Small interfering rnas targeting lp(a) and uses thereof

Abstract

The present disclosure relates to isolated oligonucleotides comprising a duplex region targeted to human LPA mRNA, and delivery systems, kits, and compositions comprising the same, and methods of using the same to inhibit or downregulate Lp(a) gene expression.

Description

[0001] Related applications

[0002] This application claims priority and benefit from international application PCT / CN2023 / 135082, filed on November 29, 2023, the contents of which are incorporated herein by reference in their entirety. Background Technology

[0003] Lipoprotein(a) (Lp(a)) is a heterogeneous low-density lipoprotein (LDL)-like particle containing a lipid core and apolipoprotein B (apoB-100), and has a unique component, apolipoprotein(a) (apo(a)), which is attached to apoB-100 via disulfide bonds. The LPA gene is primarily expressed in the liver and is limited to expression in humans and non-human primates. Lp(a) levels in humans are genetically determined and do not change significantly with diet, exercise, or other lifestyle modifications.

[0004] Normal Lp(a) levels range from 0.1 to 25 mg / dL, and approximately 25% of the US population has Lp(a) levels of 30 mg / dL or higher. Lp(a) deficiency or loss-of-function mutations can lead to dysregulation and potential overproduction. Analysis of Lp(a) levels in multiple studies has shown that high Lp(a) levels are an independent risk factor for cardiovascular disease, stroke, and other related conditions, including atherosclerotic stenosis. Furthermore, genome-wide association studies have also indicated that LPA is a genetic risk factor for diseases such as atherosclerotic stenosis. Significant reductions in cardiovascular events have been observed when therapeutic lipoprotein apheresis is used to lower Lp(a) and LDL levels in patients with hyperlipidemia. Therefore, there is a need for therapies for subjects suffering from diseases, conditions, and symptoms associated with elevated Lp(a) expression levels. This disclosure provides compositions targeting Lp(a) and methods for reducing Lp(a) expression for treating subjects suffering from diseases, conditions, or symptoms associated with elevated LPA expression levels. Summary of the Invention

[0005] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides located between any of the following nucleotide positions: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944, and the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region.

[0006] This disclosure also provides an isolated oligonucleotide comprising a sense strand selected from SEQ ID NO: 2-22 and 42-295 and its corresponding antisense strand selected from SEQ ID NO: 23-41 and 296-551, as shown in Table 2.

[0007] In some embodiments of the isolated oligonucleotides, the sense strand comprises a modified sequence selected from SEQ ID NO: 2-22 and 42-295, and its corresponding antisense strand is selected from SEQ ID NO: 23-41 and 296-551, as shown in Table 2; the sense strand comprises a modified sequence as shown in SEQ ID NO: 552-845, 1372-1378, 1383-1384, 1386-1387 and 1395-1396, and its corresponding antisense strand comprises a sequence selected from SEQ ID NO: 573-1101, 1379-1380, 1385 and 1388, as shown in Table 6.

[0008] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NO: 2-22, and its corresponding antisense strand comprises a sequence selected from 23-41 and 550-551, as shown in Table 1.

[0009] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NO: 2, 6, 16, 18, 552, 556, 568, 566, 1377-1378, 1383-1384, 1386-1387, and 1395-1396, and its corresponding antisense strand is selected from SEQ ID NO: 575, 585, 587, 1100, 1379-1380, 1385, and 1388, as shown in Table 3.

[0010] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NO: 2, 6, 18, 552, 556 and 568, and its corresponding antisense strand is selected from SEQ ID NO: 575, 587, 1100, 1379-1380 and 1385, as shown in Table 4.

[0011] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NO: 18, 568 and 1383-1384, and its corresponding antisense strand is selected from SEQ ID NO: 587 and 1380, as shown in Table 5.

[0012] In some embodiments of the isolated oligonucleotide, the sense strand comprises the sequence shown in SEQ ID NO: 18, and its corresponding antisense strand comprises the sequence shown in SEQ ID NO: 37.

[0013] In some embodiments of the isolated oligonucleotide, the sense strand comprises a modified sequence as shown in SEQ ID NO: 568, and its corresponding antisense strand comprises a modified sequence as shown in SEQ ID NO: 587.

