A method for breeding a high-yield agaricus blazei murrill strain of ergothioneine
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- LINYI XIAOFENG MUSHROOM IND
- Filing Date
- 2026-06-23
- Publication Date
- 2026-08-04
AI Technical Summary
[0005]本发明目的是针对现有技术中杏鲍菇麦角硫因产量低、选育方法针对性差、效率低的问题,本发明提供一种杏鲍菇高产麦角硫因菌株的分子选育方法,通过基因编辑技术实现麦角硫因合成关键酶基因的过表达,获得麦角硫因产量显著提升且性状稳定的杏鲍菇菌株
[0039] 1. This invention adopts a three-level screening system of "gene editing construction + HPLC precise re-screening + key gene verification": the primary screening is carried out by adding ergothioneine to synthesize the precursor histidine, thereby selectively enriching high-yield potential strains and improving screening efficiency; the re-screening uses HPLC to accurately determine yield and ensure the accuracy of screening results; the key gene verification confirms the stability of high-yield traits at the molecular level, avoids phenotypic misjudgment, and significantly improves breeding efficiency and reliability.
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial breeding technology, specifically to a method for breeding a high-yield ergothionein strain of Pleurotus ostreatus. Background Technology
[0002] Ergothioneine is a natural chiral histidine derivative with unique biological functions. It possesses excellent antioxidant, anti-inflammatory, anti-cancer, and neurodegenerative disease prevention activities, and exhibits high thermal and pH stability. It has broad application prospects and huge market demand in the food, cosmetics, and pharmaceutical industries. The human body cannot synthesize ergothioneine and must obtain it through food. Edible and medicinal fungi such as king oyster mushrooms are excellent natural sources of ergothioneine.
[0003] Currently, ergothioneine is mainly obtained through chemical synthesis, direct extraction, and bio-fermentation. Chemical synthesis suffers from expensive reagents and high purification costs; direct extraction from Pleurotus eryngii fruiting bodies is limited by long raw material acquisition cycles and low yields, making it difficult to meet the demands of large-scale production; while bio-fermentation is the current mainstream approach, the ergothioneine yield of existing Pleurotus eryngii strains is generally low. For example, in current studies, the ergothioneine content in Pleurotus eryngii fermentation products is only about 20.50±1.80 mg / L, far from meeting the requirements for industrial production.
[0004] Existing breeding techniques for high-ergothionein-producing microorganisms mainly focus on genetically engineered chassis strains such as *Escherichia coli* and *Saccharomyces cerevisiae*, or on mutagenesis of other fungi. However, techniques for breeding high-ergothionein-producing strains of *Pleurotus eryngii* itself are relatively scarce. Existing *Pleurotus eryngii* mutagenesis studies primarily focus on increasing mycelial polysaccharide content, without addressing targeted breeding related to ergothionein synthesis. Furthermore, traditional mutagenesis methods suffer from low mutation rates, poor screening efficiency, and unstable high-yield traits. In addition, research indicates that ergothionein synthesis in *Pleurotus eryngii* depends on key synthase genes such as PeEgt1 and PeEgt2. Regulating the expression of these key genes can significantly increase ergothionein yield, but current technologies have not effectively combined key gene screening with gene editing to achieve targeted breeding. Therefore, developing an efficient and targeted method for breeding high-ergothionein-producing strains of *Pleurotus eryngii* is of great significance for promoting the large-scale production of ergothionein. Summary of the Invention
[0005] The purpose of this invention is to address the problems of low ergothioneine yield, poor targeting and low efficiency of existing technologies in Pleurotus eryngii. This invention provides a molecular breeding method for high-yield ergothioneine strains of Pleurotus eryngii. By using gene editing technology to overexpress the key enzyme gene for ergothioneine synthesis, a Pleurotus eryngii strain with significantly increased ergothioneine yield and stable traits is obtained.
