Bacillus subtilis with nematocidal function and application thereof

Abstract

The application discloses a bacillus subtilis with nematode-killing function and a preparation method and application thereof. The bacillus subtilis with nematode-killing function secretes a toxic protein against nematodes, a toxic protein gene expression vector is introduced into the bacillus subtilis, and a promoter and a signal peptide are systematically screened, so that a bacillus subtilis strain capable of efficiently secreting and expressing the toxic protein is constructed. The application further discloses a construction method of the strain, a microbial inoculant containing the strain and a production method of the microbial inoculant. The strain does not contain an antibiotic resistance gene, is high in safety, is stable in target gene, and is suitable for industrial production, with a fermentation broth active bacteria number of 100 billion cfu / ml and a spore rate of more than 90%. The strain and the inoculant have a significant killing effect on plant parasitic nematodes such as rotten stem nematodes, with a 72h corrected mortality rate of more than 55%, can replace high-toxicity chemical nematode-killing agents, and realize green prevention and control of agricultural nematodes.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and particularly relates to the fields of microbial engineering and agricultural biological control. Specifically, it involves modifying Bacillus subtilis using synthetic biology techniques to enable it to secrete toxic proteins against nematodes, and then applying it to the preparation of nematicide microbial agents. Background Technology

[0002] Plant-parasitic nematodes (PPNs) are among the most significant pests and diseases affecting global agriculture, causing enormous yield losses annually. It is estimated that global agriculture suffers losses of up to $157 billion annually due to nematode damage. While traditional chemical nematicides are highly effective, their high toxicity, environmental residues, and potential harm to ecosystems and human health are increasingly prominent, leading to strict restrictions on their use. Therefore, developing efficient, environmentally friendly, and sustainable nematode control strategies has become a key focus of current agricultural research.

[0003] Biological control, as a green alternative, utilizes microorganisms and their metabolites to control plant parasitic nematodes (PPNs), demonstrating enormous application potential. Currently, various bacteria and fungi have been found to have antagonistic effects on nematodes. They can secrete various hydrolytic enzymes, toxins, secondary metabolites, or volatile organic compounds, directly killing nematodes or inducing resistance in plants. For example, *Bacillus thuringiensis* produces the cytotoxic protein *Cry*, which can disrupt the nematode's gut, exhibiting significant nematicidal activity without harming the environment or humans (Ayaz M, Zhao JT, Zhao W, et al. Biocontrol of plant parasitic nematodes by bacteria and fungi: a multi-omics approach for the exploration of novel nematicides in sustainable agriculture).

[0004] Bacillus subtilis is one of the most widely used agricultural microbial strains, characterized by the secretion of various bioactive substances, promotion of plant growth, induction of plant disease resistance, and spore formation under harsh environments. However, Bacillus subtilis in nature typically lacks the ability to effectively kill nematodes. Some literature reports on expressing Bacillus thuringiensis insecticidal proteins Cry1Ac and Vip3A in Bacillus subtilis to enhance its insecticidal ability, but these methods all rely on antibiotic resistance markers and lack systematic screening of promoters and signal peptides. Furthermore, there is no technical approach to ensure 100% stability of the target gene during passage and sporulation under antibiotic-free conditions (Qiu Sixin, Fan Xiaojing, Hong Pengxiang, et al., Expression of Bacillus thuringiensis insecticidal protein gene vip3A in Bacillus subtilis; Liu Jining, Liu Xianjin, Yu Xiangyang, et al., Construction of Cry1Ac gene vector and its insecticidal activity expression in Bacillus subtilis). Summary of the Invention

[0005] The purpose of this invention is to introduce a nematode-targeting toxin protein gene into *Bacillus subtilis* without introducing an antibiotic resistance gene, using synthetic biology techniques, to obtain a *Bacillus subtilis* strain with the target gene stable during passage and sporulation. Simultaneously, through systematic screening of promoters and signal peptides, the optimal combination for target gene secretion and expression is obtained. Using the *Bacillus subtilis* strain obtained by this invention, sporulations are obtained through fermentation for the production of microbial inoculants, providing a new solution for the green control of plant parasitic nematodes. The purpose of this invention is to provide a *Bacillus subtilis* strain capable of secreting a nematode-targeting toxin protein and its application in the field of nematode control.

[0006] To achieve the above objectives, the present invention provides a Bacillus subtilis strain with nematode-killing function. The Bacillus subtilis strain with nematode-killing function is obtained by knocking out the alarA gene in the genome of the Bacillus subtilis strain to obtain an auxotrophic chassis strain. A nucleic acid molecule carrying an alarA gene expression cassette and a nematicidal toxin protein expression cassette but not containing an antibiotic resistance gene is introduced into the auxotrophic chassis strain. The nematicidal toxin protein is Cry1518-45, a toxin protein from Bacillus thuringiensis YBT-1518.

[0007] The Bacillus subtilis with nematode-killing function described in this invention is a Bacillus subtilis that secretes toxic proteins against nematodes. After five consecutive passages without antibiotic pressure, the target gene retention rate of the Bacillus subtilis with nematode-killing function described in this invention is 100%, and the target gene retention rate in the spores is also 100%.

[0008] Preferably, the nucleic acid molecule carrying the alarA gene expression cassette and the nematicide protein expression cassette but not containing the antibiotic resistance gene is a nucleic acid molecule that expresses the alarA gene and the nematicide protein but does not express the antibiotic resistance gene. The nucleic acid molecule is preferably an expression vector, such as a plasmid vector, a linear multimer, or other common DNA forms.

[0009] Preferably, the toxic protein is Cry1518-45 from Bacillus thuringiensis YBT-1518, with NCBI number ABW88932.

[0010] Preferably, the amino acid sequence of the toxic protein Cry1518-45 is shown in SEQ ID NO: 14.

[0011] In any of the above-mentioned preferred embodiments, the nematicide protein expression cassette is composed of a P43 promoter, an amyE signal peptide, a Cry1518-45 encoded nucleic acid, and an amyE terminator connected in series.

[0012] Preferably, the P43 promoter is a nucleic acid with a nucleotide sequence as shown in SEQ ID NO: 15.