[0014] In some embodiments of the isolated oligonucleotide, the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 2 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 550; ii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 3 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 551; iii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 4 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 23; iv) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 5 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 24; v) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 6 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 25; vi) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 7 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 26; vii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 8 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 25. viii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 9 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 28; ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 29; x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 30; xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 31; xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 32; xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 33; xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 16. xv) The sense strand of the nucleic acid sequence of SEQ ID NO: 16 and the sense strand of the nucleic acid sequence of SEQ ID NO: 35; xvi) The antisense strand of the nucleic acid sequence of SEQ ID NO: 17 and the sense strand of the nucleic acid sequence of SEQ ID NO: 36; xvii) The antisense strand of the nucleic acid sequence of SEQ ID NO: 18 and the sense strand of the nucleic acid sequence of SEQ ID NO: 37; xviii) The antisense strand of the nucleic acid sequence of SEQ ID NO: 19 and the sense strand of the nucleic acid sequence of SEQ ID NO: 38;xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 and the sense strand according to SEQ ID NO: 39; xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 and the sense strand according to SEQ ID NO: 40; xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 and the sense strand according to SEQ ID NO: 41; xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 42 and the sense strand according to SEQ ID NO: 296; xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 43 and the sense strand according to SEQ ID NO: 297; xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 and the sense strand according to SEQ ID NO: 298; xxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 45 and the sense strand according to SEQ ID NO: 296. 299 sense strand; xxvi) sense strands according to SEQ ID NO: 46 antisense strands and SEQ ID NO: 300 sense strands; xxvii) sense strands according to SEQ ID NO: 47 antisense strands and SEQ ID NO: 301 sense strands; xxviii) sense strands according to SEQ ID NO: 48 antisense strands and SEQ ID NO: 302 sense strands; xxix) sense strands according to SEQ ID NO: 49 antisense strands and SEQ ID NO: 303 sense strands; xxx) sense strands according to SEQ ID NO: 50 antisense strands and SEQ ID NO: 304 sense strands; xxxi) sense strands according to SEQ ID NO: 51 antisense strands and SEQ ID NO: 305 sense strands; xxxii) sense strands according to SEQ ID NO: xxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 52 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 306; xxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 53 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 307; xxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 54 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 308; xxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 309;xxxvi) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 56 and sense strand based on the nucleic acid sequence of SEQ ID NO: 310; xxxvii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 57 and sense strand based on the nucleic acid sequence of SEQ ID NO: 311; xxxviii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 58 and sense strand based on the nucleic acid sequence of SEQ ID NO: 312; xxxix) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 59 and sense strand based on the nucleic acid sequence of SEQ ID NO: 313; xl) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 60 and sense strand based on the nucleic acid sequence of SEQ ID NO: 314; xli) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 61 and sense strand based on the nucleic acid sequence of SEQ ID NO: 315; xlii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 62 and sense strand based on the nucleic acid sequence of SEQ ID NO: 315. The sense strand of the nucleic acid sequence NO: 316; xliii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 63 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 317; xliv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 64 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 318; xlv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 65 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 319; xlvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 66 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 320; xlvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 67 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 321; xlviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 68 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 322; xlix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 316; xliii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 316; xliiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 322; xlix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 316; xliii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 317; xliiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 318; xliiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 319 ... The antisense strand of the nucleic acid sequence 69 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 323; l) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 70 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 324; li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 71 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 325; lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 72 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 326;liii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 and the sense strand according to SEQ ID NO: 327; liv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 and the sense strand according to SEQ ID NO: 328; lv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 and the sense strand according to SEQ ID NO: 329; lvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 76 and the sense strand according to SEQ ID NO: 330; lvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 77 and the sense strand according to SEQ ID NO: 331; lviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 and the sense strand according to SEQ ID NO: 332; lix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 and the sense strand according to SEQ ID NO: 327. The sense strand of SEQ ID NO: 333; lx) the antisense strand of SEQ ID NO: 80 and the sense strand of SEQ ID NO: 334; lxi) the antisense strand of SEQ ID NO: 81 and the sense strand of SEQ ID NO: 335; lxii) the antisense strand of SEQ ID NO: 82 and the sense strand of SEQ ID NO: 336; lxiii) the antisense strand of SEQ ID NO: 83 and the sense strand of SEQ ID NO: 337; lxiv) the antisense strand of SEQ ID NO: 84 and the sense strand of SEQ ID NO: 338; lxv) the antisense strand of SEQ ID NO: 85 and the sense strand of SEQ ID NO: 339; lxvi) the sense strand of SEQ ID NO: 339 and the sense strand of SEQ ID NO: 339. The antisense strand of the nucleic acid sequence of SEQ ID NO: 86 and the sense strand of the nucleic acid sequence of SEQ ID NO: 340; lxvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 87 and the sense strand of the nucleic acid sequence of SEQ ID NO: 341; lxviii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 88 and the sense strand of the nucleic acid sequence of SEQ ID NO: 342; lxix) the antisense strand of the nucleic acid sequence of SEQ ID NO: 89 and the sense strand of the nucleic acid sequence of SEQ ID NO: 343;lxx) Antisense strand of SEQ ID NO: 90 and sense strand of SEQ ID NO: 344; lxxi) Antisense strand of SEQ ID NO: 91 and sense strand of SEQ ID NO: 345; lxxii) Antisense strand of SEQ ID NO: 92 and sense strand of SEQ ID NO: 346; lxxiii) Antisense strand of SEQ ID NO: 93 and sense strand of SEQ ID NO: 347; lxxiv) Antisense strand of SEQ ID NO: 94 and sense strand of SEQ ID NO: 348; lxxv) Antisense strand of SEQ ID NO: 95 and sense strand of SEQ ID NO: 349; lxxvi) Antisense strand of SEQ ID NO: 96 and sense strand of SEQ ID NO: 349. The sense strand of the nucleic acid sequence SEQ ID NO: 350; lxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 97 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351; lxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 352; lxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 99 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 353; lxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 100 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354; lxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 355; lxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 356; lxxxiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 356. The antisense strand of the nucleic acid sequence NO: 103 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357; lxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 358; lxxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 105 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359; lxxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 106 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 360;lxxxvii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 and sense strand of the nucleic acid sequence according to SEQ ID NO: 361; lxxxviii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 and sense strand of the nucleic acid sequence according to SEQ ID NO: 362; lxxxix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 and sense strand of the nucleic acid sequence according to SEQ ID NO: 363; xc) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 and sense strand of the nucleic acid sequence according to SEQ ID NO: 364; xci) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 111 and sense strand of the nucleic acid sequence according to SEQ ID NO: 365; xcii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 and sense strand of the nucleic acid sequence according to SEQ ID NO: 366; xciii) According to SEQ ID NO: xcv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 367; xcv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 368; xcv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 369; xcvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 370; xcvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 371; xcviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 372; xcix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 and the sense strand according to SEQ ID NO: 367. c) the sense strand of the nucleic acid sequence of SEQ ID NO: 373; c) the antisense strand of the nucleic acid sequence of SEQ ID NO: 120 and the sense strand of the nucleic acid sequence of SEQ ID NO: 374; c) the antisense strand of the nucleic acid sequence of SEQ ID NO: 121 and the sense strand of the nucleic acid sequence of SEQ ID NO: 375; cii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 122 and the sense strand of the nucleic acid sequence of SEQ ID NO: 376; ciii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 123 and the sense strand of the nucleic acid sequence of SEQ ID NO: 377;civ) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 378; cv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 379; cvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 380; cvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 381; cviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 382; cix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 and the sense strand according to SEQ ID NO: 383; cx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 and the sense strand according to SEQ ID NO: 383. cxi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 384; cxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385; cxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386; cxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387; cxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388; cxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389; cxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 136 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389. The sense strand of the nucleic acid sequence SEQ ID NO: 390; cxvii) the antisense strand of the nucleic acid sequence SEQ ID NO: 137 and the sense strand of the nucleic acid sequence SEQ ID NO: 391; cxviii) the antisense strand of the nucleic acid sequence SEQ ID NO: 138 and the sense strand of the nucleic acid sequence SEQ ID NO: 392; cxix) the antisense strand of the nucleic acid sequence SEQ ID NO: 139 and the sense strand of the nucleic acid sequence SEQ ID NO: 393; cxx) the antisense strand of the nucleic acid sequence SEQ ID NO: 140 and the sense strand of the nucleic acid sequence SEQ ID NO: 394;cxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 and the sense strand according to SEQ ID NO: 395; cxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 and the sense strand according to SEQ ID NO: 396; cxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 and the sense strand according to SEQ ID NO: 397; cxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 and the sense strand according to SEQ ID NO: 398; cxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 and the sense strand according to SEQ ID NO: 399; cxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 and the sense strand according to SEQ ID NO: 400; cxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 and the sense strand according to SEQ ID NO: 400; The antisense strand of the nucleic acid sequence SEQ ID NO: 147 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 401; cxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 402; cxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 403; cxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 404; cxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 405; cxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 152 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 406; cxxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 406. The sense strand of the nucleic acid sequence 407; cxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 408; cxxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 409; cxxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 410;cxxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 411; cxxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 412; cxxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 413; cxl) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 414; cxli) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 415; cxlii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 416; cxliii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 416; The antisense strand of the nucleic acid sequence SEQ ID NO: 163 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 417; cxliv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 418; cxlv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 419; cxlvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 420; cxlvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 421; cxlviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 422; cxlix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 421. The sense strand of the nucleic acid sequence NO: 423; cl) the antisense strand of the nucleic acid sequence of SEQ ID NO: 170 and the sense strand of the nucleic acid sequence of SEQ ID NO: 424; cli) the antisense strand of the nucleic acid sequence of SEQ ID NO: 171 and the sense strand of the nucleic acid sequence of SEQ ID NO: 425; clii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 172 and the sense strand of the nucleic acid sequence of SEQ ID NO: 426; cliii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 173 and the sense strand of the nucleic acid sequence of SEQ ID NO: 427;cliv) antisense