A method for rapid detection of haemophilus parasuis

Abstract

This invention provides a rapid detection method for Haemophilus parasuis, specifically a PCR-CRISPR / Cas13a-based detection method established based on a set of highly efficient and specific PCR primers and probes for detecting Haemophilus parasuis. The PCR primers have the sequence of the upstream primer as SEQ ID NO:2 and the sequence of the downstream primer as SEQ ID NO:3. This invention combines PCR and CRISPR / Cas13a technologies to ultimately provide a PCR amplification primer pair for Haemophilus parasuis detection and a specific crRNA targeting this sequence. This crRNA can activate Cas13a to achieve highly sensitive, highly specific, and low-complexity visual detection of Haemophilus parasuis, providing an effective detection method.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology gene detection technology, specifically relating to a method for rapid detection of Haemophilus parasuis. Background Technology

[0002] Glasser's disease is caused by Haemophilus parasuis (Glässerˊs disease). Haemophilus parasuis Haemophilus influenzae (HPS) is an acute, contagious bacterial infectious disease characterized by polyserositis, arthritis, and meningitis. It is listed as a notifiable animal disease by the World Organisation for Animal Health (WOAH) and is classified as a Class III animal disease in my country's "List of Class I, II, and III Animal Diseases." It is also a key pathogen of concern for import quarantine in my country. This bacterium belongs to the Pasteuraceae family, Haemophilus genus, and is a Gram-negative bacterium. It is non-spore-forming and non-flagellated, with a circular double-stranded DNA genome. It exhibits high host specificity and can be transmitted through direct contact, respiratory droplets, and other routes, causing widespread disease outbreaks in pig herds within a short period, leading to decreased animal productivity, mortality, and other serious consequences, resulting in significant economic losses to the pig farming industry.

[0003] There are numerous serotypes of Haemophilus parasuis, with 15 serotypes (1-15) identified to date. Approximately 20% of isolates remain untyped, and cross-protection between serotypes is weak. Serotypes 5, 4, and 13 (HPS serotypes 5 / 4 / 13) are particularly prevalent in my country. Currently, inactivated vaccines are the primary means of prevention in China, but existing vaccines lack cross-protection against different serotypes and suffer from insufficient safety and poor duration of immunity. Furthermore, cross-protection between different serotypes is poor, drug resistance in isolates is increasing annually, and effective control technologies and products are lacking.

[0004] Currently, although commercially available detection kits for Haemophilus parasuis are available in China, existing detection technologies still have shortcomings. Commonly used laboratory detection methods include bacterial isolation and identification, serological detection, and molecular biological detection. Among these, bacterial isolation and identification has high specificity, but it is complex to operate, time-consuming, requires many instruments, and HPS culture is strictly dependent on NAD, serum, and a 5% CO2 environment, requiring 24-36 hours. It is also prone to contamination by other microorganisms, failing to meet the needs of rapid detection. Serological detection methods are simple and rapid to operate, but their specificity and sensitivity are not high. Molecular biological methods such as PCR and qPCR are sensitive, rapid, specific, and stable, but they also require good laboratory conditions, expensive specialized instruments, and take 4-6 hours to complete. Therefore, establishing a convenient, accurate, and field-appropriate detection technology for Haemophilus parasuis can more effectively achieve early detection, early diagnosis, and early prevention and control of this disease, providing important technical support for ensuring the healthy development of my country's pig industry.

[0005] The CRISPR / Cas13 system is a powerful RNA editing tool. The Cas13 protein, guided by crRNA, specifically recognizes and cleaves target RNA sequences. Combining PCR with CRISPR / Cas13 offers numerous advantages. In detection, the rapid amplification capability of PCR provides sufficient target RNA for CRISPR / Cas13, improving detection sensitivity and enabling the detection of trace amounts of nucleic acid, potentially for early disease diagnosis. Simultaneously, the specific cleavage capability of CRISPR / Cas13 further enhances detection accuracy and reduces false positive rates. However, this combined technology also faces some challenges, such as primer design optimization during PCR amplification and potential off-target effects of CRISPR / Cas13. Summary of the Invention

[0006] The purpose of this invention is to provide a rapid method for detecting HPS nucleic acid that can be used in the front line of epidemic prevention. Specifically, after analyzing the whole genome sequences of 82 different HPS genotypes, a conserved sequence was identified, and multiple pairs of amplification primers were designed. A set of highly efficient and specific HPS PCR primers was obtained through screening, and a highly sensitive and specific HPS PCR-CRISPR / Cas13a diagnostic method was established. The established method has discriminative ability and can accurately detect HPS nucleic acid signals.

