Screening of specific target sequence, primer pair, kit and application for identifying ferula sinkiangensis based on shizhen method

Abstract

The present application relates to the technical field of Ferula species identification, and is a specific target sequence, primer pair, kit and application for identifying Ferula sinkiangensis based on the screening method of Shi Zhen, the present application provides a specific target sequence for accurately identifying Ferula sinkiangensis, the sequence is obtained by screening the whole genome data of Ferula, and the specificity is verified by Sanger sequencing and CRISPR / Cas12a system, the target can effectively distinguish Ferula sinkiangensis and its close species, and realize accurate determination of the species of the sample to be detected. The detection system based on the specific target sequence for identifying Ferula sinkiangensis has high specificity, high sensitivity and result stability, and the operation process is simple, which can be widely applied to the identification of plant tissues, medicinal materials and related products, and provides strong technical support for guaranteeing the safety of clinical medication and standardizing the market order of Ferula.

Description

Technical Field

[0001] This invention relates to the field of species identification technology of Ferula assa-foetida, and to a specific target sequence, primer pair, kit, and application based on the Shizhen method for screening to identify Ferula assa-foetida from Xinjiang. Background Technology

[0002] Ferula assa-foetida is a resin processed from plants of the genus Ferula in the family Apiaceae. It has traditional medicinal properties such as promoting blood circulation, removing blood stasis, reducing inflammation, and relieving swelling. Modern research has also confirmed its potential in the treatment of gastrointestinal diseases and anti-tumor applications. Xinjiang Ferula assa-foetida and Fukang Ferula assa-foetida have been included in the Chinese Pharmacopoeia as the legally recognized authentic source plants of Ferula assa-foetida since 1977. However, due to the extreme scarcity of authentic resources, Xinjiang Ferula assa-foetida has been listed as a national second-class protected plant and assessed as critically endangered (CR), leading to an increasingly prominent supply-demand imbalance in the market. Driven by profit, closely related species such as Ferula multiumbellatus, Ferula odorata, and Ferula hominis, which are relatively widely distributed and morphologically similar, are widely used as substitutes or even counterfeits in the market. Studies have confirmed that there are significant differences between authentic Xinjiang Ferula assa-foetida and its closely related species in core medicinal components such as volatile oils and sulfur-containing compounds. Substitution and adulteration not only seriously weaken clinical efficacy but also harbor unpredictable safety risks.

[0003] However, existing technologies have fatal limitations in the identification and protection of genuine Xinjiang Ferula asperata, a critically endangered species. Traditional morphological and microscopic identification loses their distinguishing characteristics after resinification or pulverization of the medicinal material. Chemical fingerprinting technology is difficult to confirm authenticity due to overlapping segments in the secondary metabolites of Xinjiang Ferula asperata and closely related species, and is greatly affected by environmental factors. Although conventional DNA barcoding technology can differentiate at the genus level, it often fails to provide exclusive identification results for interspecific identification of Xinjiang Ferula asperata and its closely related species due to insufficient universal fragment variation sites and overlapping intraspecific and interspecific variations. More importantly, in the face of adulteration methods in the market, especially the trace addition of resin from closely related species to Xinjiang Ferula asperata, existing technologies lack highly specific molecular markers mined from the whole genome level, making it impossible to accurately verify the pure species of Xinjiang Ferula asperata. This results in the inability to effectively protect genuine medicinal materials and may even exacerbate clinical drug safety risks due to the misuse of counterfeit products.

[0004] With the advancement of sequencing technology, whole-genome data mining has become a crucial technique for accurate species identification. Screening for species-specific targets from whole-genome sequencing data using the Shizhen method overcomes the blind spots of traditional identification methods that rely on a few fragments, providing a new technological pathway for the rapid, accurate, and standardized identification and testing of Xinjiang Ferula. By mining unique target sequences of Xinjiang Ferula and developing corresponding primer pairs and kits, the industry challenge of distinguishing Xinjiang Ferula from morphologically similar closely related species can be fundamentally solved. This enables absolute identification and authentication of critically endangered genuine products, providing irreplaceable technical support for ensuring clinical drug safety, regulating market order, and protecting rare and endangered medicinal plant resources. Summary of the Invention

[0005] This invention provides a specific target sequence, primer pair, kit, and application for identifying Xinjiang Ferula asperata based on the Shizhen method, overcoming the shortcomings of the prior art and effectively solving the problem that existing Xinjiang Ferula asperata and its closely related species cannot be effectively identified and distinguished.

