Molecular marker of a millet heading stage related candidate gene and application thereof
By detecting the nucleotide polymorphism at position 575772 in the coding region of the Seita.8G009400 gene on chromosome 8 of millet, and using competitive allele PCR amplification and dual fluorescence signal differentiation, the problem of early screening of early-maturing varieties in breeding in high-altitude and cold regions was solved, and efficient indoor screening and identification of early-heading germplasm resources was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2026-05-26
- Publication Date
- 2026-08-04
AI Technical Summary
In the process of millet planting shifting to high-altitude and remote areas, there is a lack of technical means to screen varieties with both regional adaptability and early maturity characteristics in the early stages. Traditional phenotypic identification at the heading stage relies on field observations at multiple locations over many years. The breeding cycle is long and easily affected by climate and environmental fluctuations. Furthermore, there is a lack of stable molecular markers for detection in cross-regional environments.
Primer sets were developed using nucleotide variation sites within specific gene coding regions to establish the correspondence between gene structure and early heading phenotype. Single nucleotide polymorphism at site 575772 in the coding region of the Seita.8G009400 gene on chromosome 8 of millet was detected by competitive allele-specific PCR amplification. Allele genotypes were distinguished using dual fluorescence signals, enabling screening of early heading germplasm resources under indoor conditions.
Early-heading materials can be screened at the seedling or seed stage, shortening the breeding cycle, improving selection efficiency, avoiding interference from cross-year and cross-regional climate environments, providing stable indicators for identifying early-maturing traits, and improving the accuracy and efficiency of screening.
Smart Images
Figure CN122503531A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of crop molecular breeding technology, specifically to a molecular marker for a candidate gene related to the heading stage of millet and its application. Background Technology
[0002] Millet is a traditional staple crop in my country's dryland ecological agriculture. The heading stage is a key agronomical trait determining the growth process, regional adaptability, and yield of millet. Rational control of the heading stage is a crucial technical approach to mitigating natural climate disasters and improving land resource utilization efficiency. With the profound adjustment of my country's agricultural planting structure and the continuous optimization of regional layout, millet cultivation has mainly shifted to high-altitude and remote areas such as Inner Mongolia, Gansu, and Ningxia. These regions have short frost-free periods and variable climates; therefore, early maturity is currently a primary breeding objective. Furthermore, to meet the market demand for "early harvesting of new rice," there is an urgent need to cultivate new varieties that combine early maturity and high yield.
[0003] In the existing crop breeding system, the development of millet varieties with early-maturing characteristics mainly relies on traditional hybridization breeding and field phenotypic selection. Breeders need to conduct long-term observations of plants in the field environment, record the actual number of days to heading to assess the early-maturing characteristics of the varieties, and then select individual plants that meet the climatic conditions of specific planting areas.
[0004] Traditional methods for identifying heading-stage phenotypic traits suffer from technical drawbacks, including long identification cycles and susceptibility to external environmental interference. Field phenotypic observations require repeated planting and recording verification across different years and regions. This is particularly problematic when millet varieties are transferred to cold, high-altitude regions with short frost-free periods and variable climates, where environmental fluctuations introduce uncertainty into phenotypic data. Although some quantitative trait loci related to millet heading stage have been reported, the industry lacks specific mutation sites and detection tools that can be stably detected across geographical regions, have clear functional correspondences, and can be directly used for marker-assisted breeding. This prevents breeders from accurately screening for early-maturing materials at the molecular genetic level during early developmental stages, making it difficult to overcome the interference of complex climatic environments on identification results. Summary of the Invention
[0005] The technical problem addressed by this invention is the lack of technical means to screen varieties with both regional adaptability and early maturity characteristics at an early stage during the transfer of millet cultivation to high-altitude and remote areas. Traditional phenotypic identification at the heading stage relies on field observations at multiple locations over many years, resulting in long breeding cycles and susceptibility to climate fluctuations. Although some quantitative trait loci related to millet heading stage have been reported, there is a lack of functional molecular markers that can stably function across years and regions with clear correlations, making it difficult to directly apply them to marker-assisted breeding.
[0006] In a first aspect, the present invention provides a molecular marker primer set for detecting single nucleotide polymorphisms of candidate genes related to the heading stage of millet, employing the following technical solution: A molecular marker primer set for detecting single nucleotide polymorphisms (SNPs) of candidate genes related to the heading stage of millet, wherein the primer set is used to detect the SNP at position 575772 of the coding region of the Seita.8G009400 gene on millet chromosome 8, wherein the SNP is a C / G variation.
