer flasks containing 25 mL of YPD medium at an inoculation rate of 2% (v / v) and cultured at 30℃ and 220 rpm for 48 h to prepare fermentation broth.

[0139] 2. Calculate the yields of xanthophyll and neoxanthophyll:

[0140] 600 μL of the fermented bacterial broth was added to a disruption tube, along with an equal volume of ethyl acetate as the extraction phase. Cells were disrupted by grinding with glass beads, and after centrifugation, 400 μL of the supernatant ethyl acetate was extracted. This was diluted with 400 μL of pure methanol, filtered through a membrane, and then transferred to a liquid chromatography bottle. Agilent 6495 triple quadrupole liquid chromatography-mass spectrometry system and an Agilent ZORBAX Eclipse Plus C18 column (2.1 × 50 mm, 1.8 μm) were used to detect oxalic acid and neoxanthin using a gradient elution program and multiple reaction monitoring (MRM) mode. The fermentation yield of the engineered strain was calculated by converting the peak areas of the corresponding daughter ions to those of oxalic acid and neoxanthin standards. The OD was measured using a UV spectrophotometer after diluting the fermentation broth 100-fold. 600 .

[0141] The results are shown in Tables 4-5 and 5. Figure 1-3 As shown, the *Saccharomyces cerevisiae* strain YF25, expressing 3 copies of gene CrtZ, 3 copies of gene t24ZEP, 6 copies of MBP-t19VDL1, and 1 copy of gene RFNR1-FD3, achieved a neoxanthin yield of 14.92 mg / L and a purpuric xanthin yield of 152.31 mg / L. OD 600 The OD value was 30.77; the neoxanthin yield of the Saccharomyces cerevisiae strain YF26, expressing 3 copies of CrtZ, 3 copies of t24ZEP, 6 copies of MBP-t19VDL1, 1 copy of RFNR1-FD3, and 1 copy of EutE, reached 16.54 mg / L, and the purpuric xanthin yield was 126.51 mg / L. 600 It is 30.12.

[0142] Table 4: Neoxanthin and azoxanthin yields of different recombinant brewing yeasts

[0143]

[0144] Table 5. OD values ​​of different recombinant brewing yeasts after fermentation. 600

[0145]

[0146] Comparative examples: Recombinant strains obtained by introducing ferric redox protein combinatorial genes from different sources

[0147] The specific implementation method is the same as in Example 6, except that the RFNR1 and FD3 combination in Example 6 is updated to: FNR (NCBI number NP_001413399.1) and FNX (NCBI number NP_001413440.1) from Spinacia oleracea, Pdr (NCBI number WP_032492634.1) and Pdx (NCBI number WP_032492635.1) from Pseudomonas monteilii, and ARH1 (Gene ID 851982) and YAH1 (Gene ID 855824) and Bos from Saccharomyces cerevisiae. Using Adr (NCBI ID NP_777116.2) and Adx (NCBI ID NP_851354.1) derived from *Taurus*, *Saccharomyces cerevisiae* strains YF21-1, YF21-2, YF21-3, and YF21-4 were prepared, respectively. The yields of the target products neoxanthin and purpuric xanthin, and OD... 600 As shown in Table 6.

[0148] Table 6. Neoxanthin and ozonoxanthin yields and OD values ​​of recombinant strains incorporating ferrooxidase protein combinatorial genes from different sources. 600

[0149]

[0150] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A Saccharomyces cerevisiae strain producing neoxanthin and violaxanthin, characterized in that, The *Saccharomyces cerevisiae* strain was enhanced to express truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, and endoplasmic reticulum size regulator INO2; and heterologously expressed geranyl-geranyl diphosphate synthase CrtE, phytopene dehydrogenase CrtI, 15-cis-phytopene synthase CrtB, bifunctional lycopene cyclase / phytopene synthase CrtYB, β-carotene hydroxylase CrtZ, truncated mutant t24ZEP of zeaxanthin cyclooxygenase, mutant MBP-t19VDL1 of zeaxanthin decyclooxygenase-like protein, and ferrooxidase pairs RFNR1 and FD3. Simultaneously, the transcriptional repressor ROX1 of the ergosterol biosynthesis gene and the galactose / lactose metabolism regulator GAL80 were knocked out, and the expression of squalene synthase ERG9 was downregulated. Among them, the ferrooxidoreduction protein RFNR1-FD3 is derived from Arabica thaliana.