[0013] Preferably, the amino acid sequence of the amyE signal peptide is shown in SEQ ID NO: 21.

[0014] Preferably, Cry1518-45 encodes a nucleic acid with a nucleotide sequence as shown in SEQ ID NO: 1.

[0015] Preferably, the amyE terminator is a nucleic acid with a nucleotide sequence as shown in SEQ ID NO: 24.

[0016] In any of the above preferred embodiments, using Bacillus subtilis as the starting strain, the genomic alrA gene is knocked out to obtain an auxotrophic chassis strain, wherein the knocked-out genomic alrA gene is a nucleic acid fragment between the two homologous arms of the alrA gene of the knocked-out starting strain, and the two homologous arms of the alrA gene are nucleic acid fragments amplified using primer P23 shown in SEQ ID NO: 39 and primer P24 shown in SEQ ID NO: 40, and nucleic acid fragments amplified using primer P25 shown in SEQ ID NO: 41 and primer P26 shown in SEQ ID NO: 42.

[0017] Preferably, the nucleotide sequence of the alarA gene expression cassette carried by the nucleic acid molecule introduced into the auxotrophic chassis strain is shown in SEQ ID NO: 53.

[0018] Preferably, the starting strain is *Bacillus subtilis*, an agricultural biocontrol strain. More preferably, an auxotrophic chassis is obtained by knocking out the *alrA* gene in the genome of *Bacillus subtilis*, the starting strain.

[0019] Preferably, the starting strain is at least one of Bacillus subtilis BIB-9, Bacillus subtilis NTGB-178, or Bacillus subtilis HMB19198.

[0020] The present invention also provides a method for constructing Bacillus subtilis with nematode-killing function as described in any of the above claims, comprising the following steps:

[0021] Step 1: Construction of chassis strain: Using Bacillus subtilis as the starting strain, the alrA gene in the genome was knocked out;

[0022] Step 2: Construction of the expression strain: A linear multimer containing a promoter fragment, a signal peptide fragment, a target gene fragment, a terminator fragment, and a vector backbone fragment was prepared; the linear multimer was transformed into Bacillus subtilis competent cells, and positive transformants were obtained through screening and sequencing verification to obtain the target strain. The target gene fragment is the Cry1518-45 gene fragment, preferably a nucleic acid fragment with a nucleotide sequence as shown in SEQ ID NO: 1.

[0023] In any of the above-mentioned preferred embodiments, in step 2, the vector backbone fragment contains the Bacillus subtilis alarA gene. More preferably, the Bacillus subtilis alarA gene contained in the vector backbone fragment is the alarA gene expression cassette described in any of the above-mentioned embodiments, and the preferred nucleotide sequence is shown in SEQ ID NO: 53.

[0024] In a preferred embodiment of the present invention, a method for constructing Bacillus subtilis with nematode-killing function is provided, wherein the Bacillus subtilis with nematode-killing function secretes a toxic protein against nematodes:

[0025] Step 1: Construction of the chassis strain: The alcrA gene in the genome of the Bacillus subtilis starting strain was knocked out using gene editing techniques;

[0026] Step 2: Construction of expression strains: Promoter fragment, signal peptide fragment, target gene fragment, terminator fragment, and vector fragment are amplified by PCR. The above fragments are added to a PCR system without primers. The promoter fragment, signal peptide fragment, target gene fragment, and terminator fragment are sequentially ligated into the vector by PCR to form a linear multimer. The vector is then transformed into a chassis strain, plated on the corresponding selection plate, and the correct strain is screened by colony PCR and sequencing.

[0027] Preferably, the method for obtaining the target gene in step 2 is as follows: based on the selected protein sequence, optimization is performed on Bacillus subtilis to obtain the corresponding nucleotide sequence, and then the sequence is synthesized. The optimization method includes conventional optimization methods in the art, such as codon optimization, and the synthesis method is a conventional synthesis method in the art.

[0028] Preferably, in step 2, the promoter is a promoter that promotes gene expression in Bacillus subtilis, including but not limited to P43, P... HpaII P spoVG P Laps P shuttle09 .

[0029] In any of the above-mentioned preferred embodiments, in step 2, the promoter is P43.

[0030] In any of the above-mentioned preferred embodiments, in step 2, the signal peptide is a polypeptide sequence that promotes protein secretion in Bacillus subtilis, including but not limited to SP. AprE SP AmyE SP LytF SP YqxI .

[0031] In any of the above-mentioned preferred embodiments, in step 2, the signal peptide is SP. AmyE This invention is also known as the amyE signal peptide.

[0032] In any of the above-mentioned preferred embodiments, in step 2, the terminator is a nucleic acid sequence that induces transcription termination in Bacillus subtilis, preferably a T sequence. amyE This invention is also known as the amyE terminator.

[0033] Preferably, the nucleotide sequence of promoter P43 is as shown in SEQ ID NO: 15.

[0034] The preferred option among the above is promoter P. HpaII The nucleotide sequence is shown in SEQ ID NO: 16.

[0035] The preferred option among the above is promoter P. spoVG The nucleotide sequence is shown in SEQ ID NO: 17.

[0036] The preferred option among the above is promoter P. Laps The nucleotide sequence is shown in SEQ ID NO: 18.

[0037] The preferred option among the above is promoter P. shuttle09 The nucleotide sequence is shown in SEQ ID NO: 19.

[0038] The preferred embodiment of any of the above is the signal peptide SP. AprE The amino acid sequence is shown in SEQ ID NO: 20.

[0039] The preferred embodiment of any of the above is the signal peptide SP. AmyE The amino acid sequence is shown in SEQ ID NO: 21.

[0040] The preferred embodiment of any of the above is the signal peptide SP. LytF The amino acid sequence is shown in SEQ ID NO: 22.

[0041] The preferred embodiment of any of the above is the signal peptide SP. YqxI The amino acid sequence is shown in SEQ ID NO: 23.

[0042] The preferred option among the above is the amyE terminator (T). amyE The nucleotide sequence of ) is shown in SEQ ID NO: 24.