[0007] By adopting the above technical solution, primer sets are developed using nucleotide variation sites in specific gene coding regions to establish the correspondence between gene structure and early heading phenotype, thus achieving the effect of screening early heading germplasm resources in an indoor environment.
[0008] The specific mechanism is as follows: 1. Target identification: The Seita.8G009400 gene encodes mitochondrial ethanolamine phosphate cytyltransferase. The single nucleotide polymorphism occurring at position 575772 in the coding region of the Seita.8G009400 gene is a non-synonymous variation, causing a change in the encoded amino acid.
[0009] 2. Phenotypic association: Haplotype materials carrying the G allele showed an earlier heading phenotype in multiple environments.
[0010] 3. Molecular marker transformation: The variant sites are transformed into nucleic acid primers that can be amplified and detected in vitro, allowing for genotyping immediately after extraction of deoxyribonucleic acid from millet tissue, thus avoiding the influence of plant growth cycle and external environmental conditions on breeding work. Preferably, the primer set includes an allele X primer targeting allele C, an allele Y primer targeting allele G, and a universal primer; the nucleotide sequence of the allele X primer is as follows: The nucleotide sequence of the allele Y primer is GAAGGTGACCAAGTTCATGCTGTACTATTATCAGGAGGATTGTTGC; the nucleotide sequence of the universal primer is CAACCGATCATGTTAGCTACCTG. The allele X primer has a first fluorescent adapter conjugated to its tail, and the allele Y primer has a second fluorescent adapter conjugated to its tail, different from the first fluorescent adapter. The target nucleotide sequence specifically bound and amplified by the primer set is: GATTCAAATCCATATGCTGTTCCAATAGCTATGGGCATTTACTGTAGGCTGGAGAGTCCTTTGGATATCACTACAAGTACTATTATCAGGAGGATTGTTG.
[0011] By employing the above technical solution, the primer set is used for detection based on the principle of competitive allele-specific amplification.
[0012] The specific reaction mechanism is as follows: 1. Competitive annealing: In the reaction system, allele X primer and allele Y primer simultaneously compete to bind to the target nucleotide sequence.
[0013] 2. Specific extension: When the primer terminal base is completely complementary to the template site, the polymerase initiates the extension reaction; when the primer terminal base is mismatched with the template site, the polymerase extension reaction is inhibited.
[0014] 3. Signal Differentiation: The accumulation of amplified products is accompanied by the release of specific fluorescent signals. Homozygous C genotype templates only trigger the extension of allele X primers, producing the first fluorescent signal; homozygous G genotype templates only trigger the extension of allele Y primers, producing the second fluorescent signal; heterozygous genotype templates trigger the extension of both primers simultaneously, producing dual fluorescent signals. This enables the detection of single nucleotide polymorphisms. Secondly, this invention provides a molecular identification method for early-heading millet germplasm resources, employing the following technical solution: A molecular identification method for early heading germplasm resources of millet includes amplifying and detecting the genomic deoxyribonucleic acid of the millet sample to be tested using a molecular marker primer set for detecting single nucleotide polymorphisms of candidate genes related to heading period of millet.
[0015] By employing the above technical solution, primer sets are used to amplify and detect samples in vitro, converting growth phenotype observation into laboratory nucleic acid signal determination. Inspectors can screen for materials carrying the early heading allele at the millet seedling or seed stage, shortening the breeding cycle and improving selection efficiency. Preferably, the molecular identification method includes the following steps: S1. Extract the genomic deoxyribonucleic acid of the millet sample to be tested as a reaction template, and extract and adjust the final concentration of the reaction template to 10 to 50 nanograms per microliter; S2. The reaction template, the molecular marker primer set, and the competitive allele-specific PCR premix are mixed to prepare a detection system for thermal cycling amplification. The thermal cycling amplification program includes: pre-denaturation at 94 degrees Celsius for 15 minutes; followed by 10 falling-point amplification cycles, with each cycle consisting of denaturation at 94 degrees Celsius for 20 seconds, annealing and extension combined for 60 seconds, and the temperature decreasing by 0.8 degrees Celsius from 65 degrees Celsius per cycle; finally, 30 standard amplification cycles are performed, with each cycle consisting of denaturation at 94 degrees Celsius for 20 seconds, and annealing and extension at 57 degrees Celsius for 60 seconds. S3. After the thermal cycling amplification reaction is completed, the fluorescence signal value is read to determine the genotype of the millet sample to be tested at the 575772 locus; the fluorescence signals of the allele X primer channel and the allele Y primer channel are read. If a single allele Y primer channel fluorescence signal is detected, the genotype of the millet sample to be tested is determined to be G / G homozygous, and the G / G homozygous type is an early heading superior haplotype.