[0006] One of the technical solutions of this invention is achieved through the following measures: a method for screening specific target sequences for identifying Xinjiang asafoetida based on the Shizhen method, comprising the following steps: Step 1: Obtain whole genome sequencing data of Ferula species through resequencing, and decompose them into 25bp fragments to construct a candidate target sequence library: ① containing PAM sequences (starting with "TTTV" or ending with "VAAA", where V represents A, G, or C); ② GC content of 40% to 60%; ③ not containing 4 or more consecutive identical bases; ④ containing four bases: A, G, C, and T, and not containing poly structures.

[0007] Step 2: Align the 25 kmer containing PAM in the candidate target sequence library of each species with the 25 kmer of other species, retain the 21 bp sequences in the target species that have more than 3 nucleotide mismatches or insertions / deletions with other species sequences, and construct the target sequence library, and record the frequency of the target sequence in the genome of the target species.

[0008] Step 3: Select target sequences from the above target sequence library according to target frequency (high, medium, low), and perform Blast alignment in NBCI. Select sequences that have more than 3 nucleotide differences after removing the PAM sequence for detection. These sequences can be used to identify Xinjiang Ferula species and other closely related species corresponding to specific target sequences.

[0009] The specific target sequences for identifying Xinjiang Ferula asperata obtained by the above method include specific target sequences Ffe-53 and Ffe-59, and their nucleotide sequences are as follows: Ffe-53: 5'-TGGAACTCCTAAGAGTGGTTAGAAA-3', such as SEQ ID NO: 1; Ffe-59: 5'-CTTCCGATGCCTGCAAAGGCTGAAA-3', such as SEQ ID NO: 4.

[0010] The above SEQ ID NO:1 and SEQ ID NO:4 are both Xinjiang Ferula (Ferula assa-foetida). Ferula sinkiangensis The specific target sequences for identifying Xinjiang Ferula and its closely related species can be identified as long as one of them is identified. In some implementations, the specific target sequences that can be used to identify Xinjiang Ferula are not limited to this, but include all specific target sequences that meet the criteria screened using whole genome sequencing data.

[0011] The second technical solution of the present invention is achieved through the following measures: a primer pair for identifying Xinjiang Ferula is primer pair Ffe-53 or primer pair Ffe-59, primer pair Ffe-53 includes Ffe-53_F forward primer and Ffe-53_R reverse primer, and its nucleotide sequence is as follows: Fsi-53_F:5'-GACAGCGGACCAAGACTGATTCG-3', such as SEQ ID NO:2; Fsi-53_R:5'-GCAGCACATCCTTTTCAATCCTCGT-3', such as SEQ ID NO:3; The above SEQ ID NO:2 and SEQ ID NO:3 are used to amplify the specific target sequence Ffe-53 with the nucleotide sequence of SEQ ID NO:1; The primer pair Ffe-59 includes the Ffe-59_F forward primer and the Ffe-59_R reverse primer, and their nucleotide sequences are as follows: Fsi-59_F:5'-GGTTCGGTACTCTTACCAGCATTCTT-3', such as SEQ ID NO:5; Fsi-59_R:5'-CACTCTATGGCAGCATGTCCTACAAC-3', such as SEQ ID NO:6; The above SEQ ID NO:5 and SEQ ID NO:6 are used to amplify the specific target sequence Ffe-59 with the nucleotide sequence of SEQ ID NO:4.

[0012] The primer pairs described above are applicable to any type of DNA amplification method, including but not limited to polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), real-time quantitative PCR (qPCR), loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), recombinase polymerase amplification (RPA), and enzyme-catalyzed isothermal amplification (ERA).

[0013] SEQ ID NO:2 and SEQ ID NO:3 are used to amplify SEQ ID NO:1, and SEQ ID NO:5 and SEQ ID NO:6 are used to amplify SEQ ID NO:4. Detection of the amplified products can determine the presence of a specific target sequence. The detection system for the specific target sequence includes, but is not limited to, the Sanger sequencing system and the CRISPR / Cas12a system. For the Sanger sequencing system, if the sequencing result is the same as the standard specific target sequence, the sample to be tested is identical to the specified *Ferula* species; otherwise, it is not. For the CRISPR / Cas12a system, detection is performed as follows: if strong fluorescence is produced under blue light irradiation, it indicates that the sample to be tested is identical to the specified *Ferula* species; otherwise, it indicates that the two are not identical.