strand according to the nucleic acid sequence of SEQ ID NO: 174 and sense strand according to the nucleic acid sequence of SEQ ID NO: 428; clv) antisense strand according to the nucleic acid sequence of SEQ ID NO: 175 and sense strand according to the nucleic acid sequence of SEQ ID NO: 429; clvi) antisense strand according to the nucleic acid sequence of SEQ ID NO: 176 and sense strand according to the nucleic acid sequence of SEQ ID NO: 430; clvii) antisense strand according to the nucleic acid sequence of SEQ ID NO: 177 and sense strand according to the nucleic acid sequence of SEQ ID NO: 431; clviii) antisense strand according to the nucleic acid sequence of SEQ ID NO: 178 and sense strand according to the nucleic acid sequence of SEQ ID NO: 432; clix) antisense strand according to the nucleic acid sequence of SEQ ID NO: 179 and sense strand according to the nucleic acid sequence of SEQ ID NO: 433; clx) according to the nucleic acid sequence of SEQ ID NO: 179 and sense strand according to the nucleic acid sequence of SEQ ID NO: 433; clxi) antisense strand of SEQ ID NO: 180 and sense strand of SEQ ID NO: 434; clxi) antisense strand of SEQ ID NO: 181 and sense strand of SEQ ID NO: 435; clxii) antisense strand of SEQ ID NO: 182 and sense strand of SEQ ID NO: 436; clxiii) antisense strand of SEQ ID NO: 183 and sense strand of SEQ ID NO: 437; clxiv) antisense strand of SEQ ID NO: 184 and sense strand of SEQ ID NO: 438; clxv) antisense strand of SEQ ID NO: 185 and sense strand of SEQ ID NO: 439; clxvi) antisense strand of SEQ ID NO: 186 and sense strand of SEQ ID NO: 439. clxvii) sense strand of the nucleic acid sequence according to SEQ ID NO: 187 and sense strand of the nucleic acid sequence according to SEQ ID NO: 441; clxviii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 188 and sense strand of the nucleic acid sequence according to SEQ ID NO: 442; clxix) antisense strand of the nucleic acid sequence according to SEQ ID NO: 189 and sense strand of the nucleic acid sequence according to SEQ ID NO: 443; clxx) antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 and sense strand of the nucleic acid sequence according to SEQ ID NO: 444;clxxi) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 and sense strand of the nucleic acid sequence according to SEQ ID NO: 445; clxxii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 192 and sense strand of the nucleic acid sequence according to SEQ ID NO: 446; clxxiii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 193 and sense strand of the nucleic acid sequence according to SEQ ID NO: 447; clxxiv) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 and sense strand of the nucleic acid sequence according to SEQ ID NO: 448; clxxv) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 and sense strand of the nucleic acid sequence according to SEQ ID NO: 449; clxxvi) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 and sense strand of the nucleic acid sequence according to SEQ ID NO: 450; clxxvii) According to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 197 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 451; clxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 198 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 452; clxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 199 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 453; clxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 454; clxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 455; clxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 202 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 456; clxxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 203 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 454. clxxxiv) sense strand of the nucleic acid sequence according to SEQ ID NO: 457; clxxxv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 204 and sense strand of the nucleic acid sequence according to SEQ ID NO: 458; clxxxv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 205 and sense strand of the nucleic acid sequence according to SEQ ID NO: 459; clxxxvi) antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 and sense strand of the nucleic acid sequence according to SEQ ID NO: 460;clxxxvii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 207 and sense strand of the nucleic acid sequence according to SEQ ID NO: 461; clxxxviii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 and sense strand of the nucleic acid sequence according to SEQ ID NO: 462; clxxxix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 209 and sense strand of the nucleic acid sequence according to SEQ ID NO: 463; cxc) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 and sense strand of the nucleic acid sequence according to SEQ ID NO: 464; cxci) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 and sense strand of the nucleic acid sequence according to SEQ ID NO: 465; cxcii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 and sense strand of the nucleic acid sequence according to SEQ ID NO: 466; cxciii) According to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 213 and the sense strand according to the nucleic acid sequence SEQ ID NO: 467; cxciv) the antisense strand of the nucleic acid sequence SEQ ID NO: 214 and the sense strand according to the nucleic acid sequence SEQ ID NO: 468; cxcv) the antisense strand of the nucleic acid sequence SEQ ID NO: 215 and the sense strand according to the nucleic acid sequence SEQ ID NO: 469; cxcvi) the antisense strand of the nucleic acid sequence SEQ ID NO: 216 and the sense strand according to the nucleic acid sequence SEQ ID NO: 470; cxcvii) the antisense strand of the nucleic acid sequence SEQ ID NO: 217 and the sense strand according to the nucleic acid sequence SEQ ID NO: 471; cxcviii) the antisense strand of the nucleic acid sequence SEQ ID NO: 218 and the sense strand according to the nucleic acid sequence SEQ ID NO: 472; cxcix) the antisense strand of the nucleic acid sequence SEQ ID NO: 213 and the sense strand according to the nucleic acid sequence SEQ ID NO: 472; The antisense strand of the nucleic acid sequence SEQ ID NO: 219 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 473; cc) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 474; cci) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 221 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 475; ccii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 222 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 476; cciii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 477;cciv) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 224 and sense strand of the nucleic acid sequence according to SEQ ID NO: 478; ccv) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 225 and sense strand of the nucleic acid sequence according to SEQ ID NO: 479; ccvi) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 and sense strand of the nucleic acid sequence according to SEQ ID NO: 480; ccvii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 227 and sense strand of the nucleic acid sequence according to SEQ ID NO: 481; ccviii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 228 and sense strand of the nucleic acid sequence according to SEQ ID NO: 482; ccix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 229 and sense strand of the nucleic acid sequence according to SEQ ID NO: 483; ccx) According to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 230 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 484; ccxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 231 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 485; ccxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 232 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 486; ccxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 233 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 487; ccxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 234 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 488; ccxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 235 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 489; ccxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 236 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 489. The sense strand of the nucleic acid sequence according to SEQ ID NO: 490; ccxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 237 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 491; ccxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 238 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 492; ccxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 239 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 493; ccxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 240 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 494;ccxxi) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 241 and sense strand based on the nucleic acid sequence of SEQ ID NO: 495; ccxxii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 242 and sense strand based on the nucleic acid sequence of SEQ ID NO: 496; ccxxiii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 243 and sense strand based on the nucleic acid sequence of SEQ ID NO: 497; ccxxiv) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 244 and sense strand based on the nucleic acid sequence of SEQ ID NO: 498; ccxxv) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 245 and sense strand based on the nucleic acid sequence of SEQ ID NO: 499; ccxxvi) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 246 and sense strand based on the nucleic acid sequence of SEQ ID NO: 500; ccxxvii) Based on the nucleic acid sequence of SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 247 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 501; ccxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 248 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 502; ccxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 249 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 503; ccxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 250 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 504; ccxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 251 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 505; ccxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 252 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 506; ccxxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 253 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 504. The sense strand of the nucleic acid sequence according to SEQ ID NO: 507; ccxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 254 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 508; ccxxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 255 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 509; ccxxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 256 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 510;ccxxxvii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 257 and sense strand of the nucleic acid sequence according to SEQ ID NO: 511; ccxxxviii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 258 and sense strand of the nucleic acid sequence according to SEQ ID NO: 512; ccxxxix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 259 and sense strand of the nucleic acid sequence according to SEQ ID NO: 513; ccxl) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 260 and sense strand of the nucleic acid sequence according to SEQ ID NO: 514; ccxli) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 261 and sense strand of the nucleic acid sequence according to SEQ ID NO: 515; ccxlii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 262 and sense strand of the nucleic acid sequence according to SEQ ID NO: 516; ccxliii) According to SEQ ID The antisense strand of the nucleic acid sequence NO: 263 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 517; ccxliv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 264 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 518; ccxlv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 265 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 519; ccxlvi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 266 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 520; ccxlvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 267 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 521; ccxlviii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 268 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 522; ccxlix) according to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 269 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 523; ccl) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 270 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 524; ccli) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 271 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 525; cclii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 272 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 526;ccliii) antisense strand according to the nucleic acid sequence of SEQ ID NO: 273 and sense strand according to the nucleic acid sequence of SEQ ID NO: 527; ccliv) antisense strand according to the nucleic acid sequence of SEQ ID NO: 274 and sense strand according to the nucleic acid sequence of SEQ ID NO: 528; cclv) antisense strand according to the nucleic acid sequence of SEQ ID NO: 275 and sense strand according to the nucleic acid sequence of SEQ ID NO: 529; cclvi) antisense strand according to the nucleic acid sequence of SEQ ID NO: 276 and sense strand according to the nucleic acid sequence of SEQ ID NO: 530; cclvii) antisense strand according to the nucleic acid sequence of SEQ ID NO: 277 and sense strand according to the nucleic acid sequence of SEQ ID NO: 531; cclviii) antisense strand according to the nucleic acid sequence of SEQ ID NO: 278 and sense strand according to the nucleic acid sequence of SEQ ID NO: 532; cclix) according to the nucleic acid sequence of SEQ ID NO: 273 and sense strand according to the nucleic acid sequence of SEQ ID NO: 532; The antisense strand of the nucleic acid sequence SEQ ID NO: 279 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 533; cclx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 280 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 534; cclxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 281 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 535; cclxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 282 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 536; cclxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 283 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 537; cclxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 284 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 538; cclxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 285 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 537. The sense strand of the nucleic acid sequence NO: 539; cclxvi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 286 and the sense strand of the nucleic acid sequence of SEQ ID NO: 540; cclxvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 287 and the sense strand of the nucleic acid sequence of SEQ ID NO: 541; cclxviii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 288 and the sense strand of the nucleic acid sequence of SEQ ID NO: 542;cclxix) antisense strand based on the nucleic acid sequence of SEQ ID NO: 289 and sense strand based on the nucleic acid sequence of SEQ ID NO: 543; cclxx) antisense strand based on the nucleic acid sequence of SEQ ID NO: 290 and sense strand based on the nucleic acid sequence of SEQ ID NO: 544; cclxxi) antisense strand based on the nucleic acid sequence of SEQ ID NO: 291 and sense strand based on the nucleic acid sequence of SEQ ID NO: 545; cclxxii) antisense strand based on the nucleic acid sequence of SEQ ID NO: 292 and sense strand based on the nucleic acid sequence of SEQ ID NO: 546; cclxxiii) antisense strand based on the nucleic acid sequence of SEQ ID NO: 293 and sense strand based on the nucleic acid sequence of SEQ ID NO: 547; cclxxiv) antisense strand based on the nucleic acid sequence of SEQ ID NO: 294 and sense strand based on the nucleic acid sequence of SEQ ID NO: 548; or cclxxv) based on the nucleic acid sequence of SEQ ID NO: The antisense strand of SEQ ID NO: 295 and the sense strand of SEQ ID NO: 549.

