A base editing system for repairing artemis gene c.181t>c mutation and application thereof
By precisely repairing the c.181T>C mutation in the Artemis gene using a cytosine base editing system, the low repair efficiency and transplantation risks of existing technologies have been overcome, achieving a highly efficient restoration of immune function.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SUN YAT SEN UNIV
- Filing Date
- 2026-04-13
- Publication Date
- 2026-08-04
AI Technical Summary
Existing technologies are unable to efficiently and with low off-target repair of the Artemis gene c.181T>C mutation, which leads to immune dysfunction in patients with severe combined immunodeficiency syndrome, and hematopoietic stem cell transplantation carries the risk of immune rejection and complications.
Using a cytosine base editor, including cytidine deaminase, Cas9 nickase or its functional active variants, and uracil glycosylase inhibitor UGI, combined with sgRNA targeting the c.181T>C mutation site in the Artemis gene, precise editing and repair are achieved.
It achieved 50% editing efficiency at the cellular level, restored the function of the Artemis protein, and provided a new approach to treat severe combined immunodeficiency syndrome, avoiding the problem of immune rejection.
Smart Images

Figure CN122503379A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of gene editors and biomedical technology, and in particular to a base editing system for repairing the c.181T>C mutation in the Artemis gene and its application. Background Technology
[0002] Severe combined immunodeficiency (SCID) is a group of diseases characterized by immune system dysfunction, typically manifested by a lack of T cells and functional B cells. T cells and B cells are crucial components of the adaptive immune system, recognizing a wide range of pathogens by expressing antigen receptor molecules and assisting the host in establishing a strong immune defense. Infants with SCID are highly susceptible to infections due to their lack of T and B cells, and without timely treatment, they often die within the first year of life. The development of SCID is highly diverse; it is estimated that mutations in approximately 20 genes can trigger the condition. This includes important molecules involved in the antibody rearrangement process, such as RAG (Recombination-activating gene), DNA-PKcs (DNA-dependent protein kinase catalytic subunit), DCLRE1C (DNA cross-link repair 1C, also known as Artemis), Lig4 (DNA Ligase 4), and NHEJ1 (Non-homologous endjoining factor 1), as well as other molecules such as ADA (Adenosine deaminase), CD3D, CD3E, and CD247.
[0003] Hematopoietic stem cell transplantation (HCT) is an effective clinical treatment for severe combined immunodeficiency syndrome (SCI). As early as the 1960s, there were cases of treating SCI by remodeling the immune system through hematopoietic stem cell transplantation. With the development of molecular biology techniques, gene therapy has also been incorporated into the clinical treatment protocols for patients with SCI. In the 1990s, gene therapy was used to introduce viral vectors into patients' CD34 cells. +Integrating a normal ADA gene into cells enables the normal development of T cells, B cells, and NK cells in patients, effectively treating severe combined immunodeficiency syndrome (SIFMS) caused by ADA mutations. To date, there have been over 150 cases of treating SIFMS caused by ADA mutations using gene integration technology, and patients with SIFMS caused by other gene mutations can also use gene integration technology for clinical treatment.
[0004] Severe combined immunodeficiency syndrome caused by mutations in the Artemis gene is called ART-SCID (Artemis-deficient SCID). Artemis is the only endonuclease in mammals that can open the hairpin intermediate produced during antibody rearrangement. A deficiency in the Artemis gene prevents the opening of the hairpin intermediate produced during antibody rearrangement, preventing the linkage between V, D, and J gene segments, leading to the non-expression of antigen receptor genes and the arrest of B cell and T cell development. Furthermore, Artemis is involved in DNA double-strand break repair; therefore, ART-SCID patients also exhibit radiation sensitivity, hence the name radiosensitive severe combined immunodeficiency (RS-SCID). Mutations affecting Artemis enzyme activity can lead to severe combined immunodeficiency syndrome (SCI). For example, single point mutations at sites such as Ala28, Ser32, His35, Asp37, Gly118, Asp165, Pro171, Glu213, His228, and Glu324 can all cause SCI in the host. Although hematopoietic stem cell transplantation is an effective clinical treatment for SCI, ART-SCID patients are sensitive to the alkylating agents used in the transplantation process. Furthermore, long-term observations have shown that ART-SCID patients treated with hematopoietic stem cell transplantation are more prone to infections, dental deformities, and endocrine disorders. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a base editing system that can precisely, efficiently, and with low off-target effects repair Artemis c.181T>C mutations at the cellular level, restore protein function, and provide a new treatment option for treating severe combined immunodeficiency syndrome caused by Artemis mutations.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a base editing system for repairing the c.181T>C mutation in the Artemis gene, the base editing system comprising: (1) Cytosine base editor; the cytosine base editor includes cytidine deaminase, Cas9 nickase or its functional active variant, and uracil glycosylation inhibitor UGI; (2) sgRNA targeting the c.181T>C mutation site in the Artemis gene; The sgRNA can guide the cytosine base editor to target and repair the c.181C mutation in the Artemis gene to T.