[0043] Preferably, in step 2, the vector is a Bacillus subtilis vector. The vector fragment obtained by PCR includes the replicon sequence and selection marker from Bacillus subtilis.

[0044] In any of the above-mentioned preferred embodiments, in step 2, the conversion method includes, but is not limited to, chemical conversion, electroconversion, protoplast conversion, etc.

[0045] The present invention also provides a nematicidal microbial agent obtained from Bacillus subtilis with nematicidal function according to any one of the above claims.

[0046] The present invention also provides a method for preparing a nematicidal microbial agent based on Bacillus subtilis with nematicidal function as described in any of the above claims, characterized by comprising the following steps:

[0047] Step a: Seed liquid preparation: Inoculate the Bacillus subtilis with nematode-killing function described in any of the above items into the seed culture medium and culture at 37°C until the OD600 value is 1.0~10.0 to obtain the seed liquid;

[0048] Step b: Fermentation culture: Inoculate the seed liquid obtained in step 1 into the fermentation medium at an inoculation rate of 1%~10% by volume, and ferment at 37℃ for 20~40h to obtain the fermentation broth;

[0049] Step c: Formulation preparation: Prepare the inoculum from the fermentation broth obtained in step b.

[0050] In any of the above-mentioned preferred embodiments, in step c, the fermentation broth obtained in step b is prepared into a corresponding dosage form according to the conventional process for agricultural microbial preparations. Preferably, the dosage form includes at least one of granules, powders, suspensions, or emulsions.

[0051] In any of the above-mentioned preferred embodiments, in step a, the seed culture medium comprises: 5-20 g / L yeast extract, 5-20 g / L peptone, and 1-10 g / L sodium chloride.

[0052] In any of the above-mentioned preferred embodiments, in step a, the seed culture medium comprises 10 g / L yeast extract, 5 g / L peptone and 10 g / L sodium chloride.

[0053] In any of the above preferred embodiments, in step b, the fermentation medium comprises: 3-5 g / L of readily available carbon source, 20-40 g / L of slowly available carbon source, 30-60 g / L of nitrogen source, 3-15 g / L of inorganic salt, and an antifoaming agent.

[0054] Preferably, the fast-acting carbon source is glucose.

[0055] Preferably, the delayed carbon source is corn starch.

[0056] Preferably, the nitrogen source is soybean meal powder.

[0057] In any of the above-mentioned preferred embodiments, in step b, the fermentation culture medium comprises: 3-5 g / L glucose, 20-40 g / L corn starch, 30-60 g / L soybean meal powder, 0-8 g / L yeast powder, 1-5 g / L calcium carbonate, 0-5 g / L sodium chloride, 0.5-1 g / L magnesium sulfate, 1-5 g / L dipotassium hydrogen phosphate, 0-1 g / L manganese sulfate, and 0.1-2 g / L defoamer.

[0058] In one specific embodiment, the fermentation medium consists of: 3 g / L glucose, 40 g / L corn starch, 50 g / L soybean meal powder, 3 g / L yeast powder, 2 g / L calcium carbonate, 5 g / L sodium chloride, 1 g / L magnesium sulfate, 5 g / L dipotassium hydrogen phosphate, 1 g / L manganese sulfate, and 1 g / L foaming agent.

[0059] Preferably, the dosage form of the microbial agent is a conventional preparation such as granules, powder, suspension, or emulsion, and more preferably a powder.

[0060] Preferably, the microbial agent comprises Bacillus subtilis and agriculturally acceptable adjuvants.

[0061] In any of the above-mentioned preferred embodiments, the powder is obtained by mixing Bacillus subtilis fermentation broth and excipients at a mass ratio of 1:1 to 1:10, and then drying them in a spray dryer.

[0062] Preferably, the inlet temperature of the spray dryer is 115°C and the outlet temperature is 80°C.

[0063] In a preferred embodiment of the present invention, in step c, the fermentation broth and the auxiliary materials are mixed at a mass ratio of 1:1 and dried using a spray drying tower with an inlet temperature of 115°C and an outlet temperature of 80°C.

[0064] The present invention also provides the application of Bacillus subtilis with nematode-killing function according to any one of the above claims, or the nematode-killing microbial agent according to any one of the above claims, in the control of plant parasitic nematodes.

[0065] The present invention also provides the use of Bacillus subtilis with nematode-killing function according to any one of the above claims, or the nematode-killing microbial agent according to any one of the above claims, in the preparation of drugs for controlling plant parasitic nematodes.

[0066] Preferably, the Bacillus subtilis or the nematicidal microbial agent is applied to the crop planting soil, crop roots, or crop plants to kill plant parasitic nematodes such as root-knot nematodes, cyst nematodes, and stem rot nematodes.

[0067] The *Bacillus subtilis* strain with nematode-killing function described in this invention is obtained by transferring a vector containing a toxic protein gene expression cassette into a chassis strain. Preferably, the toxic protein gene expression cassette consists of a P43 promoter, an AmyE signal peptide, a Cry1518-45 gene, and an amyE terminator connected in series. The vector does not contain antibiotic resistance genes and contains the essential *Bacillus subtilis* gene alarA expression cassette. The *Bacillus subtilis* strain secreting a nematode-specific toxic protein provided by this invention significantly enhances its nematode-killing ability compared to ordinary *Bacillus subtilis*. Systematic screening of multiple promoters and signal peptides revealed that the combination of the P43 promoter and the AmyE signal peptide resulted in the highest secretion of the Cry1518-45 protein, achieving unexpected expression effects. The strain of this invention does not contain any antibiotic resistance genes, meets biosafety requirements, and the target gene is stably inherited under antibiotic-free conditions, making it less prone to loss during sporulation. This solves the technical problem of plasmid loss in industrial production and field applications of engineered strains. The fermentation broth can contain up to 10 billion CFU / ml of viable bacteria and has a spore count of over 90%, making it suitable for industrial production. This strain can grow and secrete toxic proteins and other active substances targeting nematodes in the operating environment, killing harmful nematodes, promoting plant growth, and thus possessing potential for agricultural applications. Attached Figure Description

[0068] Figure 1 The image shows the spectrum of plasmid EcDC101 obtained in preferred embodiment 1 of the present invention.