[0016] By adopting the above technical solution, the parameter boundaries and operation procedures of the detection system were clarified.
[0017] The specific mechanism is as follows: 1. Template control: Limit the reaction template concentration to between 10 and 50 nanograms per microliter to avoid excessive template causing nonspecific amplification, while avoiding insufficient template causing delayed fluorescence signal generation.
[0018] 2. Falling amplification mechanism: A falling amplification program with decreasing temperature is executed in the early stages of thermal cycling. The initial high annealing temperature ensures that primers bind only to perfectly matching sequences, suppressing non-specific hybridization; as the cycle number increases and the annealing temperature decreases, the target fragment begins to amplify extensively. The falling amplification program improves the accuracy of polymorphic site identification.
[0019] 3. Result interpretation: The final genotype was determined by the ratio of fluorescence signal intensity in the dual channels. The correspondence between the G / G homozygous type and the early heading superior haplotype was established, providing identification indicators for the breeding of early-maturing millet varieties.
[0020] This invention provides a molecular marker for candidate genes related to millet heading stage and their applications. It offers the following advantages: 1. This invention, through genome-wide association analysis, identified locus 575772 in the coding region of the Seita.8G009400 gene on millet chromosome 8. It confirmed a stable correlation between the C / G variation at locus 575772 and the early heading phenotype in millet. The H003 haplotype material carrying the G allele showed a significantly earlier heading date of 3–5 days. Compared to traditional phenotypic identification methods relying on multi-year, multi-location field observations, the molecular marker K001578, composed of a specific single nucleotide polymorphism locus, provides a stable evaluation indicator at the molecular genetic level. This avoids interference from complex climatic environments across years and regions in the identification of early-maturing traits, thus improving the accuracy of screening early-heading germplasm resources.
[0021] 2. This invention designs a competitive amplification primer set containing specific allele primers and universal primers for polymorphic sites. Utilizing the primer terminal single-base complementarity and mismatch repression mechanism, combined with dual-channel fluorescence signal reading, the primer set can specifically distinguish between allele C and allele G in the amplification reaction system. This technique allows researchers to determine the genotype of a single millet plant at the seed or seedling stage, shortening the plant growth cycle required for phenotypic identification and meeting the needs of large-scale, high-throughput molecular marker-assisted selection.
[0022] 3. The molecular identification method provided by this invention, combined with a falling-amplification thermal cycling procedure, exhibits good amplification robustness and a high signal-to-noise ratio. Validation data shows that, within the set template concentration parameters, the fluorescent signal points generated by the amplification products of different genotypes cluster compactly on the distribution map without diffusion, and the boundary between heterozygous and homozygous types is clear. The above reaction system and parameter design ensure that clear genotyping results can be obtained for nucleic acid samples with different extraction concentrations in practical identification applications, reducing the detection error rate. Attached Figure Description
[0023] Figure 1 This is a diagram of the gene structure of the present invention; Figure 2 This is a correlation diagram between the two haplotypes of the present invention and the phenotype at the heading stage; Figure 3 This is the genotyping diagram of the present invention. Detailed Implementation
[0024] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0025] The main raw materials and reagents used in the following examples and comparative examples have the following sources and specifications. Reagents not specifically mentioned are all commercially available analytical grade or higher grade products.
