High-efficiency reverse cross single-stage rabies virus tracer and construction method and application thereof

Abstract

This invention provides a highly efficient reverse transsynaptic tracing method for rabies virus, its construction method, and its applications. The recombinant rabies virus is a G protein-deficient rabies virus expressing a nuclear localization fluorescent protein. This recombinant rabies virus can improve the visualization efficiency of labeled reverse transsynaptic tools, and has significant practical value and wide application potential for conducting basic and applied research on rabies virus.

Description

Technical Field

[0001] This invention relates to the field of biology, and in particular to a highly efficient reverse cross-level tracing rabies virus, its construction method, and its applications. Background Technology

[0002] The human brain is one of the most complex systems in nature, and neural networks are the foundation for its functions. Normal neural connections enable normal physiological activities such as cognition, learning, memory, and fear; abnormalities in neural networks often lead to neurological diseases such as Alzheimer's, Parkinson's, and depression, but effective treatments for these diseases are still lacking. Currently, the mechanisms of normal physiological activities and disease are unclear, primarily due to a lack of information about brain neural network connections. Therefore, conducting research on brain neural circuits and mapping high-precision brain functional connectivity is crucial for understanding human physiological activities and disease mechanisms. The Brain Science Research Project is another challenging and ambitious project following the Human Genome Project, and its research results will benefit humanity just as much as those of the Human Genome Project. High-performance neural circuit tracing tools are essential for the successful implementation of this project.

[0003] Rabies virus belongs to the genus Lyssavirus of the family Rhabdoviridae. It can infect nerve cells and is transported in neural networks. Its genome is a negative-sense RNA, approximately 12 kb in length, encoding five proteins: N, P, M, G, and L. The G protein acts as an outer membrane protein, packaging the virus into complete viral particles, but it does not affect viral replication. In 2007, Ian R. Wickersham used the SAD-B19 rabies virus strain, deleting the G gene and inserting the EGFP gene into the G gene position to construct a visualized recombinant rabies virus, which was then used for in vivo neuronal labeling in mouse brains. However, it exhibited significant cytotoxicity. Therefore, in 2016, Thomas M. Jessell took a different approach, choosing another rabies virus strain, CVS-N2c, and using a similar strategy to Ian R. Wickersham to establish a reverse cross-synaptic tracer tool. Its toxicity was significantly reduced compared to the SAD-B19 strain, and its cross-synaptic efficiency was significantly improved. However, there is a significant problem: the system has a low efficiency in expressing exogenous proteins, and the fluorescence intensity is very weak when visually observed, which is not conducive to experiments and data analysis.

[0004] Therefore, it is of great significance to establish an efficient tool for reverse cross-level tracing of rabies virus in the upstream loop. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention proposes an efficient reverse cross-level tracing rabies virus, its construction method, and its application.

[0006] This invention provides a recombinant rabies virus with reverse cross-level tracing, wherein the recombinant rabies virus is a G protein-deficient rabies virus expressing a nuclear localization fluorescent protein.

[0007] Conventional knowledge in the field holds that fluorescent proteins should be localized in the cytoplasm to fully visualize neuronal morphology. This invention, through experiments, has shown that nuclear-localized fluorescent proteins do not affect rabies virus replication, packaging, or transsynaptic transmission. Furthermore, due to their brighter signal and easier recognition, more upstream input neurons can be detected under the same experimental conditions, significantly improving the effective labeling efficiency of reverse transsynaptic tracing.

[0008] In some embodiments, the nucleotide sequence of the nuclear localization fluorescent protein gene is shown in SEQ ID NO.1.

[0009] The present invention also provides a method for preparing the recombinant rabies virus, comprising the following steps: S1: The nuclear-localized fluorescent protein gene was amplified in vitro and introduced into a vector plasmid to obtain a recombinant plasmid; S2: The recombinant plasmid described in S1, along with helper plasmids pN, pP, pG, and pL, is co-transfected into B7GG cells, which are then infected with EnvA cells. The supernatant is collected and purified to obtain the recombinant rabies virus.

[0010] In some embodiments, step S1 specifically involves: double digesting the G protein-deficient rabies virus vector plasmid with enzymes, and inserting the nlsEGFP sequence shown in SEQ ID NO.1 into the vector through homologous recombination to obtain a recombinant plasmid.

[0011] In some embodiments, the G protein-deficient rabies virus vector plasmid is a rabies virus vector derived from the CVS-N2c strain.

[0012] The present invention also provides a neural circuit tracing system, including the aforementioned recombinant rabies virus.