[0069] Figure 2 The SDS-PAGE results show the content of the target protein Bt Cry1518-45 expressed by strains BsD01~BsD05 in the preferred embodiment of the present invention.

[0070] Figure 3 The above are SDS-PAGE results of the expression content of the target protein Bt Cry1518-45 by strains BsD01, BsD06~BsD09 in preferred embodiment 4 of the present invention.

[0071] Figure 4 The image shows the plasmid EcDC110 obtained in preferred embodiment 5 of the present invention. Detailed Implementation

[0072] The present invention will be further described below with reference to specific embodiments, but these embodiments should not be construed as limiting the scope of the present invention.

[0073] Unless otherwise specified, the strains, vectors, reagents, etc. used in this invention are all products already disclosed in the prior art, such as Bacillus subtilis strain Bs168, multicopy vector pWB980, Bacillus subtilis gene editing plasmid pJOE8999, etc., which are all available to the public through sharing or commercial means.

[0074] Example 1

[0075] Example 1 provides a method for cloning the target gene and constructing an expression vector.

[0076] Based on the amino acid sequence of Bacillus thuringiensis YBT-1518 Cry1518-45 (hereinafter referred to as Bt Cry1518-45 in this invention) (NCBI number ABW88932), codon optimization was performed on Bacillus subtilis to obtain the target gene sequence. The nucleotide sequence of the target gene Bt Cry1518-45 is shown in SEQ ID NO: 1. The DNA fragment of the target gene was synthesized by a gene synthesis company. Amplification was performed using primers P5 and P7 to obtain the target gene fragment flanked by homologous arms required for in vitro homologous recombination. The nucleotide sequences of primers P5 and P7 are shown below:

[0077] The nucleotide sequence of primer P5 is shown in SEQ ID NO: 2:

[0078] AACAAAAAATCTATTACTCATGAAGAATTTATTAGAC

[0079] The nucleotide sequence of primer P7 is shown in SEQ ID NO: 3:

[0080] TTATGAAAATCTAGGATTAAAATTTACCTGAATTAATG

[0081] Using the Bacillus subtilis Bs168 genome as a template, primers P1 and P3, P4 and P6, and P8 and P9 were used to amplify the P43 promoter sequence and the AmyE signal peptide (signal peptide SP). AmyE ) sequence and amyE terminator (T amyE The primer sequences are shown below:

[0082] The nucleotide sequence of primer P1 is shown in SEQ ID NO: 4:

[0083] TGATAGGTGGTATGTTTTCGC

[0084] The nucleotide sequence of primer P3 is shown in SEQ ID NO: 5:

[0085] GTGTACATTCCTCTCTTACCTATAATG

[0086] The nucleotide sequence of primer P4 is shown in SEQ ID NO: 6:

[0087] GGTAAGAGAGGAATGTACACATGTTTGCAAAACGATTCAAAAC

[0088] The nucleotide sequence of primer P6 is shown in SEQ ID NO: 7:

[0089] CATGAGTAATAGATTTTTTGTTAGCACTCGCAGCCGCCGG

[0090] The nucleotide sequence of primer P8 is shown in SEQ ID NO: 8:

[0091] TTTTAATCCTAGATTTTCATAAGGGCAAGGCTAGACGGGAC

[0092] The nucleotide sequence of primer P9 is shown in SEQ ID NO: 9:

[0093] ATTCGTTCTTTTTAGGTTCTGAAAAGTTTTGTCTGATTTATGAACAAAAAAG

[0094] Using the multicopy vector pWB980 as a template, the vector fragment was amplified with primers P2 and P10.

[0095] The nucleotide sequence of primer P2 is shown in SEQ ID NO: 10:

[0096] GCGAAAACATACCACCTATCACAGTGCCGACCAAAACCATAAAAC

[0097] The nucleotide sequence of primer P10 is shown in SEQ ID NO: 11:

[0098] AGAACCTAAAAAGAACGAATTTGAACTAAC

[0099] The above PCR reaction used Novizan 2×Phanta Flash Master Mix DNA polymerase premix. The reaction system preparation and program settings are as per the instruction manual.

[0100] The amplified fragments were collected using gel extraction and assembled using in vitro homologous recombination. The reagents used were premixed solutions from the Novizan ClonExpress Ultra One Step Cloning Kit; the reaction system preparation and procedure settings were performed according to the instruction manual.

[0101] After the reaction was completed, the assembled fragments were transformed into DH5α Escherichia coli chemocompetent cells, plated on LB agar plates containing 50 mg / L kanamycin, and incubated overnight at 37°C.

[0102] Colonies were picked from the plate for colony PCR. The primers used were P11 and P12, and the DNA polymerase used was Novizan 2×Rapid Taq Master Mix. The reaction system preparation and program settings were in accordance with the instruction manual. The correct plasmid should amplify a band of 2339 bp.

[0103] The nucleotide sequence of primer P11 is shown in SEQ ID NO: 12:

[0104] ACACCTTTTCAGGTGCTTTTTTTATTTTATAAAC

[0105] The nucleotide sequence of primer P12 is shown in SEQ ID NO: 13:

[0106] TACCTGTCCCTTGCTGATTTTTAAAC

[0107] Colonies that were correctly verified by PCR were inoculated into LB medium (containing kanamycin) and cultured. Plasmids were extracted and sequenced. The plasmid that was correctly sequenced was the target plasmid and named EcDC101 (see diagram). Figure 1 (As shown).

[0108] Example 2

[0109] Example 2 provides a method for constructing the target strain.

[0110] Using Bacillus subtilis BIB-9 as the substrate, competent cells were prepared using the Spizizen method, transformed into EcDC101, and plated onto LB agar plates containing 50 mg / L kanamycin. The cells were then incubated overnight at 37°C. The colonies that grew on the plates were the target strain, named BsD01.

[0111] Example 3

[0112] Example 3 illustrates the promoter screening method and results.