[0007] To uncover novel pathogenic mutation sites in the Artemis gene, this invention initially analyzed evolutionarily conserved amino acids and identified Artemis mutation sites indexed in the ClinVar database. Through intracellular activity and in vitro experiments, it was discovered that the C61R mutation (c.181 T>C) completely inhibits Artemis activity. Mutations at this site in Artemis inhibit antibody V(D)J rearrangement, leading to severe combined immunodeficiency syndrome. Furthermore, this invention designed a specific base editing system to edit and repair the Artemis c.181 T>C mutation site in cell lines, achieving a target site editing efficiency of 50% with no significant off-target activity.
[0008] Preferably, the cytidine deaminase includes either rAPOBEC1 or evoFERNY.
[0009] Preferably, the Cas9 nicking enzyme or its functionally active variant includes nCas9 (D10A) or SpRY-HF1.
[0010] Preferably, the C-end of the nCas9(D10A) is fused with at least one UGI.
[0011] Preferably, the cytosine base editor further includes at least one linker peptide.
[0012] Preferably, the linker peptide comprises 2-32 amino acids.
[0013] Preferably, the structure of the cytosine base editor is: cytidine deaminase-promoter peptide-Cas9 nickase or its functionally active variant-promoter peptide-UGI-promoter peptide-UGI-nuclear localization signal NLS.
[0014] Preferably, the nucleotide sequence of the sgRNA is selected from any one of SEQ ID NO.1-SEQ ID NO.5.
[0015] More preferably, the base editing system includes: (1) Cytosine base editor; the cytosine base editor includes rAPOBEC1, SpRY-HF1, and uracil glycosylation inhibitor UGI; (2) sgRNA with the sequence SEQ ID NO.4 or SEQ ID NO.5.
[0016] This invention has found that the combination of rA1-SpRY-HF1 with sgRNA4 and sgRNA5 has a better effect, which can make the editing efficiency of Artemis gene reach 50%.
[0017] Secondly, the present invention provides the application of the above-described base editing system in the preparation of gene editing reagents or kits for repairing the c.181T>C mutation in the Artemis gene.
[0018] Thirdly, the present invention provides the application of the above-described base editing system in the preparation of a medicament for treating diseases caused by the Artemis gene c.181T>C mutation.
[0019] Preferably, the disease includes severe combined immunodeficiency syndrome.
[0020] More preferably, the disease is Artemis-deficient severe combined immunodeficiency syndrome.
[0021] Fourthly, the present invention provides a kit for repairing the c.181T>C mutation in the Artemis gene, comprising the aforementioned base editing system.
[0022] The beneficial effects of this invention are as follows: This invention is the first to discover that the c.181T>C mutation in Artemis completely destroys its activity. By using a cytidine deaminase base editor to repair this site, the activity of the mutated Artemis gene is significantly enhanced, with an editing efficiency of up to 50%. This invention provides a new treatment option for severe combined immunodeficiency syndrome caused by Artemis mutations. Compared to hematopoietic stem cell transplantation, gene editing therapy repairs gene mutations only in situ, can be performed using the patient's own hematopoietic stem cells, and does not involve immune rejection. Attached Figure Description
[0023] Figure 1 This is a schematic diagram of the technical principle of the present invention.
[0024] Figure 2 for Artemis C61R The sgRNA sequence used in gene editing.
[0025] Figure 3Figure A shows the wb test results of the Artemis C61R mutant gene stable cell line, and Figure B shows the schematic diagram of the construction of rAPOBEC1-BE4max and evoFERNY-BE4max base editing plasmids.
[0026] Figure 4 Figure A shows the results of gene editing efficiency and off-target effects detection for rA1-BE4max and evoFERNY-BE4max (the horizontal axis C indicates the cytosine ribonucleotide at the corresponding position), and Figure B shows the results of off-target effects detection for rA1-BE4max and evoFERNY-BE4max (the horizontal axis OT represents off target, i.e., the predicted off-target site).