[0015] In some embodiments of the isolated oligonucleotide, the sense strand comprises at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical nucleotide sequences to a region comprising 19-25 nucleotides located between any of the following nucleotide positions: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944.

[0016] In some embodiments of the isolated oligonucleotide, the sense strand comprises the same nucleotide sequence as the region of 19-25 nucleotides located between any of the following nucleotide positions: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944.

[0017] In some embodiments of the isolated oligonucleotide, the sense strand comprises a nucleotide sequence substantially identical to the region located between any of the following nucleotide positions: a) 151 to 172, b) 248 to 269, c) 2947 to 2968, d) 2991 to 3012, e) 3463 to 3484, and f) 3931 to 3952, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0018] In some embodiments of the isolated oligonucleotide, the sense strand comprises at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical nucleotide sequences to the region located between any of the following nucleotide positions: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0019] In some embodiments of the isolated oligonucleotide, the sense strand comprises the same nucleotide sequence as the region located between any of the following nucleotide positions: a) 151 to 172, b) 248 to 269, c) 2947 to 2968, d) 2991 to 3012, e) 3463 to 3484, and f) 3931 to 3952, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0020] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence substantially identical to the region comprising a sequence selected from any of the following nucleotide positions: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0021] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to the region comprising a sequence selected from any of the following nucleotide positions: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0022] In some embodiments of the isolated oligonucleotide, the sense strand comprises the same sequence as the region comprising a sequence selected between any of the following nucleotide positions: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0023] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence substantially identical to the region comprising the sequence from nucleotide positions 156 to 177, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0024] In some embodiments of the isolated oligonucleotide, the sense strand comprises at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of the same sequence as the region comprising the sequence from nucleotide positions 156 to 177, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0025] In some embodiments of the isolated oligonucleotide, the sense strand comprises the same sequence as the region comprising the sequence from nucleotide positions 156 to 177, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0026] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide is able to induce the degradation of human LPA mRNA.

[0027] In some implementations of the isolated oligonucleotide, the sense strand is a single-stranded RNA molecule, the antisense strand is a single-stranded molecule, or both the sense strand and the antisense strand are single-stranded RNA molecules.

[0028] In some embodiments of the isolated oligonucleotide, the antisense strand includes a 3' overhang. In some embodiments of the isolated oligonucleotide, the 3' overhang includes at least one nucleotide. In some embodiments of the isolated oligonucleotide, the 3' overhang includes two nucleotides. In some embodiments of the isolated oligonucleotide, the 3' overhang includes any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cysteine-cysteine ​​(CC), guanine-guanine (GG), or uracil-uracil (UU).

[0029] In some embodiments of the isolated oligonucleotide, the sense strand comprises an RNA sequence of at least 20 nucleotides in length.

[0030] In some embodiments of the isolated oligonucleotide, the antisense strand comprises an RNA sequence of at least 22 nucleotides in length.

[0031] In some embodiments of the isolated oligonucleotide, the length of the double-stranded region is between 19 and 21 nucleotides. In some embodiments of the isolated oligonucleotide, the length of the double-stranded region is 20 nucleotides.

[0032] In some embodiments of the isolated oligonucleotide, the antisense strand comprises a nucleotide sequence according to any of the following: SEQ ID NO: 2-11 and 13-22. In some embodiments of the isolated oligonucleotide, the sense strand comprises a nucleotide sequence according to any of the following: SEQ ID NO: 21-30, 32-41, 550, and 551.

[0033] In some embodiments of the isolated oligonucleotide, the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 2 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 550; ii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 3 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 551; iii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 4 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 23; iv) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 5 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 24; v) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 6 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 25; or vi) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 7 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 26.In some embodiments of the isolated oligonucleotide, the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 8 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 27; ii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 9 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 28; iii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 10 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 29; iv) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 11 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 30; v) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 21 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 40; vi) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 13 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 32; vii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 14 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 29. The sense strand of the nucleic acid sequence of SEQ ID NO: 33; viii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 15 and the sense strand of the nucleic acid sequence of SEQ ID NO: 34; ix) the antisense strand of the nucleic acid sequence of SEQ ID NO: 16 and the sense strand of the nucleic acid sequence of SEQ ID NO: 35; x) the antisense strand of the nucleic acid sequence of SEQ ID NO: 17 and the sense strand of the nucleic acid sequence of SEQ ID NO: 36; xi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 18 and the sense strand of the nucleic acid sequence of SEQ ID NO: 37; xii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 19 and the sense strand of the nucleic acid sequence of SEQ ID NO: 38; xiii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 20 and the sense strand of the nucleic acid sequence of SEQ ID NO: 39; or xiv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 22 and the sense strand of the nucleic acid sequence of SEQ ID NO: 39. The sense strand of the nucleic acid sequence 41.

[0034] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide at a dose of 10 nM attenuates the expression of human LPAmRNA by at least 50%. In some embodiments of the isolated oligonucleotide, the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 8 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 27; ii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 9 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 28; iii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 10 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 29; iv) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 11 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 30; v) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 2 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 550; vi) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 7 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 26; vii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 13 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 27. SEQ ID NO: 32 sense strand; viii) antisense strand of SEQ ID NO: 3 and sense strand of SEQ ID NO: 551 sense strand; ix) antisense strand of SEQ ID NO: 14 and sense strand of SEQ ID NO: 33 sense strand; x) antisense strand of SEQ ID NO: 22 and sense strand of SEQ ID NO: 41 sense strand; xi) antisense strand of SEQ ID NO: 4 and sense strand of SEQ ID NO: 23 sense strand; xii) antisense strand of SEQ ID NO: 5 and sense strand of SEQ ID NO: 24 sense strand; xiii) antisense strand of SEQ ID NO: 15 and sense strand of SEQ ID NO: 34 sense strand; xiv) antisense strand of SEQ ID NO: 16 and sense strand of SEQ ID NO: 551 sense strand; xiv) antisense strand of SEQ ID NO: 16 and sense strand of SEQ ID NO: 551 sense strand; xii) antisense strand of SEQ ID NO: 14 and sense strand of SEQ ID NO: 33 sense strand; xii) antisense strand of SEQ ID NO: 15 and sense strand of SEQ ID NO: 34 sense strand; xiv) antisense strand of SEQ ID NO: 16 and sense strand of SEQ ID NO: 15 and sense strand of SEQ ID NO: 16 sense strand; xiv) antisense strand of SEQ ID NO: 16 and sense ... xv) the sense strand of the nucleic acid sequence of SEQ ID NO: 17 and the sense strand of the nucleic acid sequence of SEQ ID NO: 36; xvi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 18 and the sense strand of the nucleic acid sequence of SEQ ID NO: 37; xvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 6 and the sense strand of the nucleic acid sequence of SEQ ID NO: 25;xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 38; xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 39; or xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 40.

[0035] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide at a dose of 1.0 nM attenuates the expression of human LPAmRNA by 20% to 50%. In some embodiments of the isolated oligonucleotide, the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 2 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 550; ii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 13 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 32; iii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 5 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 24; iv) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 6 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 25; v) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 22 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 41; vi) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 9 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 28; vii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 7 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 28. The sense strands of the nucleic acid sequence SEQ ID NO: 26; viii) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 4 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 23; ix) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 20 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 39; x) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 3 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 551; xi) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 14 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 33; xii) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 11 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 30; xiii) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 10 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 29; or xiv) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 17 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 29. The sense strand of the nucleic acid sequence 36.

[0036] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide attenuates the expression of human LPAmRNA by at least 50% at a dose of 1.0 nM. In some embodiments of the isolated oligonucleotide, the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 8 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 27.