[0014] The third technical solution of the present invention is achieved through the following measures: a specific crRNA molecule for identifying Xinjiang Ferula, wherein the specific crRNA molecule is either specific crRNA molecule Ffe-53 or specific crRNA molecule Ffe-59, and its sequence is as follows: Fsi-53:UAAUUUCUACUAAGUGUAGAUUAACCACUCUUAGGAGUUCCA, such as SEQ ID NO: 7; Fsi-59:UAAUUUCUACUAAGUGUAGUAGCCUUUGCAGGCAUCGGAAG, such as SEQ ID NO:8.

[0015] The above SEQ ID NO:7 is used to detect SEQ ID NO:1, and SEQ ID NO:8 is used to detect SEQ ID NO:4.

[0016] The fourth technical solution of the present invention is achieved through the following measures: a kit for identifying Xinjiang asafoetida, comprising primer pair Ffe-53 or primer pair Ffe-59 for identifying Xinjiang asafoetida.

[0017] The kits used to identify Xinjiang asafoetida also include PCR reaction reagents and CRISPR-Cas12a system reaction reagents.

[0018] The PCR reaction reagents mentioned above include PCR amplification buffer, dNTPs, Taq DNA polymerase, MgCl2, and sterile double-distilled water.

[0019] The above-mentioned CRISPR-Cas12a system reaction reagents include gene editing buffer, Cas protein, crRNA, nuclease-free water, and fluorescent signal molecules.

[0020] The aforementioned crRNAs are specific crRNA molecules Ffe-53 or Ffe-59 used to identify *Ferula assa-foetida* from Xinjiang. The crRNAs are specifically designed based on the target sequences of the species to be identified, exhibiting a high degree of matching. The screened specific target sequences for identifying *Ferula assa-foetida* from Xinjiang are highly specific, existing only in the target species, and can effectively distinguish the target species from other closely related species.

[0021] The fifth technical solution of the present invention is achieved through the following measures: the application of a kit for identifying Xinjiang Ferula aspera in identifying Xinjiang Ferula aspera or materials derived from Xinjiang Ferula aspera, and in distinguishing Xinjiang Ferula aspera and its closely related species.

[0022] The kit described above for identifying Xinjiang Ferula can identify samples from which specific target sequences can be obtained, including but not limited to plant tissues, medicinal materials and decoction pieces, traditional Chinese medicine preparations, and dietary supplements.

[0023] This invention provides a specific target sequence for the accurate identification of *Ferula assa-foetida* from Xinjiang. This sequence was obtained through screening the whole genome data of the *Ferula* genus and its specificity was verified by dual validation using Sanger sequencing and the CRISPR / Cas12a system. This target can effectively distinguish *Ferula assa-foetida* from Xinjiang and its closely related species, enabling accurate species identification of the sample. The detection system constructed based on the specific target sequence for identifying *Ferula assa-foetida* from Xinjiang, based on this invention, possesses high specificity, high sensitivity, and result stability. The operation procedure is simple and can be widely applied to the identification of plant tissues, medicinal materials, and related products, providing strong technical support for ensuring the safety of clinical drug use and regulating the *Ferula assa-foetida* market. Attached Figure Description

[0024] Figure 1 The results of BLAST alignment of the species-specific target sequence Fsi-53 of Ferula assa-foetida from Xinjiang.

[0025] Figure 2 The results of BLAST alignment of the species-specific target sequence Fsi-59 of Ferula assa-foetida from Xinjiang.

[0026] Figure 3 Sanger sequencing results for species-specific target sequences Fsi-53 and Fsi-59 of Ferula assa-foetida from Xinjiang.

[0027] Figure 4The results of visual fluorescence detection of the species-specific target sequence Fsi-53 of Ferula assa-foetida from Xinjiang.

[0028] Figure 5 The results of visual fluorescence detection of the species-specific target sequence Fsi-59 of Ferula assa-foetida from Xinjiang. Detailed Implementation

[0029] The present invention is not limited to the following embodiments, and the specific implementation can be determined according to the technical solution of the present invention and the actual situation.