[0113] Using plasmid EcDC101 as a template, the expression vector fragment without a promoter was amplified using primers P31 and P32. Then, the promoter P was amplified using primers P33 and P34, P35 and P36, P37 and P38, and P39 and P40, respectively. HpaII P spoVG P shuttle09 P Laps The amplified fragments were collected using gel extraction, and the expression vector and promoter fragment were assembled using in vitro homologous recombination to construct plasmids EcDC102, EcDC103, EcDC104, and EcDC105. These plasmids were then transformed into Bacillus subtilis BIB-9 to obtain the corresponding expression strain BsD02 (P HpaII ), BsD03 (P spoVG ), BsD04 (P shuttle09 ) and BsD05 (P Laps ).

[0114] The sequences and construction methods of plasmids EcDC102, EcDC103, EcDC104, and EcDC105 in Example 3 are similar to those in Example 1, with the only difference being the promoter sequence. The methods for obtaining expression strains BsD02, BsD03, BsD04, and BsD05 are similar to those in Example 2.

[0115] The nucleotide sequences of primers P31 to P40 are shown below:

[0116] The nucleotide sequence of primer P31 is shown in SEQ ID NO: 25:

[0117] CAGTGCCGACCAAAACCATAAAAC

[0118] The nucleotide sequence of primer P32 is shown in SEQ ID NO: 26:

[0119] ATGTTTGCAAAACGATTCAAAAC

[0120] The nucleotide sequence of primer P33 is shown in SEQ ID NO: 27:

[0121] TATGGTTTTGGTCGGCACTGGATCTTCTCAAAAAATACTACCTGTCC

[0122] The nucleotide sequence of primer P34 is shown in SEQ ID NO: 28:

[0123] GCGAAAACATACCACCTATCAAAGTAAAGTATAACACACTATACTTTATATTCATAAAGTG

[0124] The nucleotide sequence of primer P35 is shown in SEQ ID NO: 29:

[0125] TATGGTTTTGGTCGGCACTGCAAAAGCAGTCCACACAAAAC

[0126] The nucleotide sequence of primer P36 is shown in SEQ ID NO: 30:

[0127] GCGAAAACATACCACCTATCAAGTAGTTCACCACCTTTTCCC

[0128] The nucleotide sequence of primer P37 is shown in SEQ ID NO: 31:

[0129] TATGGTTTTGGTCGGCACTGGATCGTCACAATGCGCCATC

[0130] The nucleotide sequence of primer P38 is shown in SEQ ID NO: 32:

[0131] GCGAAAACATACCACCTATCAGGATCCCACTTTATGGACGC

[0132] The nucleotide sequence of primer P39 is shown in SEQ ID NO: 33:

[0133] TATGGTTTTGGTCGGCACTGCTCAGGAGCATTTAACCTAAAAAAGC

[0134] The nucleotide sequence of primer P40 is shown in SEQ ID NO: 34:

[0135] GCGAAAACATACCACCTATCAGTTTCCTCTCTCCCTCTAATC

[0136] BsD01–BsD05 strains were inoculated into LB medium and cultured overnight at 37°C with shaking. Then, at a 2% inoculation rate, they were inoculated into 2xSR medium (50 g / L yeast extract, 30 g / L peptone, 6 g / L potassium dihydrogen phosphate) and cultured at 37°C with shaking for 48 h. The fermentation broth was centrifuged every 24 h to obtain the supernatant, and the content of the target protein Bt Cry1518-45 was detected by SDS-PAGE. The results are shown below. Figure 2 As shown.

[0137] Fermentation results showed that different promoters had significantly different effects on the expression of the target protein, with the P43 promoter showing significantly better expression than the P43 promoter. HpaII P spoVG P shuttle09 and P Laps .

[0138] Example 4

[0139] Example 4 provides a method and results for screening signal peptides.

[0140] Using plasmid EcDC101 as a template, expression vectors without signal peptides were amplified using primers P41 and P42, P43 and P44, and P45 and P46, respectively. Simultaneously, AprE, LytF, and YxqI signal peptide sequences, along with homologous sequences for plasmid construction, were introduced to the 3' end of each primer. Furthermore, expression vectors without signal peptides were amplified using primers P3 and P47 for constructing expression plasmids without signal peptides. The amplified fragments were collected using gel extraction and assembled into expression vectors using in vitro homologous recombination to construct plasmids EcDC106, EcDC107, EcDC108, and EcDC109. These plasmids were then transformed into Bacillus subtilis BIB-9 to obtain the corresponding expression strain BsD06 (SP). AprE ), BsD07 (SP) LytF ), BsD08 (SP YqxI The primers are P41, P42, P43, P44, P45, P46, and P47, for BsD09 (no signal peptide) and BsD09 (no signal peptide).

[0141] The nucleotide sequence of primer P41 is shown in SEQ ID NO: 54:

[0142] CGCCATCGTAAAGATTAACGTTAACGCAAACAACAAGCTGATCCACAATTTTTTGCTTCTCATGTGTACATTCCTCTCTTACCTATAATG

[0143] The nucleotide sequence of P42 is shown in SEQ ID NO: 55:

[0144] CGTTAATCTTTACGATGGCGTTCAGCAACATGTCTGCGCAGGCTAACAAAAAATCTATTACTCATGAAGAATTTATTAGAC

[0145] The nucleotide sequence of P43 is shown in SEQ ID NO: 56:

[0146] CACTACTAAAGTTGTGCCGACAATCGCAGATGCTGTCAGCCCTGCTGCTAATTTCTTTTTCATGTGTACATTCCTCTCTTACCTATAATG

[0147] The nucleotide sequence of P44 is shown in SEQ ID NO: 57:

[0148] GTCGGCACAACTTTAGTAGTGACACCAGCTGAAGCAAACAAAAAATCTATTACTCATGAAGAATTTATTAGAC

[0149] The nucleotide sequence of P45 is shown in SEQ ID NO: 58:

[0150] CGGAAGAACTAATGATAAAGAGAATGTTAATGCAGATGTTGCTAAAAGTAATTTCTTAAACATGTGTACATTCCTCTCTTACCTATAATG

[0151] The nucleotide sequence of P46 is shown in SEQ ID NO: 59:

[0152] CTTTATCATTAGTTCTTCCGTTGGATGGACATGCCAAAGCTAACAAAAAATCTATTACTCATGAAGAATTTATTAGAC

[0153] The nucleotide sequence of P47 is shown in SEQ ID NO: 60:

[0154] GGTAAGAGAGGAATGTACACAACAAAAAATCTATTACTCATGAAGAATTTATTAGAC

[0155] BsD01, BsD06~BsD09 strains were inoculated into LB medium and cultured overnight at 37°C with shaking. Then, 2% of the inoculum was inoculated into 2xSR medium and cultured at 37°C with shaking for 48 hours. The fermentation broth was centrifuged every 24 hours to obtain the supernatant, and the target protein content was detected by SDSPAGE. The results are shown below. Figure 3 As shown.