[0006] The technical solution provided to achieve the above objectives is as follows:
[0007] A method for breeding a high-ergot-thiocandin-producing strain of Pleurotus ostreatus includes the following steps:
[0008] S1: The genome of the starting strain was sequenced, a framework diagram was constructed, and the key gene sequence peegt for ergothionein synthesis was identified through gene alignment. The key genes responsible for ergothionein synthesis in *Pleurotus eryngii* are peegt1 and peegt2 genes, and their gene sequences are as follows:
[0009] peegt1 SEQ ID NO.1
[0010]
[0011] Peegt2 SEQ ID NO.2
[0012]
[0013] S2: A peegt gene overexpression cassette was designed and synthesized at the pepal1 (phenylalanine ammonia-lyase gene 1) non-essential gene site in Pleurotus ostreatus: pepal1 upstream homologous arm (1000 bp) + pegpd1 or tw or pepal1 or pepal2 endogenous constitutive promoter (1000 bp) + peegt1 cDNA (2400 bp) or peegt2 (1640 bp) + gpd endogenous terminator (1000 bp) + pepal1 downstream homologous arm (1000 bp);
[0014] Pepal1 upstream homologous arm (1000 bp) SEQ ID NO.3
[0015] gtacgagctcagatctgcatgcggccgctcgagatcgatgaattcggatccactagtgtcgacctgcaggcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctct。
[0016] Pepal1 downstream homologous arm (1000 bp) SEQ ID NO.4
[0017] tcagagctctcatcataccccctaccgacatctagagctcgatggatccgagctcggtaccaagcttgcggccgcactagtggatccgaattcctgcagcccgggggatccactagttctagagcggccgccaccgcggtggagctccagcttttgttccctttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctaca。
[0018] pegpd1 endogenous constitutive promoter SEQ ID NO.5
[0019] ccatatcgggcatatccccggtcacatgacatcagttgcactgaatttttatgatttcgtcgagcggaatcttttctctttccagactgagagtgagatgcgactcttgtcgtacatgtgcatagcttagtgaacaattgtcaatgaccaagaaagctcgtgaagaggccgggtccggtcgcgctaatgtacaggatggccttagctggagtacagcagttaactcgggggtgattatacatcggttgagaggtatttcgtttcaggccttgcctctaatcccttgctctgcatatgcaccagataaatccgttttgtcgtagatgcgagagttcaggttttacgccaaaccgaaaagagttgcatgagcatccctctatgctggttatctgagcgggcccgtatcctatcggcgttagagtgcagtcggagagccgcatgtatcacggaaaggactcggacagggagttttatctattcttattggtcgatatcagtcagattgtcagtgcgtcaaagttgcatccataaggctactacggtgaaaccggtgtatcctgggatagcatgaaatggttgtatgcagaagataagaatgagagtagttctagaacgacaaacccaggccagggaggaagctgtagcatttgcaagactttgcagggcttttcaaaggcacttccatccaaagctcgagcacggttccaggcaaccttagtcatggggcgatagaactgaagaacgtttgctgattggcagtccatcccaaaggactcggccaataaatcctacccaatcgcaggtccgaggtactaaagtgttttaaggtctagactttagggctatcgtcgaagtcacaacatcacgcaatcaagatttgactgaagcgcgattatctataaaaggatcagttgtgtttttcgtccgcatcttttccttgttccacaaccttcgattctaaatacactccaatccattgactgcttgaattaaaatggta。
[0020] TW endogenous constitutive promoter SEQ ID NO.6
[0021] aagctttgtgagtcaatgggttcaacatcacaaagggggaatatagacattaggtattggagtaccccgaatcacggagaacactagagttagaaactgcgaatgtaggaagtgtttcatccgtacacaagtccaatttaaacacagtcaactcaccagtttaatgatcctcccccaataaagactccatcaatagacactaagtaatgagaactcaaagtcagtttcattgctgatgaccttattgataagagtcagactgaatggcactggcaagtgcactgttatagagctattgcgcgaacaatagacaactctatacctcctcatggtcgtgtaagacggggaagagaatgcgagtcatcacagtgactatccaaggaacagaacactcacatattcaagttctctggagccggccctcaggtatttattccgtagaaaagaaagagttcaacatagttgaacaaatctttagaacaaggcttaacctcagcggatcgtagcaacaaggctactctaccgcttacagtaccccgttcccattcaagtcgtctgcaaaggattcaccccgcgcatataattattacaattcgtagacgagccaacccagcatttccgcaaggttaaccgagtccacctgatttggtttacgagcaaagctctattttaacactagttacatgtgcgggaccaacatcatcgtttctagcacggattctgacttagaggcgttcagccataatccagcagatgatagcttcgcgccattgccgatcggacaggcgcaaataccaaatatctgaatgaacggttcctctcgtactaagttcaattactattacgatgaccctccatcagtagggtaaaactaacctgtctcacgacggtctaaacccagctcacgttcctattagtggtgaacaatccaacgcttaccgaattctgcttcggtatgataggaagagccgacatcgaaggatcaaaaagcaacgtcgct。
[0022] Pepal1 endogenous constitutive promoter SEQ ID NO.7
[0023] gtacgagctcagatctgcatgcggccgctcgagatcgatgaattcggatccactagtgtcgacctgcaggcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctct。
[0024] Pepal2 endogenous constitutive promoter SEQ ID NO.8
[0025] agttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtc。
[0026] Termination subsequence SEQ ID NO.9
[0027] 。
[0028] S3: Design and synthesize the sgRNA sequence (20nt+PAM) upstream of the pepal1 gene: 5′-GCTTAATCAGTCCAGGCATTAGG-3′;
[0029] Construction of S4: pCRISPR gene editing vector: gRNA uses the endogenous U6 promoter, and the gRNA sequence targets the upstream sequence of pepal1; Cas9 protein uses the endogenous promoter pegpd, tw, pepal1, or pepal2;
[0030] S5: Activation and culture of the starting strain: Select a robust and uncontaminated original strain of Pleurotus eryngii, inoculate it on PDA slant medium, and culture it in a constant temperature incubator at 25-28℃ for 7-10 days to obtain activated mycelium; inoculate the activated mycelium into liquid PDA medium and place it in a shaker at 25-28℃ and 150-200r / min for 5-7 days to obtain mycelium suspension.