[0007] This invention first provides a PCR primer pair for detecting HPS, and the sequences of the primer pair and the nucleic acid fragment to be detected are as follows: TAACAGTTTATGAAAATGAAGGTACAAAAGTTGATTTTGATGGTCAATTGCGTCTTCTTTTAGAAGAACAAGCCACAAAAGAGAAAGGTCAATCTTCAACACGTGGTCACACTAACTTAAAGAATAATAGTTCT (SEQ ID NO: 1).

[0008] As a specific example, the sequence information of the upstream and downstream primer pairs of the PCR primer pair is as follows: Upstream primer HPS F1: 5′-GAACTAATACGACTCACTATAGGGTAACAGYTTATGAAATGAAGGTACAAAAG-3′ (SEQ IDNO: 2) Downstream primer HPS R1: 5′-AGAAYYATYATTCTTTAAGTYAGTGTGACC-3′ (SEQ ID NO: 3).

[0009] The PCR primer pairs screened in this invention are used to prepare PCR-CRISPR / Cas13a detection reagents for detecting HPS; Furthermore, the detection reagent also contains CRISPR-Cas13a protein, crRNA, and a reporter molecule; The sequence of the crRNA is as follows: TGATTTTGATGGTCARTTGCGTCTTCTTGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC (SEQ ID NO: 4).

[0010] When using the fluorescence method, the reporter molecule is a fluorescent reporter molecule with the sequence 5′-UUUUUUUUUUU-3′, and the probe ends are labeled with FAM and BHQ1, respectively; when using the test strip method, the reporter molecule is a biotin reporter molecule with the sequence 5′-UUUUUUUUUUU-3′, and the probe ends are labeled with FAM and biotin, respectively.

[0011] This invention also provides a method for detecting HPS using PCR-CRISPR / Cas13a; When the reporter molecule is a fluorescent reporter molecule, the nucleic acid of the sample to be tested is used as a template, and the above-mentioned PCR primer pair is used to perform a PCR reaction to obtain the amplification product. The fluorescent reporter molecule and the above-mentioned crRNA are used to perform a CRISPR / Cas13a reaction on the amplification product to obtain the reaction product. The presence of HPS nucleic acid in the sample to be tested is determined according to the fluorescence and fluorescence value of the reaction product. That is, the reaction product is observed under a blue light / ultraviolet light (wavelength of 440-460nm / 400nm). If the reaction product produces green fluorescence, the sample to be tested contains HPS nucleic acid. If the reaction product does not produce green fluorescence, the sample to be tested does not contain HPS nucleic acid.

[0012] When the reporter molecule is a biotin reporter molecule, using the nucleic acid of the sample to be tested as a template, a PCR reaction is performed using the above-mentioned PCR primer pair to obtain the amplification product. The amplification product is then subjected to a CRISPR / Cas13a reaction using the biotin reporter molecule and the above-mentioned crRNA to obtain the reaction product. The product after the CRISPR / Cas13a reaction is diluted with dd H2O at a ratio of 1:1. The test strip is inserted into the diluted mixture and the test result is read after 10 minutes. If the control line does not show color and the test line is visible to the naked eye, it indicates that the nucleic acid probe has been almost completely cleaved by the Cas enzyme, and the result is positive, indicating that the sample to be tested contains HPS nucleic acid. If the control line shows color and the test line is visible to the naked eye, it indicates that some of the nucleic acid probe has been cleaved by the Cas enzyme, and the result is positive, indicating that the sample to be tested contains HPS nucleic acid. If the control line shows color but the test line does not show color, it indicates that the nucleic acid probe has not been cleaved by the Cas enzyme, and the result is negative, indicating that the sample to be tested does not contain HPS nucleic acid. If neither the test line nor the control line shows color, the test result is invalid.