[0156] Fermentation results showed that different signal peptides had significantly different effects on promoting the secretion of target proteins, with AmyE signal peptide showing a significantly better secretion effect than SP. AprE SP LytF SP YqxI And no signal peptide.

[0157] Example 5

[0158] Example 5 provides the construction of a target strain without antibiotic resistance genes.

[0159] (1) Chassis modification

[0160] Based on the Bacillus subtilis gene editing plasmid pJOE8999, a gene editing plasmid that knocks out the alarA gene in the Bacillus subtilis genome was constructed.

[0161] pJOE8999 was digested with BsaI (NEB) to obtain the vector fragment; the gRNA targeting fragment was obtained by annealing with primers P19 and P20; and the two fragments were ligated together using T4 DNA (NEB) ligase to construct plasmid EcDC102. All procedures were performed according to the manufacturer's instructions. The nucleotide sequences of primers P19 and P20 are shown below:

[0162] The nucleotide sequence of primer P19 is shown in SEQ ID NO: 35:

[0163] TACGTGACGCAGGTGCTTCATGCT

[0164] The nucleotide sequence of primer P20 is shown in SEQ ID NO: 36:

[0165] AAACAGCATGAAGCACCTGCGTCA

[0166] The ligated fragments were transformed into DH5α Escherichia coli chemocompetent cells, plated on LB agar plates containing 50 mg / L kanamycin, and incubated overnight at 37°C.

[0167] Colonies were picked from the plate for colony PCR. Primers P21 and P22 were used, and the DNA polymerase used was Novizan 2×Rapid Taq Master Mix. The reaction system preparation and program settings were performed according to the instruction manual. The correct plasmid should amplify a 463bp band. Primers P21 and P22 are shown below:

[0168] The nucleotide sequence of primer P21 is shown in SEQ ID NO: 37:

[0169] GACCTCAAAAAGGTCTTTAATTAACATC

[0170] The nucleotide sequence of primer P22 is shown in SEQ ID NO: 38:

[0171] CTTATCCATCAATCCATCACTGG

[0172] The colonies that were verified by PCR were inoculated into LB medium (containing kanamycin) and cultured. The plasmid was extracted and sequenced. The plasmid that was correctly sequenced was the target plasmid and named EcDC201.

[0173] The vector was obtained by double digestion of EcDC201 with Sal1(NEB) and Xba1(NEB).

[0174] Using the Bacillus subtilis Bs168 genome as a template, primers P23 and P24, P25 and P26 were used to amplify the left and right homologous arms of the homologous recombination knockout alarA gene.

[0175] The nucleotide sequence of primer P23 is shown in SEQ ID NO: 39:

[0176] TAATACGACTCACTATAGGGGGCGAAAGAATACACCTCGTAC

[0177] The nucleotide sequence of primer P24 is shown in SEQ ID NO: 40:

[0178] TACGACACTTCCTAGCTTTATTCAATATC

[0179] The nucleotide sequence of primer P25 is shown in SEQ ID NO: 41:

[0180] AAAAGCTAGGAAGTGTCGTACTTACCTAAATGGAGAATTCATAAAACAGC

[0181] The nucleotide sequence of P26 is shown in SEQ ID NO: 42:

[0182] GATGAAGATTATTTCTTAATGTCTAAAAATCAATGAGTGCCAAAC

[0183] The amplified fragments were collected using gel extraction and assembled using in vitro homologous recombination. The reagents used were premixed solutions from the Novizan ClonExpress Ultra One Step Cloning Kit; the reaction system preparation and procedure settings were performed according to the instruction manual.

[0184] After the reaction was completed, the assembled fragments were transformed into DH5α Escherichia coli chemocompetent cells, plated on LB agar plates containing 50 mg / L kanamycin, and incubated overnight at 37°C.

[0185] Colonies were picked from the plate for colony PCR. Primers P27 and P28 were used, and the DNA polymerase used was Novizan 2×Rapid Taq Master Mix. The reaction system preparation and program settings were performed according to the instruction manual. The correct plasmid should amplify a 2192bp band. Primers P27 and P28 are shown below:

[0186] The nucleotide sequence of primer P27 is shown in SEQ ID NO: 43:

[0187] GACCTCAAAAAGGTCTTTAATTAACATC

[0188] The nucleotide sequence of P28 is shown in SEQ ID NO: 44:

[0189] CTTATCCATCAATCCATCACTGG

[0190] Colonies that were verified by PCR were inoculated into LB medium (containing kanamycin) for culture, plasmids were extracted, and sequencing was performed. The plasmid that was correctly sequenced was the target plasmid and named EcDC202.

[0191] Using Bacillus subtilis BIB-9 as the substrate, competent cells were prepared using the Spizizen method, transformed into EcDC202, and plated onto LB agar plates containing 50 mg / L kanamycin and D-alanine, and incubated overnight at 30°C.

[0192] Colonies were picked from the plate for colony PCR. Primers P29 and P30 were used, and the DNA polymerase used was Novizan 2×Rapid Taq Master Mix. The reaction system preparation and program settings were performed according to the instruction manual. The correct strain should amplify a 2378bp band. Primers P29 and P30 are shown below:

[0193] The nucleotide sequence of primer P29 is shown in SEQ ID NO: 45:

[0194] TGATAGTGCATTAAGGGAGACAAG

[0195] The nucleotide sequence of primer P30 is shown in SEQ ID NO: 46:

[0196] AACTTCATAGACAGTCCGATTTGG

[0197] Select the correct strain and inoculate it into LB medium (containing D-alanine) and culture at 37°C for 24 hours. Spread it on LB plates (containing D-alanine) and culture at 37°C overnight. Select single colonies and streak them onto LB medium (containing D-alanine) and LB medium (containing D-alanine and kanamycin). The strain that grows on the former and does not grow on the latter is the strain that has successfully knocked out the alarA gene through gene editing and is named Bs01.