[0030] The abbreviations used in the embodiments of this invention have their conventional meanings in the chemical and biological fields. The chemical structures and formulas described herein are constructed according to the standardized valence rules known in the field of chemistry. Unless otherwise specified, "μM" in this document refers to "μmol / L".

[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0032] It should be noted that the GenBank database is a DNA sequence database established by the National Center for Biotechnology Information (NCBI) in the United States. The address of the database is: https: / / www.ncbi.nlm.nih.gov / genbank / .

[0033] In this article, unless otherwise stated, the term "whole genome" refers not only to the entire genome sequence of an organism, but also to organelle genomes (such as chloroplast genomes).

[0034] To make the technical solutions disclosed herein clearer and easier to understand, a detailed description is provided below in conjunction with the accompanying drawings and specific embodiments.

[0035] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0036] The present invention will be further described below with reference to embodiments: Example 1: This method for identifying specific target sequences of Ferula asperata from Xinjiang is characterized by including specific target sequences Ffe-53 and Ffe-59, the nucleotide sequences of which are as follows: Ffe-53: 5'-TGGAACTCCTAAGAGTGGTTAGAAA-3', such as SEQ ID NO: 1; Ffe-59: 5'-CTTCCGATGCCTGCAAAGGCTGAAA-3', such as SEQ ID NO: 4.

[0037] Example 2: The primer pair used to identify Xinjiang Ferula assa-foetida includes primer pair Ffe-53 and primer pair Ffe-59. Primer pair Ffe-53 includes Ffe-53_F forward primer and Ffe-53_R reverse primer, and its nucleotide sequence is as follows: Fsi-53_F:5'-GACAGCGGACCAAGACTGATTCG-3', such as SEQ ID NO:2; Fsi-53_R:5'-GCAGCACATCCTTTTCAATCCTCGT-3', such as SEQ ID NO:3; The above SEQ ID NO:2 and SEQ ID NO:3 are used to amplify the specific target sequence Ffe-53 with the nucleotide sequence of SEQ ID NO:1; The primer pair Ffe-59 includes the Ffe-59_F forward primer and the Ffe-59_R reverse primer, and their nucleotide sequences are as follows: Fsi-59_F:5'-GGTTCGGTACTCTTACCAGCATTCTT-3', such as SEQ ID NO:5; Fsi-59_R:5'-CACTCTATGGCAGCATGTCCTACAAC-3', such as SEQ ID NO:6; The above SEQ ID NO:5 and SEQ ID NO:6 are used to amplify the specific target sequence Ffe-59 with the nucleotide sequence of SEQ ID NO:4.

[0038] Example 3: This is used to identify specific crRNA molecules of Xinjiang Ferula asperata. The specific crRNA molecules include specific crRNA molecules Ffe-53 and Ffe-59, and their sequences are as follows: Fsi-53:UAAUUUCUACUAAGUGUAGAUUAACCACUCUUAGGAGUUCCA, such as SEQ ID NO: 7; Fsi-59:UAAUUUCUACUAAGUGUAGUAGCCUUUGCAGGCAUCGGAAG, such as SEQ ID NO:8.

[0039] The above SEQ ID NO:7 is the specific crRNA molecule Ffe-53 used to detect the nucleotide sequence SEQ ID NO:1, and SEQ ID NO:8 is the specific crRNA molecule Ffe-59 used to detect the nucleotide sequence SEQ ID NO:4.

[0040] Example 4: A kit for identifying Xinjiang asafoetida, comprising primer pair Ffe-53 or primer pair Ffe-59 for identifying Xinjiang asafoetida.

[0041] Example 5: As an optimization of the above examples, the kit for identifying Xinjiang Ferula asafoetida also includes PCR reaction reagents and CRISPR-Cas12a system reaction reagents.

[0042] Example 6: As an optimization of the above examples, the PCR reaction reagents include PCR amplification buffer, dNTPs, Taq DNA polymerase, MgCl2, and sterile double-distilled water.

[0043] Example 7: As an optimization of the above examples, the CRISPR-Cas12a system reaction reagents include gene editing buffer, Cas protein, crRNA, nuclease-free water and fluorescent signal molecules; wherein, the crRNA is the specific crRNA molecule Ffe-53 or the specific crRNA molecule Ffe-59 used to identify Xinjiang Ferula.