[0031] S6: Protoplast Preparation: Take the above mycelial suspension, filter to collect the mycelium, and wash 2-3 times with 0.1-1 mol / L mannitol, sorbitol, or maltitol buffer; add a compound enzymatic hydrolysis solution (composed of 1.5% cellulase, 1.0% lysozyme, and 0.5% snailase, in 0.6 mol / L mannitol buffer, pH 5.8), and hydrolyze for 2-3 hours at 30℃ and 60 rpm; after hydrolysis, filter through 4 layers of sterile gauze to remove unhydrolyzed mycelial residue, collect the filtrate, centrifuge at 1500 rpm for 10 minutes, discard the supernatant, and wash the precipitate 2-3 times with 0.1-1 mol / L mannitol, sorbitol, or maltitol buffer to obtain Pleurotus eryngii protoplasts, resuspend them in sterile physiological saline, and adjust the concentration to 10. 6 -10 7 Protoplasts were collected at a density of 1 / mL. After washing with buffer, the mycelium was digested with a compound enzyme solution, filtered, centrifuged to collect the protoplasts, and resuspended.
[0032] S7: PEG-mediated protoplast transformation: Take a certain amount of protoplast suspension, add gene-editing plasmid, gently pipette to mix, and incubate on ice. Add an equal volume of fresh PEG transformation buffer, mix thoroughly, and incubate at room temperature to complete the transformation reaction. Finally, add sterile buffer to dilute 3-4 times, gently mix to terminate the PEG reaction, and centrifuge to collect the transformed protoplasts;
[0033] S8: Protoplast regeneration: Dilute the mutagenized protoplasts to a suitable concentration, spread them evenly on the regeneration medium (PDA medium with 0.6 mol / L mannitol, sorbitol, or maltitol added), and incubate in a constant temperature incubator at 25-28℃ in the dark for 10-14 days until regenerated colonies are formed, thus obtaining the mutagenized strain library;
[0034] S9 initial screening: Screening based on ergothionein synthesis precursor induction: Single colonies from the mutant strain library were inoculated into screening medium containing histidine (PDA medium with 0.5 g / L histidine added) and cultured at 25±1℃ for 7 days; the ergothionein content in the mycelium of each strain was rapidly detected by spectrophotometry, and strains with ergothionein content more than 30% higher than the starting strain were selected to enter the secondary screening stage.
[0035] S10: Precise rescreening by high performance liquid chromatography (HPLC): The strains obtained from the initial screening were inoculated into liquid PDA medium and cultured at 25±1℃ and 150 r / min for 7 days with shaking. Mycelia and fermentation broth were collected. Ergothioneine yield was accurately determined by HPLC. The chromatographic conditions were: C18 column (4.6 mm × 250 mm, 5 μm), mobile phase: methanol-water (v / v 10:90), flow rate: 1.0 mL / min, detection wavelength: 254 nm, column temperature: 30℃. Strains with ergothioneine yield ≥50 mg / L were selected for key gene expression level detection.
[0036] S11: Key gene verification and screening: Total RNA was extracted from the strains obtained from the secondary screening and reverse transcribed into cDNA. The relative expression levels of the key genes PeEgt1 or PeEgt2 for ergothionein synthesis were detected by real-time quantitative PCR (qRT-PCR). Strains with PeEgt1 or PeEgt2 gene expression levels that were more than 50% higher than those of the starting strain were selected to obtain candidate high-yielding strains.