2. The brewing yeast according to claim 1, characterized in that, The Saccharomyces cerevisiae further heterologously expresses an acetaldehyde dehydrogenase EutE, wherein the expression of EutE is enhanced by P GAL7 The promoter enhances the expression of acetaldehyde dehydrogenase EutE, NCBI No. WP_001075673.

1.

3. The brewing yeast according to claim 1, characterized in that, The Saccharomyces cerevisiae is capable of producing 3-hydroxy-3-methylglutaryl coenzyme A reductase tHMG1 by P GPD The Saccharomyces cerevisiae is capable of producing 3-hydroxy-3-methylglutaryl coenzyme A reductase tHMG1 by P By P PGK1 Promoter-enhanced expression of endoplasmic reticulum size regulator IN02; By P TEF1 Promoters respectively enhance the expression of farnesyl pyrophosphate synthase ERG20, isopentenyl pyrophosphate isomerase IDI1 and 15-cis octahydrolycopene synthase CrtB. By P GAL1,10 The bidirectional promoters respectively enhance the expression of phytoene dehydrogenase Crtl, geranylgeranyl diphosphate synthase CrtE, t24 ZEP and ferredoxin on RFNR1 and FD3. By P GAL7 Promoters were used to enhance the expression of bifunctional phytoene cyclase / homomeric phytoene synthase CrtYB, β-carotene hydroxylase CrtZ, truncated mutant t24ZEP of zeaxanthin epoxidase and mutant MBP-t19VDL1 of violaxanthin de-epoxidase-like protein, respectively; By replacing the P ERG9 The natural promoter was replaced by P HXT1 The expression of squalene synthase ERG9 was down-regulated by the promoter 4. The brewing yeast according to claim 1, characterized in that, The copy number of the β-carotene hydroxylase CrtZ is 3, the copy number of the truncated mutant t24ZEP of zeaxanthin cyclooxygenase is 3, the copy number of the zeaxanthin decyclooxygenase-like protein mutant MBP-t19VDL1 is 6, and the copy number of the ferrooxidase protein RFNR1-FD3 is 1.

5. The brewing yeast according to claim 2, characterized in that, The copy number of the β-carotene hydroxylase CrtZ is 3, the copy number of the truncated mutant t24ZEP of zeaxanthin cyclooxygenase is 3, the copy number of the zeaxanthin decyclooxygenase-like protein mutant MBP-t19VDL1 is 6, the copy number of the ferrooxidase RFNR1-FD3 is 1, and the copy number of the acetaldehyde dehydrogenase EutE is 1.

6. The brewing yeast according to claim 1, characterized in that, The Gene ID of the truncated 3-hydroxy-3-methylglutaryl-CoA reductase is 42650; the Gene ID of the isopentenyl pyrophosphate isomerase IDI1 is 855986; the Gene ID of the farnesyl pyrophosphate synthase ERG20 is 853272; the Gene ID of the endoplasmic reticulum size regulator INO2 is 851701; the Gene ID of the transcriptional repressor of the ergosterol biosynthesis gene is 856178; the Gene ID of the geraniol-geraniol diphosphate synthase CrtE is 45505274; the Gene ID of the phytoene dehydrogenase CrtI is 37729024; and the Gene ID of the 15-cis-phytoene synthase CrtB is... The Gene IDs of the following gene sequences are as follows: ID 429485116; GenBank ID ALK24266.1 for the bifunctional lycopene cyclase / hydrolycopene synthase CrtYB; Gene ID 854954 for the galactose / lactose metabolism regulator protein GAL80; GenBank ID CRH37458.1 for the β-carotene hydroxylase CrtZ; GenBank ID AAR11195.1 for the truncated mutant t24ZEP of zeaxanthin cyclooxygenase; GenBank ID EEC48043.1 for the mutant MBP-t19VDL1 of the xanthin decyclooxygenase-like protein; NCBI ID NP_567293.1 for the ferric oxide-reduction protein RFNR1; GenBank ID OAP10276.1 for the ferric oxide-reduction protein FD3; and Gene ID 856597 for ERG9.

7. The brewing yeast according to claim 1, characterized in that, The brewing yeast strain used was brewing yeast BY4741 as the starting strain.

8. A microbial inoculum containing the Saccharomyces cerevisiae according to any one of claims 1-7.

9. The use of the Saccharomyces cerevisiae according to any one of claims 1-7, or the microbial agent according to claim 8, in the preparation of azoxanthin and / or neoxanthin.

10. A method for preparing violetin and / or neoxanthin, characterized in that, The preparation method involves inoculating the Saccharomyces cerevisiae according to any one of claims 1-7 or the microbial agent according to claim 8 into a culture medium for fermentation culture.

Images