[0013] This invention combines PCR technology and CRISPR / Cas13a technology to achieve convenient, rapid, and high-precision detection of HPS, and has good application prospects. Attached Figure Description

[0014] Figure 1 The image shows the PCR primer screening results in Example 1, where: 1: F1R1; 2: F2R2; 3: F3R3; 4: F4R4; 5: F5R5.

[0015] Figure 2 , Figure 3 The image shows the crRNA screening results in Example 1, where 1: crRNA1+; 2: crRNA1-; 3: crRNA2+; 4: crRNA2-; 5: crRNA3+; 6: crRNA3-; 7: crRNA4+; 8: crRNA4-; 9: crRNA5+; 10: crRNA5-.

[0016] Figure 4 , Figure 5 This is a graph showing the sensitivity verification results of the HPS fluorescence method provided in Example 2, where 1: standard and 2: 10. -1 3:10 -2 ;4:10 -3 5:10 -4 6:10 -5 7:10 -6 8:10 -7 9:10 -8 10:10 -9 11:10 -10 12:10 -11 13:10 -12;14:NC.

[0017] Figure 6 The graph shows the sensitivity verification results of the HPS test strip method provided in Example 2, where 1: standard and 2: 10. -1 3:10 -2 ;4:10 -3 5:10 -4 6:10 -5 7:10 -6 8:10 -7 9:10 -8 10:10 -9 11:10 -10 12:10 -11 13:10 -12 ;14:NC.

[0018] Figure 7 , Figure 8 This is a graph showing the validation results of the HPS fluorescence method for detecting specificity provided in Example 3. Figure 7 , Figure 8 1: Pasteurella; 2: Salmonella; 3: Escherichia coli; 4: Staphylococcus aureus; 5: Brucella; 6: HPS; 7: NC.

[0019] Figure 9 This is a graph showing the verification results of the HPS test strip method for detecting specificity provided in Example 3. Figure 9 1: Pasteurella; 2: Salmonella; 3: Escherichia coli; 4: Staphylococcus aureus; 5: Brucella; 6: HPS; 7: NC.

[0020] Figure 10 , Figure 11 The graph shows the verification results of the HPS fluorescence method stability test provided in Example 4. Figure 10 , Figure 11 A, B, and C represent three gradient HPS nucleic acids.

[0021] Figure 12 The graph shows the verification results of the HPS test strip method for stability testing provided in Example 4. Figure 12 A, B, and C represent three gradient HPS nucleic acids. Detailed Implementation

[0022] In practice, the applicant discovered that low PCR amplification efficiency leads to low template amplification and false negatives; conversely, poor crRNA sequence specificity results in non-specific binding of crRNA to non-target templates, triggering non-specific Cas enzyme cleavage and causing false positives. To avoid these drawbacks, this invention first conducts a systematic analysis of the pathogen sequence and designs five pairs of PCR amplification primers. The primer pair with the highest amplification efficiency and specificity is then selected for the PCR reaction, ensuring both amplification efficiency and specificity. Simultaneously, five crRNAs are designed for the amplification sequence, and their specificity in binding to the target is tested individually to avoid false positives and ensure the reliability of the test results.

[0023] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0024] I. Preparation of HPS RNA Standards 1. HPS RNA standards need to be prepared. The highly conserved sequence (SEQ ID NO:1) obtained by screening is used as a template for the positive plasmid synthesized to detect the target gene fragment. In vitro transcription is performed, and the transcription product is purified to prepare HPS RNA standards.

[0025] 2. Perform a 10-fold serial dilution of the HPS RNA standard, and take 1×10⁻⁶ samples. -1 —1×10 -12 A total of 12 consecutive dilutions of RNA standards were used. The diluted 1×10⁻⁶ RNA standards were analyzed using a digital PCR instrument. -1 —1×10 -12 Nucleic acid copy number determination was performed using standards at 12 consecutive dilutions. The reaction program was set as follows: pre-denaturation at 95℃ for 30 s, amplification at 95℃ for 10 s, 60℃ for 30 s, for 45 cycles. The reaction system consisted of: 6 µL of 5 × One Step U+ Mix, 1.5 µL of One Step U+ Enzyme Mix, and 0.6 µL of 50 × ROXReference Dye (HiScript). ® III U+One Step qRT-PCR Probe Kit (Vazyle), 0.6 µL each of upstream and downstream primers, 0.3 µL of fluorescent probe (10 µM) (primer and probe sequences are shown in Table 1), 1 µL of HPS RNA standard, and ddH2O to bring the total to 30 µL.