[0037] S12: Stability verification: The candidate high-yielding strains were continuously passaged for 5 generations, and each generation of strains underwent liquid fermentation culture and ergothioneine yield detection; strains with ergothioneine yield fluctuations of ≤5% in each generation were selected as stable high-ergothioneine-producing strains of Pleurotus eryngii.
[0038] Beneficial effects:
[0039] 1. This invention adopts a three-level screening system of "gene editing construction + HPLC precise re-screening + key gene verification": the primary screening is carried out by adding ergothioneine to synthesize the precursor histidine, thereby selectively enriching high-yield potential strains and improving screening efficiency; the re-screening uses HPLC to accurately determine yield and ensure the accuracy of screening results; the key gene verification confirms the stability of high-yield traits at the molecular level, avoids phenotypic misjudgment, and significantly improves breeding efficiency and reliability.
[0040] 2. The high-yielding strain of Pleurotus eryngii selected in this invention can produce ergothioneine at a rate of over 100 mg / L, which is more than twice that of the original strain. Moreover, after five generations of continuous subculturing, the strain exhibits stable characteristics and minimal yield fluctuations. At the same time, this strain retains the original growth characteristics of Pleurotus eryngii, has a short fermentation cycle, and is suitable for large-scale industrial fermentation production, significantly reducing the production cost of ergothioneine. Detailed Implementation
[0041] Example 1
[0042] 1. Construct pCRISPR gene editing plasmids: Expression cassette 1—U6 promoter + sgRNA + PAM; Expression cassette 2—pepal1 upstream homologous arm + pegpd + peegt1 + terminator + pepal1 downstream homologous arm
[0043] 2. Activation and culture of the starting strain: Pleurotus eryngii strain PL7 was selected as the starting strain and inoculated into PDA slant medium (potato 200g / L, glucose 20g / L, agar 20g / L, water 1000mL, pH natural) and cultured in a constant temperature incubator at 25℃ for 8 days to obtain activated mycelium; a small amount of activated mycelium was picked up with a sterile inoculation needle and inoculated into 50mL of liquid PDA medium and cultured in a shaker at 25℃ and 150r / min for 6 days to obtain mycelium suspension.
[0044] 3. Protoplast preparation: Take 20 mL of mycelial suspension, filter it through sterile gauze to collect the mycelium, and wash it three times with 0.6 mol / L mannitol buffer (pH 5.8); place the mycelium in a 50 mL centrifuge tube, add 20 mL of compound enzymatic hydrolysis solution (cellulase 1.5%, lysozyme 1.0%, snailase 0.5%, solvent: 0.6 mol / L mannitol buffer), and hydrolyze for 2.5 h in a constant temperature water bath shaker at 30℃ and 60 r / min; after enzymatic hydrolysis, filter through four layers of sterile gauze, collect the filtrate, centrifuge at 800 r / min for 10 min, discard the supernatant, wash the precipitate three times with 0.6 mol / L mannitol buffer to obtain Pleurotus eryngii protoplasts, resuspend them in sterile physiological saline, and adjust the concentration to 5 × 10⁻⁶. 6 per mL.
[0045] 4. PEG-mediated protoplast transformation: Take 200 μL of protoplast suspension, add 20 μg of gene-editing plasmid, gently pipette to mix, and incubate on ice. Add an equal volume of fresh PEG transformation buffer, mix thoroughly, and incubate at room temperature to complete the transformation reaction. Finally, add 3 times the volume of sterile buffer to dilute, gently mix to terminate the PEG reaction, and centrifuge to collect the transformed protoplasts.
[0046] 5. Protoplast regeneration: The mutagenized protoplasts were serially diluted with sterile physiological saline to 10³ protoplasts / mL. 0.1 mL of the diluted solution was evenly spread on the regeneration medium (PDA medium with 0.6 mol / L mannitol added) and placed in a constant temperature incubator at 25℃ in the dark for 12 days to form 168 regenerated colonies, thus constructing a gene-edited strain library.