[0037] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides located between any of the following nucleotide positions: a) 124 to 176; b) 188 to 233; c) 415 to 436; d) 439 to 464; e) 2683 to 2724; f) 2731 to 2780; g) 2839 to 2860; h) 2927 to 2973; i) 2992 to 3015; j) 3023 to 3063; k) 3224 to 3245; l) 3272 to 3302; m) 3319 to 3340; n) 3347 to 3424; o) 3455 to 3485; p) 3518 to 3603; q) 3633 to 3683; r) 3689 to 3710; s) 3761 to 3814; t) 3899 to 3928; u) 3929 to 3964; v) 3991 to 4016; w) 4051 to 4072; x) 4079 to 4108; y) 4179 to 4204; z) 4526 to 4548; and aa) 4922 to 4996, and the antisense chain is largely complementary to the sense chain, so that the sense chain and the antisense chain together form a bisense region.

[0038] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide at a dose of 10 nM attenuates the expression of human LPAmRNA by 20% to 50%. In some embodiments of the isolated oligonucleotide, the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 70 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 324; ii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 71 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 325; iii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 72 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 326; iv) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 73 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 327; v) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 74 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 328; vi) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 75 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 329; vii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 76 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 329. The sense strand of SEQ ID NO: 330; viii) the antisense strand of SEQ ID NO: 77 and the sense strand of SEQ ID NO: 331; ix) the antisense strand of SEQ ID NO: 78 and the sense strand of SEQ ID NO: 332; x) the antisense strand of SEQ ID NO: 79 and the sense strand of SEQ ID NO: 333; xi) the antisense strand of SEQ ID NO: 80 and the sense strand of SEQ ID NO: 334; xii) the antisense strand of SEQ ID NO: 81 and the sense strand of SEQ ID NO: 335; xiii) the antisense strand of SEQ ID NO: 82 and the sense strand of SEQ ID NO: 336; xiv) the sense strand of SEQ ID NO: 336; xv) The antisense strand of the nucleic acid sequence of SEQ ID NO: 83 and the sense strand of the nucleic acid sequence of SEQ ID NO: 337; xv) The antisense strand of the nucleic acid sequence of SEQ ID NO: 84 and the sense strand of the nucleic acid sequence of SEQ ID NO: 338; xvi) The antisense strand of the nucleic acid sequence of SEQ ID NO: 85 and the sense strand of the nucleic acid sequence of SEQ ID NO: 339; xvii) The antisense strand of the nucleic acid sequence of SEQ ID NO: 86 and the sense strand of the nucleic acid sequence of SEQ ID NO: 340;xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 87 and the sense strand according to SEQ ID NO: 341; xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 88 and the sense strand according to SEQ ID NO: 342; xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 and the sense strand according to SEQ ID NO: 343; xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 90 and the sense strand according to SEQ ID NO: 344; xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 91 and the sense strand according to SEQ ID NO: 345; xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 92 and the sense strand according to SEQ ID NO: 346; xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 and the sense strand according to SEQ ID NO: 346. xxv) sense strands of the nucleic acid sequence of SEQ ID NO: 94 and sense strands of the nucleic acid sequence of SEQ ID NO: 348; xxvi) antisense strands of the nucleic acid sequence of SEQ ID NO: 95 and sense strands of the nucleic acid sequence of SEQ ID NO: 349; xxvii) antisense strands of the nucleic acid sequence of SEQ ID NO: 96 and sense strands of the nucleic acid sequence of SEQ ID NO: 350; xxviii) antisense strands of the nucleic acid sequence of SEQ ID NO: 97 and sense strands of the nucleic acid sequence of SEQ ID NO: 351; xxix) antisense strands of the nucleic acid sequence of SEQ ID NO: 98 and sense strands of the nucleic acid sequence of SEQ ID NO: 352; xxx) antisense strands of the nucleic acid sequence of SEQ ID NO: 99 and sense strands of the nucleic acid sequence of SEQ ID NO: 353; xxxi) sense strands of the nucleic acid sequence of SEQ ID NO: 99 and sense strands of the nucleic acid sequence of SEQ ID NO: 353; The antisense strand of the nucleic acid sequence SEQ ID NO: 100 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354; xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 355; xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 356; xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 103 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357;xxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 and the sense strand according to SEQ ID NO: 358; xxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 105 and the sense strand according to SEQ ID NO: 359; xxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 106 and the sense strand according to SEQ ID NO: 360; xxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 and the sense strand according to SEQ ID NO: 361; xxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 and the sense strand according to SEQ ID NO: 362; xl) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 and the sense strand according to SEQ ID NO: 363; xli) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 and the sense strand according to SEQ ID NO: 358; The antisense strand of the nucleic acid sequence of SEQ ID NO: 110 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 364; xlii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 111 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365; xliii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 112 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 366; xliv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 113 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 367; xlv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 114 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368; xlvi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 115 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369; xlvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 116 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369. The sense strand of the nucleic acid sequence 370; xlviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371; xlix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 372; l) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373; li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 374;lii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 and sense strand of the nucleic acid sequence according to SEQ ID NO: 375; liii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 and sense strand of the nucleic acid sequence according to SEQ ID NO: 376; liv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 and sense strand of the nucleic acid sequence according to SEQ ID NO: 377; lv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 and sense strand of the nucleic acid sequence according to SEQ ID NO: 378; lvi) antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 and sense strand of the nucleic acid sequence according to SEQ ID NO: 379; lvii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 and sense strand of the nucleic acid sequence according to SEQ ID NO: 380; lviii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 and sense strand of the nucleic acid sequence according to SEQ ID NO: 128. sense strands of the nucleic acid sequence of SEQ ID NO: 381; lx) antisense strands of the nucleic acid sequence of SEQ ID NO: 128 and sense strands of the nucleic acid sequence of SEQ ID NO: 382; lx) antisense strands of the nucleic acid sequence of SEQ ID NO: 383 and sense strands of the nucleic acid sequence of SEQ ID NO: 383; lxi) antisense strands of the nucleic acid sequence of SEQ ID NO: 130 and sense strands of the nucleic acid sequence of SEQ ID NO: 384; lxii) antisense strands of the nucleic acid sequence of SEQ ID NO: 131 and sense strands of the nucleic acid sequence of SEQ ID NO: 385; lxiii) antisense strands of the nucleic acid sequence of SEQ ID NO: 132 and sense strands of the nucleic acid sequence of SEQ ID NO: 386; lxiv) antisense strands of the nucleic acid sequence of SEQ ID NO: 133 and sense strands of the nucleic acid sequence of SEQ ID NO: 387; lxv) according to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 134 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388; lxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389; lxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 136 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 390; lxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391;lxix) antisense strand based on the nucleic acid sequence of SEQ ID NO: 138 and sense strand based on the nucleic acid sequence of SEQ ID NO: 392; lxx) antisense strand based on the nucleic acid sequence of SEQ ID NO: 139 and sense strand based on the nucleic acid sequence of SEQ ID NO: 393; lxxi) antisense strand based on the nucleic acid sequence of SEQ ID NO: 140 and sense strand based on the nucleic acid sequence of SEQ ID NO: 394; lxxii) antisense strand based on the nucleic acid sequence of SEQ ID NO: 141 and sense strand based on the nucleic acid sequence of SEQ ID NO: 395; lxxiii) antisense strand based on the nucleic acid sequence of SEQ ID NO: 142 and sense strand based on the nucleic acid sequence of SEQ ID NO: 396; lxxiv) antisense strand based on the nucleic acid sequence of SEQ ID NO: 143 and sense strand based on the nucleic acid sequence of SEQ ID NO: 397; lxxv) based on the nucleic acid sequence of SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 144 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 398; lxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 399; lxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 400; lxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 147 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 401; lxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 402; or lxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 403.