[0044] Experimental Example 1: Screening of specific target sequences of Ferula assa-foetida from Xinjiang Materials: A total of 25 whole genomes from 5 species of the genus *Ferula* were involved. Among them, *Ferula fukangensis* (… Ferula fukanensis ), stinky asafoetida ( Ferula teterrima ), whole-lobed asafoetida ( Ferula dissecta ) and multi-umbrella asafoetida ( Ferula feruloides Twenty fresh leaf samples from *Ferula assa-foetida* were collected, and DNA extraction, library construction, and Illumina NovaSeq paired-end sequencing were performed by Tianjin Novogene Bioinformatics Technology Co., Ltd. (*Ferula assa-foetida* from Xinjiang) Ferula sinkiangensis The five genome data were derived from unpublished raw sequencing data generated by our team between 2021 and 2023.

[0045] The sequence data has been submitted to the Genome Sequence Archive (GSA) with submission number subCRA062736.

[0046] A species-specific target sequence library was constructed based on whole-genome sequencing data: Jellyfish (v1.1.12) was used with default parameters to cut the sequencing data into 25 bp fragments, and all fragments containing Protospacer Adjacent Motifs (PAMs) (starting with "TTTV" or ending with "VAAA", where V represents A, G, or C) were extracted. Fragments with a frequency below 10 (below 5 for Ferula asperata) were removed. Subsequently, specific target sequences containing all four bases (A, G, C, and T) and without polymer structures were further screened to construct a small-fragment genome library. The target species library fragments were compared with 25 bp fragments containing PAM sequences from other species within the analysis range. 21 bp sequences (excluding PAM sequences) with more than three nucleotide mismatches or insertions / deletions from other species were selected to construct the Ferula asperata specific target sequence library: 2,179 candidate target sequences were output from Ferula asperata.

[0047] Target sequence screening for *Ferula asperata* from Xinjiang: Candidate target sequences were selected from the candidate target sequence library based on frequency (high, medium, low). Specific target sequences were then subjected to BLAST alignment in GenBank, selecting sequences that differed from other species sequences by at least three bases. Two species-specific target sequences, Ffe-53 and Ffe-59, were screened for *Ferula asperata* from Xinjiang. Their nucleotide sequences are as follows: Ffe-53: 5'-TGGAACTCCTAAGAGTGGTTAGAAA-3', as shown in SEQ ID NO:1, its BLAST alignment results are as follows: Figure 1 ; Ffe-59: 5'-CTTCCGATGCCTGCAAAGGCTGAAA-3', as shown in SEQ ID NO:4, its BLAST alignment results are as follows: Figure 2 The specific target sequences Ffe-53 and Ffe-59 met the screening requirements.

[0048] Experimental Example 2: Identification of specific target sequences of the target species in the test sample using Sanger sequencing Experimental objective: To verify that the specific target sequence obtained in Experiment Example 1 is indeed unique to the target species and to ensure its accuracy in actual detection is consistent with the theory, specific primer pairs were designed based on the specific target sequence of Ferula assa-foetida candidate from Xinjiang. Subsequently, PCR amplification was carried out using genomic DNA from the target species sample and several closely related species samples as templates, and the amplification products were detected and compared by agarose gel electrophoresis.

[0049] Experimental materials: A total of 25 samples from 5 species of the genus Ferula, with specific species information as follows: Experimental methods: including DNA extraction, PCR amplification, and Sanger sequencing, as detailed below: (1) DNA extraction Genomic DNA was extracted from Ferula samples using a plant genomics kit.

[0050] (2) PCR amplification Based on the candidate specific target sequences screened in Example 1, the sequences were extended upstream and downstream by 150 bp to design primer pairs. The designed primer pairs were used to perform PCR amplification on all samples to verify specificity. The PCR reaction program was: 95℃ for 5 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 45 s, 35 cycles; 72℃ for 10 min. The PCR reaction system is shown in Table 3.

[0051] (3) Sanger sequencing Sanger bidirectional sequencing was performed on the specific target bands and all visible amplified bands presented in the agarose gel imaging. If the sequencing results completely matched only the specific target sequence of the candidate target species, and there were no amplified bands in other non-target species or the sequencing data of the visible amplified bands differed from the specific target sequence by 3 or more bases, then the candidate specific target sequence was actually valid and could be used as a target sequence for species identification.