[0047] 6. Initial Screening: Screening based on ergothioneine precursor induction: 168 regenerated single colonies were inoculated into screening medium containing histidine (PDA medium with 0.5 g / L histidine added), with 3 replicates per colony, and cultured at 25℃ for 7 days; mycelia of each strain were collected, freeze-dried, and ground into powder. 0.1 g of powder was added to 1 mL of distilled water, and the mixture was extracted by sonication for 30 min, centrifuged at 12000 r / min for 10 min, and the supernatant was collected; the absorbance value was detected by spectrophotometry at a wavelength of 254 nm, and the content was calculated according to the ergothioneine standard curve; 22 strains with ergothioneine content increased by more than 30% compared with the starting strain (18.2 mg / L) were screened and entered the secondary screening stage.
[0048] 7. Secondary Screening: Precise Screening by High Performance Liquid Chromatography (HPLC): 22 initially screened strains were inoculated into 50 mL of liquid PDA medium and cultured at 25℃ and 150 r / min for 7 days with shaking. Mycelia and fermentation broth were collected, combined, freeze-dried, and ground into powder. 0.2 g of powder was added to 2 mL of methanol, ultrasonically extracted for 40 min, centrifuged at 12000 r / min for 15 min, and the supernatant was filtered through a 0.22 μm organic filter membrane. Ergothioneine yield was detected by HPLC. The chromatographic conditions were: C18 column (4.6 mm × 250 mm, 5 μm), mobile phase: methanol-water (v / v 10:90), flow rate: 1.0 mL / min, detection wavelength: 254 nm, column temperature: 30℃, injection volume: 20 μL. The results showed that 7 strains had ergothioneine yields ≥50 mg / L, with strain E-22 having the highest yield of 62.8 mg / L.
[0049] 8. Key Gene Validation and Screening: Total RNA was extracted from the rescreening strain and the starting strain, and cDNA was synthesized using a reverse transcription kit. Using the cDNA as a template, the relative expression level of the PeEgt1 gene was detected by qRT-PCR, with β-actin as the internal control gene. The qRT-PCR reaction system consisted of 20 μL: 10 μL SYBR Green qPCR Mix, 0.5 μL upstream primer, 0.5 μL downstream primer, 2 μL cDNA template, and 7 μL sterile water. The reaction program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s, 58℃ annealing for 30 s, and 72℃ extension for 30 s, for 40 cycles. The results showed that the relative expression level of the PeEgt1 gene in strain E-32 was 2.3 times that of the starting strain, meeting the screening requirements and thus identified as a candidate high-yielding strain.
[0050] 9. Stability verification: The E-22 strain was continuously passaged for 5 generations on PDA slant medium. Each generation of the strain was inoculated into liquid PDA medium for fermentation, and the ergothioneine yield was detected. The results showed that the ergothioneine yields of the 5 generations of strains were 62.8 mg / L, 63.2 mg / L, 61.9 mg / L, 62.5 mg / L, and 63.0 mg / L, respectively, with fluctuation ranges of ≤5%, indicating that the high-yield trait of this strain is stable.
[0051] Example 2
[0052] 1. Constructing pCRISPR gene editing plasmids: Expression cassette 1—U6 promoter + sgRNA + PAM; Expression cassette 2—pepal1 upstream homologous arm + petm + peegt1 + terminator + pepal1 downstream homologous arm
[0053] 2. Activation and culture of the starting strain: Pleurotus eryngii strain PL7 was selected as the starting strain and inoculated into PDA slant medium. It was cultured in a constant temperature incubator at 25℃ for 6 days to obtain activated mycelium. A small amount of activated mycelium was picked up with a sterile inoculation needle and inoculated into 50mL of liquid PDA medium. It was then placed in a shaker at 25℃ and 200r / min for 3 days to obtain a mycelium suspension.
[0054] 3. Protoplast preparation: Take 50 mL of mycelial suspension, filter it through sterile gauze to collect the mycelium, and wash it three times with 0.6 mol / L sorbitol buffer (pH 5.8); place the mycelium in a 50 mL centrifuge tube, add 20 mL of compound enzymatic hydrolysis solution (cellulase 1.5%, lysozyme 1.0%, snailase 0.5%, solvent: 0.6 mol / L mannitol buffer), and hydrolyze for 2.5 h in a constant temperature water bath shaker at 30℃ and 60 r / min; after enzymatic hydrolysis, filter through four layers of sterile gauze, collect the filtrate, centrifuge at 800 r / min for 10 min, discard the supernatant, wash the precipitate three times with 0.6 mol / L sorbitol buffer to obtain Pleurotus eryngii protoplasts, resuspend them in sterile physiological saline, and adjust the concentration to 5 × 10⁻⁶. 7 per mL.