[0026] Millet germplasm resources include various types of millet, such as red glutinous millet, sorghum stalk millet, yellow glutinous millet, tightly stalked millet, large-ear glutinous millet, green millet with exposed grains, autumn-haired millet, early millet, purple-rooted red millet, dog-tail millet (japonica millet), wild millet, red glutinous millet, wine millet, white millet with even heads, Datong yellow millet, sixty early millet, woolly glutinous millet, large yellow millet, white sand millet, red second millet, large yellow hairy glutinous millet, red seedling early millet, and the developed variety Longfu. 60533, bred variety 8609-3, bred variety Tie 8396, bred variety Xiaolibai male-sterile line, bred variety DA3 male-sterile line, bred variety 338A, bred variety Zheng 448, bred variety Tie 9037, bred variety Jigu 20, bred variety Nei 701, bred variety Lugu 9, bred variety Jigu 14, bred variety Longgu 11, bred variety Gonggu 65, bred variety Chaogu 12, bred variety Jigu 12, bred variety Zheng 204(1), bred variety Zheng 256, foreign variety S1359, foreign variety Set3 / 80. All the above-mentioned plant materials were collected, propagated and preserved by the applicant for use as real tissue sample materials for extracting plant genomic DNA.
[0027] The competitive allele-specific PCR amplification primer set is a custom-synthesized nucleic acid material not currently available in the market. Its specific preparation process will be described in the subsequent preparation examples. This primer set consists of three specifically designed oligonucleotide single-stranded molecules: an allele X primer targeting the mutation site C (its nucleotide sequence is GAAGGTGACCAAGTTCATGCTGTACTATTATCAGGAGGATTGTTGC, with a fluorescent chromophore conjugated to its 5' end); an allele Y primer targeting the mutation site G (its nucleotide sequence is GAAGGTCGGAGTCAACGGATTGTACTATTATCAGGAGGATTGTTGG, with a different fluorescent chromophore conjugated to its 5' end); and a universal primer without a fluorescent label (its nucleotide sequence is CAACCGATCATGTTAGCTACCTG). This primer set is used to target the extracted millet genomic DNA sequence: GATTCAAATCCATATGCTGTTCCAATAGCTATGGGCATTTACTGTAGGCTGGAGAGTCCTTTGGATATCACTACAAGTACTATTATCAGGAGGATTGTTG undergoes specific annealing and amplification.
[0028] Competitive allele-specific PCR premix is a commercially available, routine high-throughput molecular biology assay. This premix is a ready-to-use formulation containing immobilized Taq DNA polymerase with 5' to 3' exonuclease activity, a mixture of deoxyribonucleoside triphosphates, a universal oligonucleotide probe covalently modified with a specific fluorescent dye (e.g., FAM dye and HEX or VIC dye), a passive reference dye (ROX dye), and an amplification buffer containing magnesium chloride and an appropriate amount of potassium ions.
[0029] The hexadecyltrimethylammonium bromide, tris(hydroxymethyl)aminomethane, ethylenediaminetetraacetic acid, sodium chloride, chloroform, 3-methyl-1-butanol, 2-propanol, and anhydrous ethanol used in the extraction of plant genomic DNA are all commercially available basic chemical reagents that are extremely common in the field. The known conventional physicochemical properties of these reagents are sufficient to meet the purification requirements of cell lysis, nucleic acid precipitation, and impurity extraction in this invention, and do not involve any special physicochemical performance parameters. Whether or not they are disclosed will not result in insufficient disclosure. Those skilled in the art can successfully implement this invention using any commercially available brand of the above-mentioned reagents or conventional plant genomic DNA extraction kits; therefore, their specific molecular structures and parameters are omitted here to save space.
[0030] In the early stages of this invention, genome-wide association analysis (GWAS) was conducted based on the heading date phenotypic data of 942 core millet germplasm materials under multiple environments. In six environments—Beijing (2011, 2015), Qiqihar (2015), Taiyuan (2015), Urumqi (2016), and Yulin (2020)—a major-effect QTL locus significantly associated with heading date was repeatedly detected on millet chromosome 8. A comprehensive analysis of 13 candidate genes within this QTL interval, combined with expression pattern analysis, identified the candidate gene Seita.8G009400, which encodes mitochondrial ethanolamine phosphocytyltransferase. Further sequence analysis of Seita.8G009400 revealed 12 SNP variation sites in its coding region. Among these, two SNP sites at pos575528 and pos575772 were non-synonymous variations that could cause changes in the encoded amino acids. Based on the combination of these two sites, a total of three haplotypes were identified: H001, H002, and H003.