[0052] Two specific target sequences and their primer pairs were ultimately selected for Xinjiang asafoetida aspera, as follows: The specific target sequence Fsi-53 and its primer pair are as follows: Fsi-53:5'-TGGAACTCCTAAGAGTGGTTAGAAA-3', such as SEQ ID NO: 1; Fsi-53_F:5'-GACAGCGGACCAAGACTGATTCG-3', such as SEQ ID NO:2; Fsi-53_R: 5'-GCAGCACATCCTTTTCAATCCTCGT-3', such as SEQ ID NO: 3.

[0053] The specific target sequence Fsi-59 and its primer pair are as follows: Fsi-59:5'-CTTCCGATGCCTGCAAAGGCTGAAA-3', such as SEQ ID NO:4; Fsi-59_F:5'-GGTTCGGTACTCTTACCAGCATTCTT-3', such as SEQ ID NO:5; Fsi-59_R: 5'-CACTCTATGGCAGCATGTCCTACAAC-3', such as SEQ ID NO: 6.

[0054] Figure 3 The Sanger sequencing results of specific target sequences Fsi-53 and Fsi-59 from *Ferula assa-foetida* from Xinjiang are shown. Regions that perfectly match the specific target sequences are highlighted in green. Figure 3 It can be seen that the amplified sequence and the screened specific target sequence are completely matched in the target region, confirming the species conservation of the target sequence.

[0055] Experiment Example 3: Precise identification of specific target sequences in Xinjiang Ferula assa-foetida using gene editing technology Experimental materials: The kit includes the following reagents: 5 μL 10×NEBuffer 2.1, 1 μL Cas12a (33 nmol / L), 1.65 μL crRNA (300 nmol / L), 10 μL substrate DNA (sample), 2 μL ssDNA ( / 5'6-FAM / CCCCCCCCCC / 3' BHQ-1, 400 nmol / L) and 30.35 μL sterile double-distilled water.

[0056] The crRNA is either the specific crRNA molecule Ffe-53 or the specific crRNA molecule Ffe-59, and its sequence is as follows: Fsi-53:UAAUUUCUACUAAGUGUAGAUUAACCACUCUUAGGAGUUCCA, such as SEQ ID NO: 7; Fsi-59:UAAUUUCUACUAAGUGUAGUAGCCUUUGCAGGCAUCGGAAG, such as SEQ ID NO: 8; Specifically, SEQ ID NO:7 is used to detect SEQ ID NO:1, and SEQ ID NO:8 is used to detect SEQ ID NO:4.

[0057] Experimental method: First, Cas12a, crRNA and DNA substrate were incubated in 1× NE Buffer at 37℃ for 10 min. Then, ssDNA was added to the incubated mixture. Finally, the fluorescence phenomenon was directly observed using a blue light transilluminator (BG-Vtrans 520s, 196 Baygene Biotech (Beijing) Co., Ltd., China).

[0058] Experimental results: Figure 4 The results of visual fluorescence detection of the species-specific target sequence Fsi-53 of Ferula assa-foetida from Xinjiang are shown. Figure 5 The results of visual fluorescence detection of the species-specific target sequence Fsi-59 of Ferula assa-foetida from Xinjiang are shown. Figures 4 to 5 In the sample, CK was the control, XJ-1 was the Xinjiang Ferula sample, FK-1-5 was the Fukang Ferula sample, C-1 was the stinking Ferula sample, QLY-1-5 was the whole-lobed Ferula sample, and DS-1-5 was the multi-umbellated Ferula sample. Figures 4 to 5 It was observed that only the target species, *Ferula asperata*, exhibited a strong fluorescent signal visible to the naked eye. This indicates that the technical system (based on the primer system constructed from the specific target sequence for identifying *Ferula asperata* of this invention, combined with the Sanger sequencing system and gene editing technology) has high specificity and sensitivity, effectively distinguishing whether the sample to be tested and the species to be identified are identical, and is suitable for the rapid detection and identification of target species.