[0055] 4. PEG-mediated protoplast transformation: Take 200 μL of protoplast suspension, add 40 μg of gene-editing plasmid, gently pipette to mix, and incubate on ice. Add an equal volume of fresh PEG transformation buffer, mix thoroughly, and incubate at room temperature to complete the transformation reaction. Finally, add 4 volumes of sterile buffer to dilute, gently mix to terminate the PEG reaction, and centrifuge to collect the transformed protoplasts.
[0056] 5. Protoplast regeneration: The mutagenized protoplasts were serially diluted with sterile physiological saline to 10³ protoplasts / mL. 0.1 mL of the diluted solution was evenly spread on the regeneration medium (PDA medium with 0.6 mol / L sorbitol added) and placed in a constant temperature incubator at 25℃ in the dark for 12 days to form 123 regenerated colonies, thus constructing a gene-edited strain library.
[0057] 6. Initial Screening: Screening based on ergothioneine precursor induction: 123 regenerated single colonies were inoculated into screening medium containing histidine (PDA medium with 0.8 g / L histidine added), with 3 replicates per colony, and cultured at 25℃ for 7 days; mycelia of each strain were collected, freeze-dried, and ground into powder. 0.1 g of powder was added to 1 mL of distilled water, and the mixture was extracted by sonication for 30 min, centrifuged at 12000 r / min for 10 min, and the supernatant was collected; the absorbance value was detected by spectrophotometry at a wavelength of 254 nm, and the content was calculated according to the ergothioneine standard curve; 18 strains with an ergothioneine content of more than 30% higher than the starting strain (18.2 mg / L) were selected and entered the secondary screening stage.
[0058] 7. Secondary Screening: Precise Screening by High Performance Liquid Chromatography (HPLC): 18 strains of the initial screening strains were inoculated into 50 mL of liquid PDA medium and cultured at 25℃ and 150 r / min for 7 days with shaking. Mycelia and fermentation broth were collected, combined, freeze-dried, and ground into powder. 0.2 g of powder was added to 2 mL of methanol, ultrasonically extracted for 40 min, centrifuged at 12000 r / min for 15 min, and the supernatant was filtered through a 0.22 μm organic filter membrane. Ergothioneine yield was determined by HPLC. The chromatographic conditions were: C18 column (4.6 mm × 250 mm, 5 μm), mobile phase: methanol-water (v / v 10:90), flow rate: 1.0 mL / min, detection wavelength: 254 nm, column temperature: 30℃, injection volume: 20 μL. The results showed that 4 strains had ergothioneine yields ≥50 mg / L, with strain E-15 having the highest yield of 84.1 mg / L.
[0059] 8. Key Gene Validation and Screening: Total RNA was extracted from the rescreening strain and the starting strain, and cDNA was synthesized using a reverse transcription kit. Using the cDNA as a template, the relative expression level of PeEgt1 was detected by qRT-PCR, with β-actin as the internal reference gene. The qRT-PCR reaction system consisted of 20 μL: 10 μL SYBR Green qPCR Mix, 0.5 μL upstream primer, 0.5 μL downstream primer, 2 μL cDNA template, and 7 μL sterile water. The reaction program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s, 58℃ annealing for 30 s, and 72℃ extension for 30 s, for 40 cycles. The results showed that the relative expression level of the PeEgt1 gene in strain E-15 was 3.6 times that of the starting strain, meeting the screening requirements and thus identified as a candidate high-yielding strain.
[0060] 9. Stability verification: The E-15 strain was continuously passaged for 5 generations on PDA slant medium. Each generation of the strain was inoculated into liquid PDA medium for fermentation, and the ergothioneine yield was detected. The results showed that the ergothioneine yields of the 5 generations of strains were 85.8 mg / L, 83.1 mg / L, 81.5 mg / L, 82.4 mg / L, and 83.5 mg / L, respectively, with fluctuation ranges of ≤2%, indicating that the high-yield trait of this strain is stable.
[0061] Example 3
[0062] 1. Construct pCRISPR gene editing plasmids: Expression cassette 1—U6 promoter + sgRNA + PAM; Expression cassette 2—pepal1 upstream homologous arm + pepal1 + peegt1 + terminator + pepal1 downstream homologous arm
[0063] 2. Activation and culture of the starting strain: Pleurotus eryngii strain PL7 was selected as the starting strain and inoculated into PDA slant medium. It was cultured in a constant temperature incubator at 25℃ for 10 days to obtain activated mycelium. A small amount of activated mycelium was picked up with a sterile inoculation needle and inoculated into 50mL of liquid PDA medium. It was then placed in a shaker at 25℃ and 220r / min and cultured for 3 days to obtain a mycelium suspension.