[0031] Preparation Example 1: This preparation example provides a KASP molecular marker primer set for detecting single nucleotide polymorphisms of candidate genes related to the heading stage of millet, with the marker number K001578, including the following steps: Based on the single nucleotide polymorphism (SNP) variant sequence at position 575772 in the coding region of the candidate gene Seita.8G009400 on chromosome 8 of millet, three single-stranded deoxyribonucleic acid (DNA) primers were designed and synthesized using artificial methods. Specifically: a primer targeting allele C (allele X) was synthesized, with the nucleotide sequence GAAGGTGACCAAGTTCATGCTGTACTATTATCAGGAGGATTGTTGC, and a first fluorescent adapter was coupled to the tail of this primer; a primer targeting allele G (allele Y) was synthesized, with the nucleotide sequence GAAGGTCGGAGTCAACGGATTGTACTATTATCAGGAGGATTGTTGG, and a second fluorescent adapter (different from the first fluorescent adapter) was coupled to the tail of this primer; a universal primer without fluorescent labeling was synthesized, with the nucleotide sequence CAACCGATCATGTTAGCTACCTG. The synthesized and purified single-stranded primers were thoroughly dissolved and mixed in nuclease-free water to prepare a target sequence for the extracted millet: A set of competitive allele-specific PCR molecular marker primers for specific annealing and amplification of GATTCAAATCCATATGCTGTTCCAATAGCTATGGGCATTTACTGTAGGCTGGAGAGTCCTTTGGATATCACTACAAGTACTATTATCAGGAGGATTGTTG.
[0032] Based on the single nucleotide polymorphism (SNP) variant sequence at position 575772 in the coding region of the candidate gene Seita.8G009400 on chromosome 8 of millet, three single-stranded deoxyribonucleic acid primers were designed and prepared using artificial synthesis methods.
[0033] Example 1:
[0034] This embodiment provides a molecular marker for a candidate gene related to the heading stage of millet and its application, including the following steps: Genomic DNA was extracted from leaves of 68 representative millet germplasm resources and its final concentration was adjusted to 30 nanograms per microliter as an intermediate parameter. A 10-microliter intermediate parameter detection system was prepared, containing 5 microliters of competitive allele-specific PCR premix, 0.14 microliters of the molecular marker primer set obtained in Example 1, 2 microliters of the extracted DNA template, and 2.86 microliters of nuclease-free water. The prepared detection system was placed in a high-throughput quantitative PCR instrument for amplification. The reaction program was set as follows: 94°C pre-denaturation for 15 minutes, followed by 10 cycles of a fallback amplification program (94°C denaturation for 20 seconds, annealing and extension combined for 60 seconds with the temperature decreasing by 0.8°C per cycle from 65°C), and finally 30 standard cycles (94°C denaturation for 20 seconds, annealing and extension for 60 seconds). After the reaction, the reaction tubes were cooled to room temperature, and the signal values of each fluorescence channel were read using a quantitative real-time PCR instrument to classify the genotypes. Among these 68 materials, 54 homozygous C / C haplotypes, 12 homozygous G / G haplotypes (target superior early-heading haplotypes), and 1 C / G heterozygous haplotype were successfully identified. The signal points of different genotypes clustered extremely tightly with no obvious diffusion, accurately and with high throughput, identifying the genotypes of the millet population and precisely pinpointing the superior early-heading G / G haplotype.
[0035] Example 2:
[0036] This embodiment provides a molecular marker for a candidate gene related to the heading stage of millet and its application, including the following steps: Genomic DNA was extracted from leaves of 68 representative millet germplasm resources and its final concentration was adjusted to 10 nanograms per microliter as the lower limit endpoint parameter. A detection system with a total reaction volume of 5 microliters was prepared, containing 2.5 microliters of competitive allele-specific PCR premix, 0.07 microliters of the molecular marker primer set obtained in Example 1, 1 microliter of the extracted DNA template, and 1.43 microliters of nuclease-free water. The prepared detection system was placed in a high-throughput quantitative PCR instrument and subjected to the same falling amplification and standard cyclic thermal reaction program as in Example 1. After the reaction, the fluorescence signal was read and genotyping was performed. The amplification specificity and signal-to-noise ratio were extremely high, and the genotyping distribution results were highly consistent with those of Example 1, demonstrating that the molecular markers of the present invention can still maintain amplification specificity and discrimination clarity under low concentration DNA templates and micro-reaction systems, and are suitable for early and accurate detection of micro-tissue samples and molecular marker-assisted selection.