[0039] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide at a dose of 10 nM attenuates the expression of human LPAmRNA by at least 50%. In some embodiments of the isolated oligonucleotide, the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 42 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 296; ii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 43 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 297; iii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 44 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 298; iv) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 45 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 299; v) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 46 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 300; vi) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 48 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 302; vii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 50 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 296. The sense strand of SEQ ID NO: 304; viii) the antisense strand of SEQ ID NO: 52 and the sense strand of SEQ ID NO: 306; ix) the antisense strand of SEQ ID NO: 56 and the sense strand of SEQ ID NO: 310; x) the antisense strand of SEQ ID NO: 57 and the sense strand of SEQ ID NO: 311; xi) the antisense strand of SEQ ID NO: 58 and the sense strand of SEQ ID NO: 312; xii) the antisense strand of SEQ ID NO: 65 and the sense strand of SEQ ID NO: 319; xiii) the antisense strand of SEQ ID NO: 67 and the sense strand of SEQ ID NO: 321; xiv) the sense strand of SEQ ID NO: 304; viii) the antisense strand of SEQ ID NO: 52 and the sense strand of SEQ ID NO: 306; xix) the antisense strand of SEQ ID NO: 56 and the sense strand of SEQ ID NO: 310; xiii) the antisense strand of SEQ ID NO: 57 and the sense strand of SEQ ID NO: 311; xix) the antisense strand of SEQ ID NO: 58 and the sense strand of SEQ ID NO: 312; xii) the antisense strand of SEQ ID NO: 65 and the sense strand of SEQ ID NO: 319; xiii) the antisense strand of SEQ ID NO: 67 and the sense strand of SEQ ID NO: 321; xiv) the sense strand of SEQ ID NO: 304; viii ... xv) The antisense strand of the nucleic acid sequence of SEQ ID NO: 63 and the sense strand of the nucleic acid sequence of SEQ ID NO: 317; xv) The antisense strand of the nucleic acid sequence of SEQ ID NO: 64 and the sense strand of the nucleic acid sequence of SEQ ID NO: 318; xvi) The antisense strand of the nucleic acid sequence of SEQ ID NO: 54 and the sense strand of the nucleic acid sequence of SEQ ID NO: 308;xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 60 and the sense strand according to SEQ ID NO: 314; xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 49 and the sense strand according to SEQ ID NO: 303; xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 51 and the sense strand according to SEQ ID NO: 305; xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 59 and the sense strand according to SEQ ID NO: 313; xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 53 and the sense strand according to SEQ ID NO: 307; xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 61 and the sense strand according to SEQ ID NO: 315; xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 47 and the sense strand according to SEQ ID NO: 60. The sense strand of the nucleic acid sequence 301; xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 66 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 320; xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 309; xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 69 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 323; xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 62 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 316; or xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 68 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 322.

[0040] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide at a dose of 1.0 nM attenuates the expression of human LPAmRNA by 20% to 50%. In some embodiments of the isolated oligonucleotide, the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 43 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 297; ii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 48 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 302; iii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 45 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 299; iv) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 50 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 304; v) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 52 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 306; vi) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 104 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 358; vii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 65 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 306. The sense strand of the nucleic acid sequence NO: 319; viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 298; ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 97 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351; x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 349; xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 58 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 312; xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 56 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 310; xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 396; xiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 319; v ... xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 367; xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 375; xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 94 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 348;xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 347; xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 92 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 346; xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 343; xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 96 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 350; xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 384; xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 67 and the sense strand according to SEQ ID NO: 321; xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 57 and the sense strand according to SEQ ID NO: 99. 311 sense strand; xxiv) antisense strand according to SEQ ID NO: 147 and sense strand according to SEQ ID NO: 401; xxv) antisense strand according to SEQ ID NO: 123 and sense strand according to SEQ ID NO: 377; xxvi) antisense strand according to SEQ ID NO: 114 and sense strand according to SEQ ID NO: 368; xxvii) antisense strand according to SEQ ID NO: 74 and sense strand according to SEQ ID NO: 328; xxviii) antisense strand according to SEQ ID NO: 240 and sense strand according to SEQ ID NO: 494; xxix) antisense strand according to SEQ ID NO: 78 and sense strand according to SEQ ID NO: 332; xxx) according to SEQ ID NO: The antisense strand of the nucleic acid sequence 87 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 341; xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381; xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 105 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359; xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335;xxxiv) The antisense strand based on the nucleic acid sequence of SEQ ID NO: 46 and the sense strand based on the nucleic acid sequence of SEQ ID NO: 300; xxxv) The antisense strand based on the nucleic acid sequence of SEQ ID NO: 71 and the sense strand based on the nucleic acid sequence of SEQ ID NO: 325; xxxvi) The antisense strand based on the nucleic acid sequence of SEQ ID NO: 134 and the sense strand based on the nucleic acid sequence of SEQ ID NO: 388; xxxvii) The antisense strand based on the nucleic acid sequence of SEQ ID NO: 152 and the sense strand based on the nucleic acid sequence of SEQ ID NO: 406; xxxviii) The antisense strand based on the nucleic acid sequence of SEQ ID NO: 125 and the sense strand based on the nucleic acid sequence of SEQ ID NO: 379; xxxix) The antisense strand based on the nucleic acid sequence of SEQ ID NO: 117 and the sense strand based on the nucleic acid sequence of SEQ ID NO: 371; xl) The antisense strand based on the nucleic acid sequence of SEQ ID NO: 107 and the sense strand based on the nucleic acid sequence of SEQ ID NO: 46 and the sense strand based on the nucleic acid sequence of SEQ ID NO: 300. xli) sense strand of SEQ ID NO: 361; xli) antisense strand of SEQ ID NO: 186 and sense strand of SEQ ID NO: 440; xlii) antisense strand of SEQ ID NO: 120 and sense strand of SEQ ID NO: 374; xliii) antisense strand of SEQ ID NO: 100 and sense strand of SEQ ID NO: 354; xliv) antisense strand of SEQ ID NO: 183 and sense strand of SEQ ID NO: 437; xlv) antisense strand of SEQ ID NO: 158 and sense strand of SEQ ID NO: 412; xlvi) antisense strand of SEQ ID NO: 207 and sense strand of SEQ ID NO: 461; or xlvii) sense strand of SEQ ID NO: 361. The antisense strand of the nucleic acid sequence NO: 109 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 363.

[0041] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide attenuates the expression of human LPAmRNA by at least 50% at a dose of 1.0 nM. In some embodiments of the isolated oligonucleotide, the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 42 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 296.

[0042] In some embodiments of isolated oligonucleotides, the sense strand or antisense strand, or both, contains one or more modified nucleotides.

[0043] This disclosure provides a vector that encodes any of the isolated oligonucleotides of this disclosure.

[0044] This disclosure provides a delivery system comprising any of the isolated oligonucleotides of this disclosure.

[0045] This disclosure provides a pharmaceutical composition comprising any of the isolated oligonucleotides of this disclosure, any of the carriers of this disclosure, or any of the delivery systems of this disclosure, as well as a pharmaceutically acceptable carrier, diluent, or excipient.

[0046] This disclosure provides a kit comprising any of the isolated oligonucleotides of this disclosure, any of the carriers of this disclosure, any of the delivery systems of this disclosure, or any of the pharmaceutical compositions of this disclosure.

[0047] This disclosure provides a method for inhibiting or downregulating the expression or level of human Lp(a) in a subject of need, wherein the method comprises administering to the subject an effective amount of at least one of any of the isolated oligonucleotides of this disclosure, any of the carriers of this disclosure, any of the delivery systems of this disclosure, or any of the pharmaceutical compositions of this disclosure.

[0048] This disclosure provides a method for treating or preventing a disease or condition in a subject of need that is associated with abnormal or increased expression or activity of human Lp(a) or in which human Lp(a) plays a role, wherein the method comprises administering to the subject an effective amount of at least one of any of the isolated oligonucleotides of this disclosure, any of the carriers of this disclosure, any of the delivery systems of this disclosure, or any of the pharmaceutical compositions of this disclosure.