[0064] 3. Protoplast preparation: Take 50 mL of mycelial suspension, filter it through sterile gauze to collect the mycelium, and wash it three times with 0.8 mol / L mannitol buffer (pH 5.8); place the mycelium in a 50 mL centrifuge tube, add 20 mL of compound enzymatic hydrolysis solution (cellulase 1.5%, lysozyme 1.0%, snailase 0.5%, solvent: 0.8 mol / L mannitol buffer), and hydrolyze for 2.5 h in a constant temperature water bath shaker at 30℃ and 60 r / min; after enzymatic hydrolysis, filter through four layers of sterile gauze, collect the filtrate, centrifuge at 800 r / min for 10 min, discard the supernatant, wash the precipitate three times with 0.8 mol / L mannitol buffer to obtain Pleurotus eryngii protoplasts, resuspend them in sterile physiological saline, and adjust the concentration to 5 × 10⁻⁶. 8 per mL.
[0065] 4. PEG-mediated protoplast transformation: Take 200 μL of protoplast suspension, add 60 μg of gene-editing plasmid, gently pipette to mix, and incubate on ice. Add an equal volume of fresh PEG transformation buffer, mix thoroughly, and incubate at room temperature to complete the transformation reaction. Finally, add 4 volumes of sterile buffer to dilute, gently mix to terminate the PEG reaction, and centrifuge to collect the transformed protoplasts.
[0066] 5. Protoplast regeneration: The mutagenized protoplasts were serially diluted to 10⁻⁶ with sterile physiological saline. 5 The concentration of bacteria was 137 / mL. 0.1 mL of the diluted solution was evenly spread on the regeneration medium (PDA medium with 0.8 mol / L mannitol added) and placed in a constant temperature incubator at 28℃ in the dark for 12 days to form 137 regenerated colonies, thus constructing a mutant strain library.
[0067] 6. Initial Screening: Screening based on ergothioneine precursor induction: 137 regenerated single colonies were inoculated into screening medium containing histidine (PDA medium with 0.5 g / L histidine added), with 3 replicates per colony, and cultured at 25℃ for 7 days; mycelia of each strain were collected, freeze-dried, and ground into powder. 0.1 g of powder was added to 1 mL of distilled water, and the mixture was extracted by sonication for 30 min, centrifuged at 12000 r / min for 10 min, and the supernatant was collected; the absorbance value was detected by spectrophotometry at a wavelength of 254 nm, and the content was calculated according to the ergothioneine standard curve; 34 strains with an ergothioneine content of more than 30% higher than the starting strain (18.2 mg / L) were selected and entered the secondary screening stage.
[0068] 7. Secondary Screening: Precise Screening by High Performance Liquid Chromatography (HPLC): 34 strains of the initial screening strains were inoculated into 50 mL of liquid PDA medium and cultured at 25℃ and 150 r / min for 7 days with shaking. Mycelia and fermentation broth were collected, combined, freeze-dried, and ground into powder. 0.2 g of powder was added to 2 mL of methanol, ultrasonically extracted for 40 min, centrifuged at 12000 r / min for 15 min, and the supernatant was filtered through a 0.22 μm organic filter membrane. Ergothioneine yield was detected by HPLC. The chromatographic conditions were: C18 column (4.6 mm × 250 mm, 5 μm), mobile phase: methanol-water (v / v 10:90), flow rate: 1.0 mL / min, detection wavelength: 254 nm, column temperature: 30℃, injection volume: 20 μL. The results showed that 11 strains had ergothioneine yields ≥50 mg / L, with strain E-5 having the highest yield of 102.8 mg / L.
[0069] 8. Key Gene Validation and Screening: Total RNA was extracted from the rescreening strain and the starting strain, and cDNA was synthesized using a reverse transcription kit. Using cDNA as a template, the relative expression levels of PeEgt1 and PeEgt2 genes were detected by qRT-PCR, with β-actin as the internal control gene. The qRT-PCR reaction system consisted of 20 μL: 10 μL SYBR Green qPCR Mix, 0.5 μL upstream primer, 0.5 μL downstream primer, 2 μL cDNA template, and 7 μL sterile water. The reaction program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s, 58℃ annealing for 30 s, and 72℃ extension for 30 s, for 40 cycles. The results showed that the relative expression level of the PeEgt1 gene in strain E-5 was 5.1 times that of the starting strain, meeting the screening requirements and thus identified as a candidate high-yielding strain.