[0037] Example 3:
[0038] This embodiment provides a molecular marker for a candidate gene related to the heading stage of millet and its application, including the following steps: Genomic DNA was extracted from leaves of 68 representative millet germplasm resources and its final concentration was adjusted to 50 nanograms per microliter (µL) as the upper limit endpoint parameter. A detection system with a total reaction volume of 15 µL was prepared, containing 7.5 µL of competitive allele-specific PCR premix, 0.21 µL of the molecular marker primer set obtained in Example 1, 3 µL of the extracted DNA template, and 4.29 µL of nuclease-free water. The prepared detection system was placed in a high-throughput quantitative PCR instrument and subjected to the same falling amplification and standard cyclic thermal reaction program as in Example 1. After the reaction, fluorescence signals were read and genotyping was performed. Genotype signal points showed significant clustering with extremely clear inter-cluster genotyping angles. The genotyping distribution results were completely consistent with those of Example 1, verifying the robustness and high-throughput identification capability of the molecular marker system of this invention under large reaction system and high template concentration conditions. Its genotyping success rate and accuracy fully meet the practical production and promotion requirements of molecular marker-assisted breeding.
[0039] Comparative Example 1: Compared with Example 1, the difference lies in the molecular marker development site used. In this comparative example, the 575528th site of the coding region of the Seita.8G009400 gene on chromosome 8 of millet was selected for molecular marker development and genotyping. All other aspects are the same.
[0040] Comparative Example 2: Compared with Example 1, the difference lies in the detection method of polymorphic site typing. This comparative example did not use competitive allele-specific PCR amplification primer set and fluorescence signal reading system. Instead, it used conventional primers to amplify the deoxyribonucleic acid fragment containing the 575772 site and then used first-generation sequencing technology to determine the genotype. All other aspects are the same.
[0041] Comparative Example 3: Compared with Example 1, the difference lies in the screening method for early heading germplasm resources. This comparative example did not use a seedling molecular marker-assisted selection system, but instead used traditional breeding methods to screen based on field observations of actual heading phenotypic data under cross-year and multi-regional environmental conditions. All other aspects are the same.
[0042] Test Example 1: Test Example 1 was used to determine the specificity of molecular marker typing and to validate the population detection rate. The specific experimental steps are as follows: After amplification in Examples 1 to 3, the reaction plates were placed in a high-throughput quantitative PCR instrument to scan the endpoint fluorescence signals. The FAM fluorescence signal values of the allele X primer and the HEX fluorescence signal values of the allele Y primer were read from each reaction well. The raw fluorescence datasets from both channels were extracted and imported into genotype analysis software. The data were normalized using the universal reference dye ROX signal as a baseline. A scatter plot was plotted based on the normalized relative fluorescence intensity ratios to divide the genotype quadrants. The coordinate data were extracted, and the genotypes of each sample were recorded. The number of homozygous and heterozygous samples was counted.
[0043] Twelve SNP variations in the coding region of the candidate gene Seita.8G009400 were analyzed, and two non-synonymous variant sites (pos575528C / T, pos575772C / G) were identified. Based on the two-site combination, 942 core germplasm accessions were classified into three haplotypes. The specific genotyping and phenotypic associations are shown in Table 1 below. Based on the heading date phenotypic data of 942 core millet germplasm resources under multiple years and locations, including Shunyi, Beijing (2016), Dingxi, Gansu (2018), Hainan (2010), Qiqihar, Heilongjiang (2016, 2017), Anyang, Henan (2016), Taiyuan, Shanxi (2012, 2013), Yulin, Shaanxi (2020), Anningqu, Xinjiang (2016), and Qitai, Xinjiang (2013, 2015), the correlation analysis results showed that the heading date of haplotype H003 was significantly earlier than that of haplotypes H001 and H002 by about 3 to 5 days, indicating that H003 is an excellent early heading haplotype. Further analysis shows that the pos575772 locus can clearly distinguish H003 from H001 and H002, and its allele status has a more direct correspondence with the early heading phenotype. Therefore, this locus is preferred as the molecular marker development site in this invention.
[0044] Table 2. Original test data for molecular marker typing in a portion of the validation population. Based on test data and the proposed mechanism, the Seita.8G009400 gene on millet chromosome 8 encodes mitochondrial ethanolamine phosphate cytyltransferase. A single nucleotide polymorphism (SNP) at position 575772 in the Seita.8G009400 gene coding region is a non-synonymous variation, causing a change in the encoded amino acid. Genome-wide association analysis confirmed that haplotypes carrying the G allele at position 575772 exhibited earlier heading behavior.