[0013] The present invention also provides the application of the recombinant rabies virus in the preparation of mammalian brain neural circuit tracing tools.

[0014] The present invention also provides the application of the recombinant rabies virus in the development of rabies virus vaccines.

[0015] The present invention also provides the application of the recombinant rabies virus in the establishment of animal models of rabies virus infection.

[0016] The present invention also provides the application of the recombinant rabies virus in establishing a drug screening platform for rabies virus.

[0017] In summary, compared with the prior art, the present invention achieves the following technical effects: (1) Existing neural circuit tracing methods for rabies virus typically express cytoplasmic diffuse fluorescent proteins, with fluorescence distributed throughout the cell body and processes. The signal is scattered and the brightness per unit volume is low, making it difficult to achieve clear imaging under weak expression or low titer conditions. This invention optimizes the visualization probe and, based on the application scenario and actual application requirements, adopts a nuclear localization expression of fluorescent protein method to improve the visualization efficiency of rabies expression inverse tracing of the upstream circuit. It can serve as a neural circuit labeling tool, facilitating related research.

[0018] (2) Based on nlsEGFP, this invention has prepared a highly efficient rabies virus reverse cross-level tracing tool for tracing the upstream loop, which facilitates related research.

[0019] (3) This invention has important practical significance and wide application value for carrying out basic research on rabies virus (such as pathogenic mechanism, replication mechanism, etc.) and applied research (such as neural circuit labeling, cell gene therapy, oncolytic virus, novel vaccine and diagnostic reagent, etc.). Attached Figure Description

[0020] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 This diagram illustrates the construction of a rabies virus clone expressing nuclear-localized green fluorescent protein according to the present invention. In the diagram, A represents the backbone plasmid RabV CVS-N2c(deltaG)-tdTomato, B represents the control virus plasmid CVS-N2c(ΔG)-EGFP, C represents the target plasmid of the present invention CVS-N2c(ΔG)-nlsEGFP, N, P, M, and L represent the four proteins encoded by the rabies virus, EGFP represents the green fluorescent protein gene, and nls is the nuclear localization signal sequence.

[0022] Figure 2 This is a visualization of the improved effect of rabies virus expressing nuclear-localized green fluorescent protein on infected cells in Example 2 of the present invention. In this figure, A shows the fluorescence brightness of cells after infection with existing rabies virus, and B shows the fluorescence brightness of cells after infection with the recombinant rabies virus constructed in this invention.

[0023] Figure 3This is a diagram illustrating the effect of rabies virus expressing nuclear-localized green fluorescent protein in reverse transsynaptic cross-linking of the present invention, which clearly visualizes upstream nerve cells. In this diagram, A represents the transsynaptic effect of the recombinant rabies virus constructed in this invention, B represents the transsynaptic effect of existing rabies viruses, and C represents a comparison of the transsynaptic efficiency of the recombinant rabies virus constructed in this invention and existing rabies viruses. Detailed Implementation

[0024] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0025] Unless otherwise specified, the instruments and materials used in the following embodiments are all commonly used laboratory equipment, and the technical solutions described are all conventional technologies in the field.

[0026] Example 1: Preparation of rabies virus expressing nuclear-localized green fluorescent protein I. Building a clone The RabV CVS-N2c(deltaG)-tdTomato (Plasmid #73462) vector was digested with XmaI and NheI enzymes. The sequences shown in SEQ ID NO.1 (nlsEGFP) and SEQ ID NO.4 (EGFP) were inserted into the vector by homologous recombination, respectively, to obtain clones named CVS-N2c(ΔG)-nlsEGFP and CVS-N2c(ΔG)-EGFP. Primers for amplifying the corresponding sequences: Primers for amplifying SEQ ID NO.1 are SEQ ID NO.2 and SEQ ID NO.3, and the template is SEQ ID NO.1. Primers for amplifying SEQ ID NO.4 are SEQ ID NO.5 and SEQ ID NO.3, and the template is SEQ ID NO.1.

[0027] All primers used in the PCR of this invention were synthesized by BGI Genomics Co., Ltd., and all constructed clones were sequenced and verified by BGI Genomics Co., Ltd.