[0198] (2) Strain construction

[0199] Using plasmid EcDC101 as a template, the vector fragment lacking the kanamycin resistance gene and E. coli replicons was amplified using primers P13 and P14, as shown below:

[0200] The nucleotide sequence of primer P13 is shown in SEQ ID NO: 47:

[0201] CTATTAATAACTCGTCTTCCTAAGCATC

[0202] The nucleotide sequence of primer P14 is shown in SEQ ID NO: 48:

[0203] ATTATTAATCTGTTCAGCAATCGGG

[0204] Using the Bacillus subtilis Bs168 genome as a template, the alarA gene expression cassette sequence was amplified using primers P15 and P16. This gene is essential for Bacillus subtilis; strains lacking this gene cannot grow under natural conditions. Primers P15 and P16 are shown below:

[0205] The nucleotide sequence of primer P15 is shown in SEQ ID NO: 49:

[0206] GGAAGACGAGTTATTAATAGTTTGGCCTTTTTTTCGTTAGACATC

[0207] The nucleotide sequence of primer P16 is shown in SEQ ID NO: 50:

[0208] TTGCTGAACAGATTAATAATGCTGTTTTATGAATTCTCCATTAGG

[0209] The above PCR reaction used Novizan 2×Phanta Flash Master Mix DNA polymerase premix. The reaction system preparation and program settings are as per the instruction manual.

[0210] The amplified fragments were collected using gel extraction and 100 ng was added to the PCR system. Linear multimers were obtained by amplification without primers. The reagent used was 2×Phanta Flash Master Mix DNA polymerase premix; the reaction system preparation and program settings were as per the manufacturer's instructions.

[0211] Bacillus subtilis Bs01 was used as the substrate bacteria. Competent cells were prepared using the Spizizen method, transformed into linear multimers, plated on LB plates, and incubated overnight at 37°C.

[0212] Colonies were picked from the plate for colony PCR. Primers P17 and P18 were used, and the DNA polymerase used was Novizan 2×Rapid Taq Master Mix. The reaction system preparation and program settings were performed according to the instruction manual. The correct strain should amplify a 1560bp band. Primers P17 and P18 are shown below:

[0213] The nucleotide sequence of primer P17 is shown in SEQ ID NO: 51:

[0214] GAGTAGTTCAACAAACGGGC

[0215] The nucleotide sequence of primer P18 is shown in SEQ ID NO: 52:

[0216] GTCCGTTTTGTCTAGCTTACC

[0217] Colonies that were verified by PCR were inoculated into LB medium and cultured. Plasmids were extracted and sequenced. The plasmid that was correctly sequenced was the target plasmid and named EcDC110 (e.g., EcDC110). Figure 4 (As shown). The correctly sequenced strain is the target strain, named Bs02, which is the Bacillus subtilis strain with nematode-killing function of this invention.

[0218] Example 6

[0219] Example 6 provides the stability test results of the target gene in the target strain without the resistance gene.

[0220] (1) Transmission stability

[0221] BsD01 and Bs02 strains were inoculated into 5 ml of antibiotic-free LB medium and incubated overnight at 37°C. The bacterial culture was then transferred at 0.1% volume to 5 ml of fresh LB medium and incubated at 37°C for 24 h; this constitutes one subculture. This subculture was repeated 5 times. After each generation, the bacterial culture was serially diluted, plated on LB agar plates, and 100 single colonies were picked for colony PCR. Primers P17 and P18 were used, and the DNA polymerase used was Novizan 2×Rapid Taq Master Mix. The reaction system preparation and program settings were followed according to the manufacturer's instructions. A correct strain should amplify a 1560 bp band. The total number of colonies and the number of verified correct colonies were calculated. The formula for calculating the target gene retention rate is as follows:

[0222]

[0223] The experimental results showed that after 5 subcultures, the retention rate of the target gene in strain Bs02 was 100%, while that in strain BsD01 was 0%.

[0224] (2) Sporulation stability

[0225] BsD01 and Bs02 strains were inoculated into 5 ml of antibiotic-free LB medium and cultured overnight at 37°C. The bacterial culture was then treated at 80°C for 20 min to kill vegetative cells and obtain spores. The treated bacterial culture was serially diluted, plated on LB agar plates, and the retention rate of the target gene was calculated as above.

[0226] The experimental results showed that the retention rate of the target gene in Bs02 spores was 100%, while the retention rate of the target gene in BsD01 spores was 37.5%.

[0227] In summary, strains containing essential gene tag plasmids exhibited stable target genes during growth and sporulation under antibiotic-free conditions, significantly outperforming traditional resistance gene tag plasmids.

[0228] Example 7

[0229] Example 7 provides a method for preparing microbial inoculants.

[0230] (1) Seed liquid preparation

[0231] Streak Bs02 glycerol bacteria on LB agar plates and incubate overnight at 37°C.

[0232] Pick colonies and inoculate them into 300 ml of LB medium. Incubate overnight at 37°C.

[0233] (2) Culture medium preparation

[0234] Prepare 30L of fermentation medium according to Table 1 and sterilize at 121℃ for 20min.

[0235] Table 1:

[0236]

[0237] (3) Fermentation

[0238] The seed culture was inoculated into the fermentation medium and fermented at 37°C, with dissolved oxygen controlled to be greater than 30%. Fermentation was stopped after microscopic observation showed that the sporulation rate was greater than 90%.