[0059] In summary, this invention provides a specific target sequence for the accurate identification of *Ferula assa-foetida* from Xinjiang. This sequence was obtained through screening the whole genome data of the *Ferula* genus and its specificity was verified by dual validation using Sanger sequencing and the CRISPR / Cas12a system. This target can effectively distinguish *Ferula assa-foetida* from Xinjiang and its closely related species, achieving accurate species identification of the sample to be tested. The detection system constructed based on the specific target sequence for identifying *Ferula assa-foetida* from Xinjiang in this invention combines high specificity, high sensitivity, and result stability. The operation procedure is simple and can be widely used in the identification of plant tissues, medicinal materials, and related products, providing strong technical support for ensuring the safety of clinical drug use and regulating the market order of *Ferula assa-foetida*.

[0060] The above technical features constitute the embodiments of the present invention, which have strong adaptability and implementation effect. Unnecessary technical features can be added or removed according to actual needs to meet the needs of different situations.

Claims

1. A specific target sequence for identifying Xinjiang asafoetida, characterized in that... It includes specific target sequences Ffe-53 and Ffe-59, with the nucleotide sequence of specific target sequence Ffe-53 as shown in SEQ ID NO:1 and the nucleotide sequence of specific target sequence Ffe-59 as shown in SEQ ID NO:

4.

2. The application of the specific target sequence Ffe-53 or Ffe-59 for identifying Xinjiang Ferula as described in claim 1 as the subject of detection in identifying Xinjiang Ferula or materials derived from Xinjiang Ferula, and in distinguishing Xinjiang Ferula from its closely related species.

3. A primer pair for identifying Xinjiang asafoetida, characterized in that... The primer pair is either primer pair Ffe-53 or primer pair Ffe-59. Primer pair Ffe-53 includes Ffe-53_F forward primer and Ffe-53_R reverse primer. The nucleotide sequence of Ffe-53_F forward primer is shown in SEQ ID NO:2, and the nucleotide sequence of Ffe-53_R reverse primer is shown in SEQ ID NO:

3. SEQ ID NO:2 and SEQ ID NO:3 are used to amplify SEQ ID NO:

1. The primer pair Ffe-59 includes the Ffe-59_F forward primer and the Ffe-59_R reverse primer. The nucleotide sequence of the Ffe-59_F forward primer is shown in SEQ ID NO:5, and the nucleotide sequence of the Ffe-59_R reverse primer is shown in SEQ ID NO:

6. SEQ ID NO:5 and SEQ ID NO:6 are used to amplify SEQ ID NO:

4.

4. A specific crRNA molecule for identifying Xinjiang asafoetida, characterized in that... The specific crRNA molecule is either specific crRNA molecule Ffe-53 or specific crRNA molecule Ffe-59. The nucleotide sequence of specific crRNA molecule Ffe-53 is shown in SEQ ID NO:7, and SEQ ID NO:7 is used to detect SEQ ID NO:

1. The nucleotide sequence of specific crRNA molecule Ffe-59 is shown in SEQ ID NO:8, and SEQ ID NO:8 is used to detect SEQ ID NO:

4.

5. A reagent kit for identifying Xinjiang asafoetida, characterized in that... Includes the primer pair as described in claim 3, wherein the primer pair is primer pair Ffe-53 or primer pair Ffe-59.

6. The reagent kit for identifying Xinjiang Ferula aspera according to claim 5, characterized in that... It also includes PCR reaction reagents and CRISPR-Cas12a system reaction reagents.

7. The reagent kit for identifying Xinjiang Ferula aspera according to claim 6, characterized in that... PCR reaction reagents include PCR amplification buffer, dNTPs, Taq DNA polymerase, MgCl2, and sterile double-distilled water.

8. The reagent kit for identifying Xinjiang asafoetida according to claim 6 or 7, characterized in that... The CRISPR-Cas12a system reaction reagents include gene editing buffer, Cas protein, crRNA, nuclease-free water, and fluorescent signal molecules.

9. The reagent kit for identifying Xinjiang asafoetida according to claim 8, characterized in that... The crRNA is the specific crRNA molecule Ffe-53 or the specific crRNA molecule Ffe-59 as described in claim 4.

10. The use of a kit for identifying *Ferula asperata* according to any one of claims 5 to 9 in identifying *Ferula asperata* or materials derived from *Ferula asperata*, and in distinguishing *Ferula asperata* from its closely related species.

Images