[0026] 3. Place the calibrated 10-1 —10 -12 The diluted HPS RNA standard was aliquoted and stored at -80°C for later use. The copy number was 256329.4 copies / µL (10). -4 ), 39850.6 copies / µL (10 -5 ), 746.8 copies / µL (10 -6 ), 168.2 copies / µL (10 -7 ), 10 copies / µL (10 -8 ), 3.2 copies / µL (10 -9 ).

[0027] Table 1: Information on primers and fluorescent probe sequences for HPS RNA standard amplification HPS cRNA F TTGATGGTCAATTGCGTCTTCT HPS cRNA R CCACGTGTTGAAGATTGACCTTT HPS cRNA probe TAGAAGAACAAGCCACAAAA II. Design and Screening of PCR Primers Eighty-two whole-genome sequences of different HPS serotypes were extracted from the GenBank database (NCBI, website: http: / / www.ncbi.nlm.nih.gov / ) and sequence alignment was performed using BioEdit software (version 7.2.5). Highly conserved genes were selected as detection targets, and ten primers for conserved gene regions were designed according to PCR design principles. The upstream primer was extended with the T7 promoter sequence to facilitate in vitro transcription (as shown in Table 2).

[0028] Table 2: Primer sequence list for PCR of Haemophilus parasuis III. Selection of Optimal Primer Pairs Using HPS RNA standards as templates, PCR reactions were performed using five primer pairs (F1R1, F2R2, F3R3, F4R4, and F5R5) as shown in Table 1. The reaction system is shown in Table 3. The reaction temperature was 98℃ for 30 s; 98℃ for 10 s, 58℃ for 10 s, and 72℃ for 30 s, for a total of 30 cycles; followed by 72℃ for 5 min. After the reaction, 5 μL of the reaction product was electrophoresed on a 2% agarose gel, and the results were observed on a gel imaging system. Figure 1 The results showed that ( Figure 1 The amplification band of primer F1R1 was brighter, so F1R1 was selected as the best primer pair for detecting HPS.

[0029] Table 3: PCR Reaction System Table IV. Design, transcription, and purification of HPS crRNA 1. Based on the target fragment sequence amplified by PCR and the characteristics of LwaCas13a recognizing crRNA, five crRNAs were designed (sequences are shown in Table 4).

[0030] 2. The oligonucleotide T7 oligo synthesized from the crRNA transcription template was combined with crRNA-R (1-5) respectively. The resulting oligonucleotide chain combinations were dissolved in DEPC water to a concentration of 100 µmol / L. The mixture was then denatured at 95°C for 5 min and slowly cooled to 25°C for at least 45 min to anneal and form double-stranded DNA (the annealing system is shown in Table 5).

[0031] 3. Using the above double-stranded DNA as a template, in vitro transcription (T7 RNA Polymerase, Vazyme) was performed to obtain crRNA1-5 (transcription system is shown in Table 6). The crRNA concentration was measured, aliquoted, and stored at -80℃ for later use.

[0032] Table 4: Information on crRNA and reporter molecule sequences Table 5: Composition of the annealing system Table 6: crRNA in vitro transcription system V. Screening of HPS crRNA Using HPS RNA standards as templates, PCR was performed with HPS F1R1 primers to obtain amplification products. ddH2O was used as a negative control (reaction system shown in Table 3). The CRISPR / Cas13a fluorescence method and test strip method reaction system 1 was incubated at 37℃ for 10 min in a PCR instrument (as shown in Table 7). The amplification products were added to the CRISPR / Cas13a fluorescence method and test strip method reaction system 2 (as shown in Table 8), and reacted in a constant temperature metal bath at 37℃ for 30 min. The reporter molecule used in this case was a fluorescent reporter molecule. After the reaction was complete, the fluorescence intensity was observed and the fluorescence value was detected to select the optimal crRNA. The fluorescence results were observed under blue light, and the fluorescence intensity value was detected and read using a multi-functional microplate reader. The results are shown in Table 3. Figure 2 , Figure 3 The Cas13a protein was purchased from Genscript Biotech Inc. The 5′ and 3′ ends of the fluorescent reporter molecule were modified with a fluorescent group (FAM) and a fluorescence quencher group (BHQ 1), respectively, which were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (sequence shown in Table 4).