[0239] The fermentation broth was treated at 80℃ for 20 min to kill vegetative cells and obtain spores. The treated broth was serially diluted and plated on LB agar plates. Simultaneously, untreated fermentation broth was serially diluted and plated on LB agar plates. The viable cell count and spore count were calculated, and the spore rate was calculated as (spore count / viable cell count) × 100%. The results showed that the viable cell count in the fermentation broth reached 10.3 billion CFU / ml, and the spore rate reached 93.2%.

[0240] (4) Spray drying

[0241] The fermentation broth and auxiliary materials were mixed at a mass ratio of 1:1 and dried using a spray drying tower with an inlet temperature of 115℃ and an outlet temperature of 80℃.

[0242] The preferred excipient is gluten powder, which is a conventional product in the prior art and can be obtained by purchasing goods. All gluten powders sold in the prior art are applicable to this invention, including but not limited to gluten powder from Jinan Yufeng Chemical Co., Ltd.

[0243] Example 8

[0244] Example 8 provides the results of the nematicidal activity assay of the strain.

[0245] Healthy and active stem nematodes were isolated from diseased potato tubers, washed three times with sterile water, and counted under a microscope to a count of 150 nematodes per dish.

[0246] Bs02 bacterial powder was diluted with sterile water to a concentration of 10. 6 CFU / mL (dilution plating count).

[0247] Add 5 mL of the corresponding reagent to each petri dish (to completely cover the nematodes), and add an equal volume of sterile water or original Bacillus subtilis BIB-9 bacterial suspension to the blank control group. The treatment group and the control group were placed in a constant temperature incubator at 25℃ and kept in the dark.

[0248] Observations were conducted at 24h, 48h, and 72h. Nematodes that remained stiff and motionless and did not respond to stimulation with 0.1mol / L NaOH were considered dead (microscopic observation).

[0249] The formula for calculating the mortality rate is:

[0250]

[0251] Formula for calculating adjusted mortality rate (adjusted case fatality rate):

[0252]

[0253] The corrected mortality rates of nematodes under different bacterial powder treatment conditions are shown in Table 2.

[0254] Table 2: Determination of nematicidal activity of Bacillus subtilis.

[0255] .

Claims

1. A Bacillus subtilis strain with nematode-killing function, characterized in that, The Bacillus subtilis strain with nematode-killing function is obtained by knocking out the alarA gene in the genome of Bacillus subtilis to obtain an auxotrophic chassis strain. A nucleic acid molecule carrying an alarA gene expression cassette and a nematicidal toxin expression cassette but without antibiotic resistance genes is introduced into the auxotrophic chassis strain. The nematicidal toxin is the toxin protein Cry1518-45 from Bacillus thuringiensis YBT-1518.

2. The Bacillus subtilis with nematode-killing function according to claim 1, characterized in that, The amino acid sequence of the toxic protein Cry1518-45 is shown in SEQ ID NO:

14.

3. The Bacillus subtilis with nematode-killing function as described in claim 1, characterized in that, The nematicide protein expression cassette is composed of the P43 promoter, the amyE signal peptide, the Cry1518-45 encoded nucleic acid, and the amyE terminator, which are sequentially connected in series.

4. The Bacillus subtilis with nematode-killing function as described in claim 3, characterized in that, The P43 promoter is a nucleic acid with the nucleotide sequence shown in SEQ ID NO: 15; the amino acid sequence of the amyE signal peptide is shown in SEQ ID NO: 21; the nucleic acid encoding Cry1518-45 is a nucleic acid with the nucleotide sequence shown in SEQ ID NO: 1; the amyE terminator is a nucleic acid with the nucleotide sequence shown in SEQ ID NO: 24; the genomic alrA gene knocked out from Bacillus subtilis is a nucleic acid fragment between the two homologous arms of the alrA gene from the Bacillus subtilis knockout strain, wherein the two homologous arms of the alrA gene are nucleic acid fragments amplified using primers P23 (SEQ ID NO: 39) and P24 (SEQ ID NO: 40), and nucleic acid fragments amplified using primers P25 (SEQ ID NO: 41) and P26 (SEQ ID NO: 42); the nucleotide sequence of the alrA gene expression cassette carried by the nucleic acid molecule introduced into the auxotrophic chassis strain is shown in SEQ ID NO:

53.

5. The Bacillus subtilis with nematode-killing function as described in any one of claims 1 to 4, characterized in that, The starting strain is at least one of Bacillus subtilis BIB-9, Bacillus subtilis NTGB-178, or Bacillus subtilis HMB19198.

6. The method for constructing Bacillus subtilis with nematode-killing function according to any one of claims 1 to 5, characterized in that, Includes the following steps: Step 1: Construction of chassis strain: Using Bacillus subtilis as the starting strain, the alrA gene in the genome was knocked out; Step 2: Construction of the expression strain: Prepare a linear multimer containing a promoter fragment, a signal peptide fragment, a target gene fragment, a terminator fragment, and a vector backbone fragment; transform the linear multimer into Bacillus subtilis competent cells, and obtain positive transformants through screening and sequencing verification to obtain the target strain; the target gene fragment is the Cry1518-45 toxic protein gene fragment.

7. The method for constructing Bacillus subtilis with nematode-killing function according to claim 6, characterized in that, In step 2, the vector backbone fragment contains the Bacillus subtilis alarA gene.

8. The nematicidal microbial agent obtained from Bacillus subtilis with nematicidal function according to any one of claims 1 to 5.

9. The method for preparing nematicidal microbial agents from Bacillus subtilis with nematicidal function according to any one of claims 1 to 5, characterized in that, Includes the following steps: Step a: Seed liquid preparation: Bacillus subtilis with nematode-killing function as described in any one of claims 1 to 5 is inoculated into seed culture medium and cultured at 37°C until the OD600 value is 1.0~10.0 to obtain seed liquid; Step b: Fermentation culture: Inoculate the seed liquid obtained in step 1 into the fermentation medium at an inoculation rate of 1%~10% by volume, and ferment at 37℃ for 20~40h to obtain the fermentation broth; Step c: Formulation preparation: Prepare the inoculum from the fermentation broth obtained in step b.

10. The application of Bacillus subtilis with nematode-killing function according to any one of claims 1 to 5 or the nematode-killing microbial agent according to claim 8 in the control of plant parasitic nematodes.

Images