[0045] Table 2 shows the test data verifying the competitive amplification effect of the molecular marker primer set in the reaction system. When the template carries the homozygous G allele, the Y allele primer undergoes complete complementary extension and produces a HEX fluorescence signal with a relative intensity greater than 0.8, while the free background signal in the FAM channel is below 0.2. Conversely, the template carrying the homozygous C allele produces a FAM fluorescence signal. The single-base complementarity mechanism at the primer ends inhibits the polymerase extension reaction of the mismatched primers, and there is no cross-interference between the fluorescence signals corresponding to the two types of alleles. The sample points appear as independent clusters on the scatter plot. Heterozygous samples contain both template targets, and the two primers amplify equivalently, with both channels showing intermediate fluorescence signals.
[0046] This technical solution transforms cross-regional field observation of growth phenotypes into laboratory nucleic acid fluorescence signal determination. By identifying the differences in endpoint signals, homozygous individual plants carrying the early heading allele can be directly identified, thus achieving early auxiliary screening for early maturity traits.
[0047] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.
Claims
1. A molecular marker primer set for detecting single nucleotide polymorphisms (SNPs) of candidate genes related to millet heading stage, characterized in that, The primer set was used to detect a single nucleotide polymorphism (SNP) at position 575772 in the coding region of the Seita.8G009400 gene on chromosome 8 of millet, wherein the SNP is a C / G variation.
2. The molecular marker primer set according to claim 1, characterized in that, It includes allele X primers for allele C, allele Y primers for allele G, and universal primers.
3. The molecular marker primer set according to claim 2, characterized in that, The nucleotide sequence of the allele X primer is as follows: GAAGGTGACCAAGTTCATGCTGTACTATTATCAGGAGGATTGTTGC; The nucleotide sequence of the Y allele primer is as follows: GAAGGTCGGAGTCAACGGATTGTACTATTATCAGGAGGATTGTTGG; The nucleotide sequence of the universal primer is: CAACCGATCATGTTAGCTACCTG.
4. The molecular marker primer set according to claim 3, characterized in that, The tail of the allele X primer is coupled with a first fluorescent adapter, and the tail of the allele Y primer is coupled with a second fluorescent adapter, which is different from the first fluorescent adapter.
5. The molecular marker primer set according to any one of claims 1 to 4, characterized in that, The target nucleotide sequence that the primer set specifically binds to and amplifies is: GATTCAAATCCATATGCTGTTCCAATAGCTATGGGCATTTACTGTAGGCTGGAGAGTCCTTTGGATATCACTACAAGTACTATTATCAGGAGGATTGTTG.
6. A molecular identification method for early-heading millet germplasm resources, characterized in that, This includes using the molecular marker primer set according to any one of claims 1 to 5 to amplify and detect the genomic deoxyribonucleic acid of the millet sample to be tested.
7. The molecular identification method according to claim 6, characterized in that, Includes the following steps: S1. Extract the genomic deoxyribonucleic acid of the millet sample to be tested as a reaction template; S2. Mix the reaction template, the molecular marker primer set, and the competitive allele-specific PCR premix to prepare a detection system for thermal cycling amplification reaction; S3. After the thermal cycling amplification reaction is completed, the fluorescence signal value is read, and the genotype of the millet sample to be tested at the 575772 locus is determined.
8. The molecular identification method according to claim 7, characterized in that, In step S1, the final concentration of the reaction template is extracted and adjusted to 10–50 ng / μL.
9. The molecular identification method according to claim 7, characterized in that, In step S2, the procedure for the thermal cycling amplification reaction includes: pre-denaturation at 94°C for 15 minutes; followed by 10 fall amplification cycles, with each cycle consisting of denaturation at 94°C for 20 seconds, annealing and extension combined for 60 seconds, and the temperature decreasing by 0.8°C per cycle from 65°C; and finally, 30 standard amplification cycles, with each cycle consisting of denaturation at 94°C for 20 seconds, annealing and extension at 57°C for 60 seconds.
10. The molecular identification method according to claim 7, characterized in that, The specific implementation method of step S3 is as follows: read the fluorescence signals of the X primer channel and the Y primer channel of allele. If a single Y primer channel fluorescence signal is detected, the genotype of the millet sample to be tested is determined to be G / G homozygous, and the G / G homozygous type is an early heading superior haplotype.