[0033] The experimental results showed that crRNA5 had the highest fluorescence intensity, therefore crRNA5 was selected for subsequent experiments. Figure 2 , Figure 3 ).

[0034] Table 7: Established Reaction System Table 8: CRISPR / Cas13a Fluorescence and Test Strip Method Reaction System

[0035] Use the calibrated 10-1 —10 -12 Using diluted HPS RNA standards as templates, the copy numbers were 256329.4 copies / µL (10⁻¹⁰). -4 ), 39850.6 copies / µL (10 -5 ), 746.8 copies / µL (10 -6 ), 168.2 copies / µL (10 -7 ), 10 copies / µL (10 -8 ), 3.2 copies / µL (10 -9 ), 0 copies / µL (10 -10-12 ), and prepare PCR-CRISPR / Cas13a fluorescence method and test strip method detection system.

[0036] When the reporter molecule is a fluorescent reporter molecule, the results are as follows: Figure 4 , Figure 5 The results showed that fluorescence was still present even when the template concentration was as low as 10 copies / µL. The experiment was repeated three times, and the results consistently showed the same pattern. This indicates that the detection limit of the fluorescence method for HPS is 10 copies / µL.

[0037] When the reporter molecule is a biotin reporter molecule, the result is as follows: Figure 6 The results showed that when the template dilution was 10... -1 —10 -8 At a certain time, the test line on the test strip is bright, indicating strong signal amplification; when the template dilution is 10... -9 In the initial test, only the control line showed a red line, and the negative control also only showed a red line. The experiment was repeated three times, and the results consistently showed the same pattern. This indicates that the detection limit of the test strip method for HPS is 10 copies / µL.

[0038] 1. Pasteurella multocida was selected ( Pasteurella multocida ),salmonella( Salmonella Staphylococcus aureus ( Staphylococcus aureus Brucella ( Brucella ), Escherichia coli ( Escherichia coli The specificity of the fluorescence method and the test strip method was verified by comparing the nucleic acids of common swine pathogens such as HPS RNA with the HPS RNA standard. ddH2O was used as a negative control.

[0039] 2. PCR amplification was performed using the optimal primer pair screening method described in Example 1. After amplification, 5 μL of PCR product was taken to prepare CRISPR / Cas13a fluorescence detection system and test strip detection system.

[0040] When the reporter molecule is a fluorescent reporter molecule, the presence of HPS nucleic acid in the test sample is determined based on the fluorescence and fluorescence value of the product after the CRISPR / Cas13a reaction. The results are as follows: Figure 7 , Figure 8 The results showed that only the reaction product of the HPS nucleic acid positive control showed obvious green fluorescence, while the other control virus samples and negative controls did not produce green fluorescence, thus proving that the fluorescence detection method designed in this invention has high specificity.

[0041] When the reporter molecule is a biotin reporter molecule, the presence of HPS nucleic acid in the sample is determined based on the detection result of the test strip inserted into the product after the CRISPR / Cas13a reaction. The result is as follows: Figure 9 The results showed that only the HPS nucleic acid positive control showed a clear red line in the reaction product detection line, while the other control virus samples and negative controls only showed a red line in the quality control line. This proves that the test strip detection method designed in this invention has high specificity.

[0042] From the calibrated 10 -1 —10 -12 Four dilutions of HPS RNA standards were randomly selected as templates to prepare a PCR-CRISPR / Cas13a fluorescence detection system, with ddH2O as a negative control. The experiment was repeated three times.

[0043] When the reporter molecule is a fluorescent reporter molecule, the results are as follows: Figure 10 , Figure 11 The results showed that the reaction products of HPS at all four dilutions exhibited obvious green fluorescence, while the negative control did not produce green fluorescence, thus proving that the fluorescence detection method designed in this invention has high stability.