[0028] II. Construction of Recombinant Rabies Virus (1) Preparation of recombinant rabies virus packaged with G One day in advance, B7GG cells (Osakada F and Callaway EM. Nature Protocols. 2013.) were digested with trypsin (purchased from Thermo Fisher Scientific) and then cultured in 15cm culture dishes until approximately 80% confluence at transfection. The five plasmids required for packaging rabies virus—core plasmid A (CVS-N2c(ΔG)-nlsEGFP and CVS-N2c(ΔG)-EGFP, with CVS-N2c(ΔG)-EGFP serving as a control), pN plasmid B, pOP plasmid C, pG plasmid D, and pL plasmid E (pN, pP, pG, and pL derived from "Osakada F and Callaway EM. Nature Protocols. 2013")—were transfected into B7GG cells using the transfection reagent lipo2000 (purchased from Thermo Fisher Scientific). The supernatant from the culture medium was collected after transfection to obtain recombinant rabies virus packaged with G protein.

[0029] Next, the viral titer was determined. 15 μL of the collected supernatant was added to a 1.5 mL centrifuge tube, and 135 μL of culture medium was added to a final volume of 150 μL. Subsequent serial dilutions were performed using a 10-fold serial dilution method. 100 μL of both the original solution and the diluted virus were then used to infect 293T cells (purchased from ATCC). Since the recombinant rabies virus can express green fluorescent protein, the viral titer was calculated by recording the number of cells expressing green fluorescent protein observed under a microscope.

[0030] (2) Preparation of recombinant rabies virus packaged with EnvA One day in advance, EnvA cells (Osakada F and Callaway EM. Nature Protocols. 2013.) were digested with trypsin and then plated into 15 cm culture dishes for adherent culture. At the time of infection, the cell confluence was about 90%. The recombinant rabies virus packaged with G prepared in step (1) above was used to infect the EnvA-expressing cells. After infection, the culture supernatant was collected to obtain the recombinant rabies virus packaged with EnvA.

[0031] Next, the viral titer was determined by adding 15 μL of the collected supernatant to a 1.5 mL centrifuge tube, followed by adding 135 μL of culture medium to a final volume of 150 μL. Subsequent serial dilutions were performed using a 10-fold serial dilution method. 100 μL of both the original solution and the diluted virus were then used to infect TVA800 cells (Osakada F and Callaway EM. Nature Protocols. 2013.). Since the recombinant rabies virus expresses green fluorescent protein, the viral titer was calculated by recording the number of cells expressing nuclear-localized green fluorescent protein observed under a microscope.

[0032] Example 2: Toxicity test of low-toxicity, high-efficiency rabies virus expressing green fluorescent protein 0.15 μL of the recombinant rabies virus (CVS-N2c(ΔG)-nlsEGFP and CVS-N2c(ΔG)-EGFP) packaged with G and expressing nuclear-localized green fluorescent protein (CVF) from Example 1 of this invention was injected into the ventral hippocampus of mice (purchased from Guangdong Vital River Laboratory Animal Technology Co., Ltd.). Twenty-one days later, the animals were anesthetized and perfused with 0.9% (v / v) physiological saline, then fixed with 4% (v / v) paraformaldehyde. Brain tissue was removed and immersed in 4% (v / v) paraformaldehyde solution, then placed in 20% (v / v) sucrose solution for 1 day, followed by 30% (v / v) sucrose solution for 2 days. The bottom of the brain tissue was cut flat, embedded in a base, frozen for 1 hour, and then sectioned. Brain slices were observed using a fluorescence microscope. The observation results are as follows: Figure 2 As shown, after the non-nuclear-localized recombinant rabies virus and the nuclear-localized recombinant rabies virus prepared in this invention were injected into the mouse brain, diffuse and nuclear-localized green fluorescent protein signals were observed. Figure 2 Injection sites A and 2B showed that the recombinant virus could mediate the expression of exogenous proteins in mouse brain nerve cells and had the ability to label brain neural circuits. Figure 2 The low number of fluorescence in A indicates that CVS-N2c(ΔG)-EGFP rabies virus has low efficiency in expressing exogenous proteins. Figure 2 The number of fluorescent markers in marker B was significantly higher, with clearer boundaries, lower background, and a significantly increased number of positively labeled cells, resulting in a substantial improvement in visualization. This indicates that the present invention significantly improves the labeling efficiency and imaging clarity of rabies virus in neurons without increasing viral toxicity or altering host cell safety.