[0027] Figure 5 Figure A shows the results of detecting the activity of the Artemis gene in edited cells; Figure B shows the principle of the GFP gene reporter system for detecting Artemis activity, and the results of detecting the restoration of Artemis activity in cells by rA1-BE4max and evoFERNY-BE4max.
[0028] Figure 6 Figure A shows the editing efficiency test results of rA1-SpRY-HF1-BE4max; Figure B shows the design diagram of sgRNA2-sgRNA5; and Figure C shows the editing efficiency test results of sgRNA combined with rA1-SpRY-HF1.
[0029] Figure 7 The results of the detection of the restoration of Artemis activity in cells by rA1-SpRY-HF1 combined with sgRNA4. Detailed Implementation
[0030] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.
[0031] Unless otherwise specified, the experimental methods used in this invention are conventional methods, and the materials and reagents used are commercially available products.
[0032] Sequence information of the sgRNA designed in this invention: sgRNA1 (SEQ ID NO.1): ATACCGTTCACCTGTGACTA; sgRNA2 (SEQ ID NO.2): ACCGTTCACCTGTGACTAAG; sgRNA3 (SEQ ID NO.3): TACCGTTCACCTGTGACTAA; sgRNA4 (SEQ ID NO.4): TATACCGTTCACCTGTGACT; sgRNA5 (SEQ ID NO. 5): CTATACCGTTCACCTGTGAC.
[0033] Example 1: This embodiment is designed to use the CBE base editing tool to repair the c.181T>C mutation in Artemis cells.
[0034] principle( Figure 1 ): Mutation using a point mutation kit Artemis Mutant genes ( Artemis c. 181 T>C The corresponding protein sequence mutation is C61R, which was stably transfected into the endogenous protein using lentivirus. Artemis Gene knockout 293T cells (293T Artemis- / - Single clones were sorted and amplified using flow cytometry to select single clones stably transfected with the Artemis c.181 T>C mutant gene (293T). C61R Cells were edited using a cytosine base editor, and harvested 3 days later. The genome was extracted from one group of cells, the edited sequence was cloned, and high-throughput sequencing was performed to assess the editing efficiency. The other group of cells was used to detect the intracellular activity of Artemis cells after editing. The repair efficiency of the cytosine base editor on the Artemis c.181 T>C site was verified using both sequencing and activity assays.
[0035] Specific methods: 1) Design sgRNA sequences In the early stages of this invention, two methods were used to jointly screen for the pathogenic mutation site C61R (c.181T>C) in Artemis. The C61 site is located in the third exon of Artemis. Based on the specific location of the c.181T>C mutation, an sgRNA sequence was selected. This sgRNA is near a classic PAM sequence, AGG, which is suitable for Cas9 targeting. Furthermore, the target editing site is at position 5 of the sgRNA, which is also the position with the highest CBE editing efficiency. Therefore, this invention designed sgRNA1, synthesized the corresponding DNA sequence, and constructed it into the pUC19 vector to obtain the sgRNA transcription plasmid (…). Figure 2 ).
[0036] 2) Constructing cell editing and base editing systems Endogenous cells in 293T cells were knocked out using CRISPR / Cas9 technology. ArtemisThe gene was knocked out using sequencing and Western blot verification, yielding 293T. Artemis- / - Cells. Cloning from 293T cells Artemis The gene was mutated at the c.181T>C site using the QuikChange Lightning point mutation kit (catalog number: 210513) from Agilent Technologies. The mutated gene was then cloned into a lentiviral packaging plasmid, transfected into 293T cells, and the viral supernatant was collected the next day and the virus was concentrated. This virus was then used to infect 293T cells. Artemis- / - Cells. After viral infection, single clones were sorted, cultured, and then stable transfection was detected by Western blot. Artemis Cloning of mutant genes ( Figure 3 A).
[0037] Furthermore, this invention constructs rat APOBEC1 protein (rAPOBEC1, abbreviated as rA1) and evoFERNY editing enzyme into the BE4max plasmid system to obtain base editing plasmids ( Figure 3 B).
[0038] Construction of rAPOBEC1-BE4max and evoFERNY-BE4max base editing plasmids: Among them, rAPOBEC1 (rA1) is a synthetic gene, the sequence of which is obtained from NCBI, index number: L07114.1; evoFERNY is a synthetic gene, the sequence of which is obtained from NCBI, OM324335.1; the two genes were constructed into the pCMV_BE4max (abbreviated as BE4max, purchased from addgene: #112093) plasmid. Figure 3 B) The base editing plasmids rAPOBEC1-BE4max (rA1-BE4max) and evoFERNY-BE4max were obtained respectively.