[0044] When the reporter molecule is a biotin reporter molecule, the result is as follows: Figure 12 The results showed that the detection line for the reaction product with HPS showed a clear red line, while the negative control only showed a red line in the quality control line, thus proving that the test strip detection method designed in this invention has high stability.

[0045] In summary, this invention combines PCR technology with CRISPR / Cas13a technology to achieve highly sensitive, highly specific, and low-complexity visual detection of HPS.

Claims

1. A PCR primer pair for detecting Haemophilus parasuis, characterized in that, The sequence of the nucleic acid fragment amplified and detected by the primer pair is SEQ ID NO:

1.

2. The PCR primer pair as described in claim 1, characterized in that, The primer pair has the sequence of the upstream primer as SEQ ID NO:2 and the sequence of the downstream primer as SEQ ID NO:

3.

3. The use of the primer pair according to claim 1 in the preparation of a detection reagent for detecting Haemophilus parasuis.

4. A PCR-CRISPR / Cas13a detection reagent for detecting Haemophilus parasuis, characterized in that, The detection reagent contains the primer pair as described in claim 1.

5. The detection reagent as described in claim 4, characterized in that, The detection reagent also contains CRISPR-Cas13a protein, crRNA, and a reporter molecule.

6. The detection reagent as described in claim 5, characterized in that, The sequence of the crRNA is SEQ ID NO:

4.

7. The detection reagent as described in claim 5, characterized in that, The reporter molecule is a fluorescent reporter molecule with the sequence 5′-UUUUUUUUUUU-3′, and the 5′ and 3′ ends are labeled with FAM and BHQ1, respectively.

8. The detection reagent as described in claim 5, characterized in that, The reporter molecule is a biotin reporter molecule with the sequence 5′-UUUUUUUUUUU-3′, and its two ends are labeled with FAM and biotin, respectively.

9. A method for detecting Haemophilus parasuis, characterized in that, The method described herein is to perform detection using the detection reagent as described in claim 4.

10. The method as described in claim 9, characterized in that, The method, when the reporter molecule is a fluorescent reporter molecule, uses the nucleic acid of the sample to be tested as a template, performs a PCR reaction using the above-mentioned PCR primer pair to obtain an amplification product, and uses the above-mentioned reporter molecule and the above-mentioned crRNA to perform a CRISPR / Cas13a reaction on the amplification product to obtain a reaction product. The fluorescence and fluorescence value of the reaction product determine whether the sample to be tested contains Haemophilus parasuis nucleic acid, that is, the reaction product is observed under a blue light / ultraviolet light. If the reaction product produces green fluorescence, the sample to be tested contains Haemophilus parasuis nucleic acid; if the reaction product does not produce green fluorescence, the sample to be tested does not contain Haemophilus parasuis nucleic acid. When the reporter molecule is a biotin reporter molecule, using the nucleic acid of the sample to be tested as a template, a PCR reaction is performed using the above-mentioned PCR primer pair to obtain the amplification product. The amplification product is then subjected to a CRISPR / Cas13a reaction using the biotin reporter molecule and the above-mentioned crRNA to obtain the reaction product. The product after the CRISPR / Cas13a reaction is diluted with dd H2O at a ratio of 1:

1. The test strip is inserted into the diluted mixture and the test result is read after 10 minutes. If the control line is not colored and the test line is visible to the naked eye, it indicates that the nucleic acid probe has been almost completely cleaved by the Cas enzyme, and the result is positive, indicating that the sample to be tested contains Haemophilus parasuis nucleic acid. If the control line is colored and the test line is visible to the naked eye, it indicates that some of the nucleic acid probe has been cleaved by the Cas enzyme, and the result is positive, indicating that the sample to be tested contains Haemophilus parasuis nucleic acid. If the control line is colored but the test line is not colored, it indicates that the nucleic acid probe has not been cleaved by the Cas enzyme, and the result is negative, indicating that the sample to be tested does not contain Haemophilus parasuis nucleic acid. If neither the test line nor the control line is colored, the result is invalid.

Images