[0049] This disclosure also provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand form a double-stranded region, wherein the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 2 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 1102; ii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 3 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 1103; iii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 4 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 1104; iv) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 5 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 1105; v) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 6 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 1106; vi) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 7 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 1106. The sense strands of the nucleic acid sequence SEQ ID NO: 1107; vii) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 8 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 1108; viii) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 9 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 1109; ix) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 10 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 1110; x) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 11 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 1111; xi) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 12 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 1112; xii) the antisense strands of the nucleic acid sequence according to SEQ ID NO: 13 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 1113; xiii) the sense strands of the nucleic acid sequence according to SEQ ID NO: 1107 and the sense strands of the nucleic acid sequence according to SEQ ID NO: 1108; The antisense strand of the nucleic acid sequence of SEQ ID NO: 14 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1114; xiv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 15 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1115; xv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 16 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1116; xvi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 17 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1117; xvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 18 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1118;xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 and the sense strand according to SEQ ID NO: 1119; xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 and the sense strand according to SEQ ID NO: 1120; xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 and the sense strand according to SEQ ID NO: 1121; xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 and the sense strand according to SEQ ID NO: 1122; xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 42 and the sense strand according to SEQ ID NO: 1123; xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 43 and the sense strand according to SEQ ID NO: 1124; xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 and the sense strand according to SEQ ID NO: 1125 sense strand; xxv) sense strands according to SEQ ID NO: 45 and SEQ ID NO: 1126; xxvi) sense strands according to SEQ ID NO: 46 and SEQ ID NO: 1127; xxvii) sense strands according to SEQ ID NO: 47 and SEQ ID NO: 1128; xxviii) sense strands according to SEQ ID NO: 48 and SEQ ID NO: 1129; xxix) sense strands according to SEQ ID NO: 49 and SEQ ID NO: 1130; xxx) sense strands according to SEQ ID NO: 50 and SEQ ID NO: 1131; xxxi) sense strands according to SEQ ID NO: 50 and SEQ ID NO: 1131; xxxii) The antisense strand of the nucleic acid sequence of SEQ ID NO: 51 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1132; xxxiii) The antisense strand of the nucleic acid sequence of SEQ ID NO: 52 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1133; xxxiii) The antisense strand of the nucleic acid sequence of SEQ ID NO: 53 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1134; xxxiv) The antisense strand of the nucleic acid sequence of SEQ ID NO: 54 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1135;xxxv) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 55 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1136; xxxvi) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 56 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1137; xxxvii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 57 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1138; xxxviii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 58 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1139; xxxix) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 59 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1140; xl) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 60 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1141; xli) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 61 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1141. The sense strand of the nucleic acid sequence according to SEQ ID NO: 1142; xlii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 62 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1143; xliii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 63 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1144; xliv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 64 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1145; xlv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 65 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1146; xlvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 66 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1147; xlvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 67 and the sense strand of the nucleic acid sequence according to SEQ ID NO: The sense strand of the nucleic acid sequence SEQ ID NO: 1148; xlviii) the antisense strand of the nucleic acid sequence SEQ ID NO: 68 and the sense strand of the nucleic acid sequence SEQ ID NO: 1149; xlix) the antisense strand of the nucleic acid sequence SEQ ID NO: 69 and the sense strand of the nucleic acid sequence SEQ ID NO: 1150; l) the antisense strand of the nucleic acid sequence SEQ ID NO: 70 and the sense strand of the nucleic acid sequence SEQ ID NO: 1151; li) the antisense strand of the nucleic acid sequence SEQ ID NO: 71 and the sense strand of the nucleic acid sequence SEQ ID NO: 1152;lii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 72 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1153; liii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1154; liv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1155; lv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1156; lvi) antisense strand of the nucleic acid sequence according to SEQ ID NO: 76 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1157; lvii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 77 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1158; lviii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1159. sense strands of the nucleic acid sequence SEQ ID NO: 1159; lx) antisense strands of the nucleic acid sequence SEQ ID NO: 79 and sense strands of the nucleic acid sequence SEQ ID NO: 1160; lx) antisense strands of the nucleic acid sequence SEQ ID NO: 80 and sense strands of the nucleic acid sequence SEQ ID NO: 1161; lxi) antisense strands of the nucleic acid sequence SEQ ID NO: 81 and sense strands of the nucleic acid sequence SEQ ID NO: 1162; lxii) antisense strands of the nucleic acid sequence SEQ ID NO: 82 and sense strands of the nucleic acid sequence SEQ ID NO: 1163; lxiii) antisense strands of the nucleic acid sequence SEQ ID NO: 83 and sense strands of the nucleic acid sequence SEQ ID NO: 1164; lxiv) antisense strands of the nucleic acid sequence SEQ ID NO: 84 and sense strands of the nucleic acid sequence SEQ ID NO: 1165; lxv) according to SEQ ID NO: The antisense strand of the nucleic acid sequence of SEQ ID NO: 85 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1166; lxvi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 86 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1167; lxvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 87 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1168; lxviii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 88 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1169;lxix) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 89 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1170; lxx) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 90 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1171; lxxi) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 91 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1172; lxxii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 92 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1173; lxxiii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 93 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1174; lxxiv) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 94 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1175; lxxv) Based on the nucleic acid sequence of SEQ ID NO: 89 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1175; The antisense strand of SEQ ID NO: 95 and the sense strand of SEQ ID NO: 1176; lxxvi) the antisense strand of SEQ ID NO: 96 and the sense strand of SEQ ID NO: 1177; lxxvii) the antisense strand of SEQ ID NO: 97 and the sense strand of SEQ ID NO: 1178; lxxviii) the antisense strand of SEQ ID NO: 98 and the sense strand of SEQ ID NO: 1179; lxxix) the antisense strand of SEQ ID NO: 99 and the sense strand of SEQ ID NO: 1180; lxxx) the antisense strand of SEQ ID NO: 100 and the sense strand of SEQ ID NO: 1181; lxxxi) the antisense strand of SEQ ID NO: 101 and the sense strand of SEQ ID NO: 1180. The sense strand of the nucleic acid sequence NO:1182; lxxxii) the antisense strand of the nucleic acid sequence of SEQ ID NO:102 and the sense strand of the nucleic acid sequence of SEQ ID NO:1183; lxxxiii) the antisense strand of the nucleic acid sequence of SEQ ID NO:103 and the sense strand of the nucleic acid sequence of SEQ ID NO:1184; lxxxiv) the antisense strand of the nucleic acid sequence of SEQ ID NO:104 and the sense strand of the nucleic acid sequence of SEQ ID NO:1185; lxxxv) the antisense strand of the nucleic acid sequence of SEQ ID NO:105 and the sense strand of the nucleic acid sequence of SEQ ID NO:1186;lxxxvi) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 106 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1187; lxxxvii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1188; lxxxviii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1189; lxxxix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1190; xc) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1191; xci) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 111 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1192; xcii) According to SEQ ID NO: xciii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1193; xcv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1194; xciv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1195; xcv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1196; xcvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1197; xcvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1198; xcviii) According to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 1198 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1199; xcix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1200; c) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1201; ci) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1202; cii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1203;ciii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 and the sense strand according to SEQ ID NO: 1204; civ) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 and the sense strand according to SEQ ID NO: 1205; cv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 and the sense strand according to SEQ ID NO: 1206; cvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 and the sense strand according to SEQ ID NO: 1207; cvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 and the sense strand according to SEQ ID NO: 1208; cviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 and the sense strand according to SEQ ID NO: 1209; cix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 1209 and the sense strand according to SEQ ID NO: 1204; cx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1210; cx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1211; cxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1212; cxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1213; cxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1214; cxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1215; cxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 and the sense strand according to SEQ ID NO: 1214. The sense strand of the nucleic acid sequence NO: 1216; cxvi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 136 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1217; cxvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 137 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1218; cxviii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 138 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1219; cxix) the antisense strand of the nucleic acid sequence of SEQ ID NO: 139 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1220;cxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1221; cxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1222;