[0039] 3) Detection of gene editing efficiency and off-target effects The sgRNA transcription plasmid and the aforementioned base editing plasmid were co-transfected into 293TC61R cells. Cells were harvested 3 days after editing. The genome of the edited cells was extracted using a kit, primers were designed to clone the repaired gene sequence, and high-throughput sequencing was performed.
[0040] Data analysis results show that both rA1-BE4max and evoFERNY-BE4max can achieve an editing efficiency of approximately 35% at the target site. Figure 4 A). By predicting sgRNA-dependent off-target sites online, cloning and high-throughput sequencing of potentially off-target sites revealed that the experimental group did not exhibit significant off-target effects compared to the unedited group. Figure 4 B) indicates the security of this editing method.
[0041] 4) Detect the activity of the Artemis gene in edited cells. Cells were plated 3 days after editing and transfected with a reporter plasmid for detecting Artemis activity. The Artemis activity in the edited cells was then detected using a GFP reporter system to determine whether there was a significant increase compared to the unedited group. Figure 5 A).
[0042] The results showed that intracellular Artemis activity was significantly increased in cells edited with either rA1-BE4max or evoFERNY-BE4max compared to the control group. Figure 5 (B) This indicates that the CBE base editing tool can effectively repair the c.181T>C mutation in Artemis within cells.
[0043] Example 2: The aforementioned editing strategy is limited by the classic NGG PAM sequence in sgRNA design. To further improve editing efficiency, this invention selects the Cas9 variant SpRY-HF1, which has a broader PAM recognition range.
[0044] SpRY-HF1 preferentially recognizes NRN (N is any base, R is A or G) type PAMs. Based on this characteristic, this invention constructed the rA1-SpRY-HF1-BE4max edit plasmid: replacing nCas9 in the rA1-BE4max plasmid with the SpRY-HF1 gene yields rA1-SpRY-HF1-BE4max. The SpRY-HF1 gene is cloned from pCMV-T7-SpRY-HF1-P2A-EGFP (addgene: RTW5008), and four sgRNAs (sgRNA2-sgRNA5) were designed for functional testing. Figure 6 AB).
[0045] Under the same conditions as the previous editing experiments, high-throughput sequencing results showed that the editing efficiency of sgRNA4 and sgRNA5 was significantly higher than that of sgRNA1, reaching up to 50%. Figure 6 C).
[0046] Similarly, the functional activity of intracellular Artemis cells after editing with sgRNA4 and sgRNA5 was detected using a GFP reporter system. The results showed that its activity recovered to approximately 50% of that of wild-type Artemis, consistent with the editing efficiency obtained from high-throughput sequencing. Figure 7 ).
[0047] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A base editing system for repairing the c.181T>C mutation in the Artemis gene, characterized in that, The base editing system includes: (1) Cytosine base editor; the cytosine base editor includes cytidine deaminase, Cas9 nickase or its functional active variant, and uracil glycosylation inhibitor UGI; (2) sgRNA targeting the c.181T>C mutation site in the Artemis gene; The sgRNA can guide the cytosine base editor to target and repair the c.181C mutation in the Artemis gene to T.
2. The base editing system as described in claim 1, characterized in that, The cytidine deaminase includes either rAPOBEC1 or evoFERNY.
3. The base editing system as described in claim 1, characterized in that, The Cas9 nickase or its functionally active variants include nCas9 (D10A) or SpRY-HF1.
4. The base editing system as described in claim 1, characterized in that, The cytosine base editor also includes at least one linker peptide.
5. The base editing system as described in claim 1, characterized in that, The nucleotide sequence of the sgRNA is selected from any one of SEQ ID NO.1-SEQ ID NO.
5.
6. The base editing system as described in claim 1, characterized in that, The base editing system includes: (1) Cytosine base editor; the cytosine base editor includes rAPOBEC1, SpRY-HF1, and uracil glycosylation inhibitor UGI; (2) sgRNA with the sequence SEQ ID NO.4 or SEQ ID NO.
5.
7. The use of the base editing system according to any one of claims 1-6 in the preparation of gene editing reagents or kits for repairing the c.181T>C mutation in the Artemis gene.
8. The use of the base editing system according to any one of claims 1-6 in the preparation of a medicament for treating diseases caused by the c.181T>C mutation of the Artemis gene.
9. The application as described in claim 8, characterized in that, The diseases mentioned include severe combined immunodeficiency syndrome.
10. A kit for repairing the c.181T>C mutation in the Artemis gene, characterized in that, The kit includes the base editing system as described in any one of claims 1-6.