[0070] 9. Stability verification: The E-5 strain was continuously passaged for 5 generations on PDA slant medium. Each generation of the strain was inoculated into liquid PDA medium for fermentation, and the ergothioneine yield was detected. The results showed that the ergothioneine yields of the 5 generations of strains were 102.8 mg / L, 103.2 mg / L, 101.9 mg / L, 102.5 mg / L, and 103.0 mg / L, respectively, with fluctuation ranges of ≤2%, indicating that the high-yield trait of this strain is stable.
Claims
1. A molecular selection method for a high-yield ergothionein-producing strain of Pleurotus ostreatus, characterized in that, Includes the following steps: S1: Sequencing the genome of the starting strain, constructing a framework diagram, and identifying the key gene sequence peegt for ergothionein synthesis through gene alignment; S2: Design and synthesize the peegt gene overexpression gene at the pepal1 (phenylalanine ammonia-lyase gene 1) site, a non-essential gene in Pleurotus ostreatus. Box: Pepal1 upstream homologous arm + endogenous promoter + peegt cDNA + terminator + Pepal1 downstream homologous arm; S3: Design and synthesize the sgRNA sequence (20nt+PAM) upstream of the pepal1 gene: 5′-GCTTAATCAGTCCAGGCATTAGG-3′; S4: Construction of pCRISPR gene editing vector: gRNA uses the endogenous U6 promoter, and the gRNA sequence targets the upstream sequence of pepal1; Cas9 protein uses the endogenous promoter; S5: Activation and Culture of the Starting Strains: A robust, uncontaminated *Pleurotus eryngii* strain was selected and inoculated onto PDA slant medium. The strain was cultured at 25-28℃ for 7-10 days to obtain activated mycelium. The activated mycelium was then inoculated onto liquid PDA medium and cultured at 25-28℃ and 150-200 rpm for 5-7 days to obtain a mycelial suspension. S6: Protoplast preparation: Collect mycelia, wash with buffer solution, digest with compound enzyme solution, filter, centrifuge to collect protoplasts and resuspend; S7: PEG-mediated protoplast transformation: Take a certain amount of protoplast suspension, add gene editing plasmid, gently pipette to mix, place on ice, add an equal volume of fresh PEG transformation buffer, mix thoroughly, incubate at room temperature to complete the transformation reaction, finally add sterile buffer to dilute, gently mix to terminate the PEG reaction, and centrifuge to collect the transformed protoplasts. S8: Protoplast regeneration: Transformed protoplasts are spread on regeneration medium and cultured to obtain a gene-edited strain library; S9 initial screening: Gene-edited strains were inoculated into screening medium containing histidine, and after cultivation, the ergothionein content was detected by spectrophotometry. Strains with a content more than 30% higher than that of the starting strain were selected. S10: Secondary screening: The strains screened in the primary screening were cultured by liquid fermentation, and the yield of ergothionein was accurately detected by HPLC. Strains with a yield ≥50mg / L were selected. S11: Key gene verification and screening: The relative expression levels of the PeEgt gene in the secondary screening strains were detected, and candidate high-yielding strains with both expression levels increased by more than 50% compared with the starting strain were selected. S12: Stability verification: The candidate high-yielding strains were continuously passaged and cultured. The ergothionein yield of each generation was detected. The strain with a fluctuation range of ≤5% was selected as the target strain.
2. The breeding method according to claim 1, characterized in that, In step S1, the ergothionein synthesis gene can be peegt1 or peegt2 or an optimized gene sequence of both.
3. The breeding method according to claim 1, characterized in that, In step S2, the endogenous promoter can be pegpd1, pepal1, pepal2, tw1, or an optimized sequence of the above promoters.
4. The breeding method according to claim 1, characterized in that, In step S8, the regeneration medium is a PDA medium supplemented with mannitol, sorbitol, maltitol, or xylitol, with an addition amount of 0.1-1M.
5. The breeding method according to claim 1, characterized in that, In step S9, the screening medium is PDA medium supplemented with 0.5 g / L histidine; the spectrophotometric detection wavelength is 254 nm.
6. The breeding method according to claim 1, characterized in that, In step S11, qRT-PCR was used to detect gene expression levels. The PeEgt primer sequences were 5'-ATGGCCTCTTCTGCTCTTCT-3' and 5'-TCAGACTGCTGCTGCTTCTT-3''.