[0033] Example 3: Transsynaptic assay of rabies virus expressing nuclear-localized green fluorescent protein 0.1 μL of recombinant adeno-associated virus expressing G and TVA (purchased from Wuhan Shumi Brain Science Technology Co., Ltd.) was injected into the ventral hippocampus of mice. 21 days post-infection, 0.15 μL of recombinant rabies virus expressing green fluorescent protein (CVS-N2c(ΔG)-nlsEGFP and CVS-N2c(ΔG)-EGFP) packaged with EnvA (as described in Example 2 of this invention) was injected into the region already injected with recombinant adeno-associated virus. 14 days later, the animals were anesthetized and perfused with 0.9% (V / V) physiological saline, then fixed with 4% (V / V) paraformaldehyde. The brain tissue was removed and immersed in 4% (V / V) paraformaldehyde solution, then placed in 20% (V / V) sucrose solution for 1 day, and then in 30% (V / V) sucrose solution for 2 days. The bottom of the brain tissue was cut flat, embedded in a base, frozen for 1 hour, and then sectioned. The brain slices were observed using a fluorescence microscope.

[0034] The results are as follows Figure 3 As shown, green fluorescent signals were detected in the transsynaptic regions of the mouse brain after injection of both groups of recombinant rabies virus. Figure 3 In the transsynaptic regions A and 3B, the recombinant virus was able to mediate the expression of exogenous proteins in mouse brain neurons and facilitate the transsynaptic transmission of rabies virus, indicating that the recombinant virus can successfully mediate the expression of exogenous genes and achieve reverse transsynaptic transmission of rabies virus. Figure 3 The transsynaptic region of A exhibits bright, concentrated, and well-defined green fluorescence with a high signal-to-noise ratio; Figure 3 The fluorescence signal in the B transsynaptic region is weak and diffuse, showing less green fluorescence signal. Figure 3 C represents the statistical results of the transsynaptic efficiency index. It can be seen that the transsynaptic labeling efficiency of the recombinant rabies virus of the present invention is significantly higher than that of the existing CVS-N2c (ΔG)-EGFP rabies virus.

[0035] The results of this embodiment show that the rabies virus tracing tool expressing nuclear-localized green fluorescent protein prepared in this invention can be transported more efficiently in neural networks and has the ability to label brain neural circuits.

[0036] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0037] sequence list SEQ ID No.1 (nlsEGFP) ATGCCTCCAAAGAAGAAGAGAAAGGTGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAG SEQ ID No.2 CATCCCTCAAAAGACCCCGGGAAAGCCACCATGCCTCCAAAGAAGAAGAGAAAGGTGATGGTGAGCAAGGGCGAGGA SEQ ID No.3 GACCGGCTAGGCGCCGCTAGCCTACTTGTACAGCTCGTCCAT SEQ ID No.4 ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAG SEQ ID No.5 CATCCCTCAAAAGACCCCGGGAAAGCCACCATGGTGAGCAAGGGCGAGGA。

Claims

1. A recombinant rabies virus with reverse cross-level tracing, characterized in that, The recombinant rabies virus is a G protein-deficient rabies virus expressing a nuclear localization fluorescent protein.

2. The recombinant rabies virus according to claim 1, characterized in that, The nucleotide sequence of the nuclear-localized fluorescent protein gene is shown in SEQ ID NO.

1.

3. The method for preparing recombinant rabies virus according to claim 1 or 2, characterized in that, Includes the following steps: S1: The nuclear-localized fluorescent protein gene was amplified in vitro and introduced into a vector plasmid to obtain a recombinant plasmid; S2: The recombinant plasmid described in S1, along with helper plasmids pN, pP, pG, and pL, is co-transfected into B7GG cells, which are then infected with EnvA cells. The supernatant is collected and purified to obtain the recombinant rabies virus.

4. The preparation method according to claim 3, characterized in that, Step S1 specifically involves: double digestion of the G protein-deficient rabies virus vector plasmid, and insertion of the nlsEGFP sequence shown in SEQ ID NO.1 into the vector via homologous recombination to obtain the recombinant plasmid.

5. The preparation method according to claim 3, characterized in that, The G protein-deficient rabies virus vector plasmid is a rabies virus vector derived from the CVS-N2c strain.

6. A neural circuit tracing system, characterized in that, Includes the recombinant rabies virus as described in claim 1 or 2.

7. The use of the recombinant rabies virus according to claim 1 or 2 in the preparation of a mammalian brain neural circuit tracing tool.

8. The use of the recombinant rabies virus as described in claim 1 or 2 in the development of rabies virus vaccines.

9. The application of the recombinant rabies virus according to claim 1 or 2 in the establishment of animal models of rabies virus infection.

10. The application of the recombinant rabies virus according to claim 1 or 2 in establishing a drug screening platform for rabies virus.

Images