[0050] cxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 and the sense strand according to SEQ ID NO: 1223; cxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 and the sense strand according to SEQ ID NO: 1224; cxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 and the sense strand according to SEQ ID NO: 1225; cxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 and the sense strand according to SEQ ID NO: 1226; cxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 and the sense strand according to SEQ ID NO: 1227; cxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 147 and the sense strand according to SEQ ID NO: 1228; cxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 and the sense strand according to SEQ ID NO: 1228; The antisense strand of the nucleic acid sequence SEQ ID NO: 148 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1229; cxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1230; cxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1231; cxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1232; cxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 152 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1233; cxxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1234; cxxxiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 1234; The antisense strand of the nucleic acid sequence SEQ ID NO: 154 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1235; cxxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1236; cxxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1237; cxxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1238;cxxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 and the sense strand according to SEQ ID NO: 1239; cxxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 and the sense strand according to SEQ ID NO: 1240; cxl) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 and the sense strand according to SEQ ID NO: 1241; cxli) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 and the sense strand according to SEQ ID NO: 1242; cxlii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 and the sense strand according to SEQ ID NO: 1243; cxliii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 and the sense strand according to SEQ ID NO: 1244; cxliv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 and the sense strand according to SEQ ID NO: 1244; The antisense strand of the nucleic acid sequence SEQ ID NO: 164 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1245; cxlv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1246; cxlvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1247; cxlvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1248; cxlviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1249; cxlix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1250; cl) the sense strand of the nucleic acid sequence according to SEQ ID NO: 1245; The antisense strand of the nucleic acid sequence SEQ ID NO: 170 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1251; cli) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1252; clii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1253; cliii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 173 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1254; cliv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 174 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1255;clv) antisense strand based on the nucleic acid sequence of SEQ ID NO: 175 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1256; clvi) antisense strand based on the nucleic acid sequence of SEQ ID NO: 176 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1257; clvii) antisense strand based on the nucleic acid sequence of SEQ ID NO: 177 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1258; clviii) antisense strand based on the nucleic acid sequence of SEQ ID NO: 178 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1259; clx) antisense strand based on the nucleic acid sequence of SEQ ID NO: 179 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1260; clx) antisense strand based on the nucleic acid sequence of SEQ ID NO: 180 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1261; clxi) based on the nucleic acid sequence of SEQ ID NO: 175 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1256; The antisense strand of the nucleic acid sequence SEQ ID NO: 181 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1262; clxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1263; clxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 183 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1264; clxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 184 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1265; clxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 185 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1266; clxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1267; clxvii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 1267. The antisense strand of the nucleic acid sequence SEQ ID NO: 187 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1268; clxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 188 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1269; clxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 189 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1270; clxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1271; clxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1272;clxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 192 and the sense strand according to SEQ ID NO: 1273; clxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 193 and the sense strand according to SEQ ID NO: 1274; clxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 and the sense strand according to SEQ ID NO: 1275; clxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 and the sense strand according to SEQ ID NO: 1276; clxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 and the sense strand according to SEQ ID NO: 1277; clxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 197 and the sense strand according to SEQ ID NO: 1278; clxxviii) The sense strand according to SEQ ID NO: The antisense strand of the nucleic acid sequence according to SEQ ID NO: 198 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1279; clxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 199 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1280; clxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1281; clxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1282; clxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 202 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1283; clxxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 203 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1284; clxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 204 and the sense strand according to SEQ ID NO: 1284. The sense strand of the nucleic acid sequence of SEQ ID NO: 1285; clxxxv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 205 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1286; clxxxvi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 206 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1287; clxxxvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 207 and the sense strand of the nucleic acid sequence of SEQ ID NO: 1288;clxxxviii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1289; clxxxix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 209 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1290; cxc) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1291; cxci) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1292; cxcii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1293; cxciii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 213 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1294; cxciv) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1294; The antisense strand of the nucleic acid sequence SEQ ID NO: 214 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1295; cxcv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 215 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1296; cxcvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 216 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1297; cxcvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1298; cxcviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 218 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1299; cxcix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1300; cc) according to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 220 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1301; cci) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 221 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1302; ccii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 222 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1303; cciii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1304; cciv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 224 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1305;ccv) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 225 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1306; ccvi) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1307; ccvii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 227 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1308; ccviii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 228 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1309; ccix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 229 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1310; ccx) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 230 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1311; ccxi) According to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 231 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1312; ccxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 232 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1313; ccxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 233 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1314; ccxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 234 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1315; ccxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 235 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1316; ccxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 236 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1317; ccxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2312 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1317; The antisense strand of the nucleic acid sequence 237 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1318; ccxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 238 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1319; ccxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 239 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1320; ccxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 240 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1321;ccxxi) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 241 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1322; ccxxii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 242 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1323; ccxxiii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 243 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1324; ccxxiv) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 244 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1325; ccxxv) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 245 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1326; ccxxvi) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 246 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1327; ccxxvii) Based on SEQ ID NO: 241 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1327; The antisense strand of the nucleic acid sequence according to SEQ ID NO: 247 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1328; ccxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 248 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1329; ccxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 249 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1330; ccxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 250 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1331; ccxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 251 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1332; ccxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 252 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1333; ccxxxiii) according to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 253 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1334; ccxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 254 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1335; ccxxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 255 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1336; ccxxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 256 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1337;ccxxxvii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 257 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1338; ccxxxviii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 258 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1339; ccxxxix) antisense strand of the nucleic acid sequence according to SEQ ID NO: 259 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1340; ccxl) antisense strand of the nucleic acid sequence according to SEQ ID NO: 260 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1341; ccxli) antisense strand of the nucleic acid sequence according to SEQ ID NO: 261 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1342; ccxlii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 262 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1343; ccxliii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 263 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1344; ccxliv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 264 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1345; ccxlv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 265 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1346; ccxlvi) antisense strand of the nucleic acid sequence according to SEQ ID NO: 266 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1347; ccxlvii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 267 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1348; ccxlviii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 268 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1349; ccxlix) antisense strand of the nucleic acid sequence according to SEQ ID NO: 269 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1350; ccl) antisense strand of the nucleic acid sequence according to SEQ ID NO: 270 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1351; ccli) antisense strand of the nucleic acid sequence according to SEQ ID NO: 271 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1352; cclii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 272 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1353;ccliii) antisense strand according to the nucleic acid sequence of SEQ ID NO: 273 and sense strand according to the nucleic acid sequence of SEQ ID NO: 1354; ccliv) antisense strand according to the nucleic acid sequence of SEQ ID NO: 274 and sense strand according to the nucleic acid sequence of SEQ ID NO: 1355; cclv) antisense strand according to the nucleic acid sequence of SEQ ID NO: 275 and sense strand according to the nucleic acid sequence of SEQ ID NO: 1356; cclvi) antisense strand according to the nucleic acid sequence of SEQ ID NO: 276 and sense strand according to the nucleic acid sequence of SEQ ID NO: 1357; cclvii) antisense strand according to the nucleic acid sequence of SEQ ID NO: 277 and sense strand according to the nucleic acid sequence of SEQ ID NO: 1358; cclviii) antisense strand according to the nucleic acid sequence of SEQ ID NO: 278 and sense strand according to the nucleic acid sequence of SEQ ID NO: 1359; cclix) according to SEQ ID NO: 273 and sense strand according to the nucleic acid sequence of SEQ ID NO: 1359; The antisense strand of the nucleic acid sequence NO:279 and the sense strand according to the nucleic acid sequence of SEQ ID NO:1360; cclx) the antisense strand of the nucleic acid sequence of SEQ ID NO:280 and the sense strand according to the nucleic acid sequence of SEQ ID NO:1361; cclxi) the antisense strand of the nucleic acid sequence of SEQ ID NO:281 and the sense strand according to the nucleic acid sequence of SEQ ID NO:1362; cclxii) the antisense strand of the nucleic acid sequence of SEQ ID NO:282 and the sense strand according to the nucleic acid sequence of SEQ ID NO:1363; cclxiii) the antisense strand of the nucleic acid sequence of SEQ ID NO:283 and the sense strand according to the nucleic acid sequence of SEQ ID NO:1364; cclxiv) the antisense strand of the nucleic acid sequence of SEQ ID NO:284 and the sense strand according to the nucleic acid sequence of SEQ ID NO:1365; cclxv) the antisense strand of the nucleic acid sequence of SEQ ID NO:284 and the sense strand according to the nucleic acid sequence of SEQ ID NO:1365; The antisense strand of the nucleic acid sequence SEQ ID NO: 285 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1366; cclxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 286 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1367; cclxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 287 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1368; cclxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 288 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1369;cclxix) antisense strand of the nucleic acid sequence according to SEQ ID NO: 289 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1370; cclxx) antisense strand of the nucleic acid sequence according to SEQ ID NO: 290 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1371; cclxxi) antisense strand of the nucleic acid sequence according to SEQ ID NO: 291 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1372; cclxxii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 292 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1373; cclxxiii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 293 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1374; cclxxiv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 294 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1375; (or cclxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 295 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1376.

[0051] In some embodiments of the isolated oligonucleotide, the sense strand contains at least one targeting ligand. In some embodiments of the isolated oligonucleotide, the antisense strand contains at least one targeting ligand. In some embodiments of the isolated oligonucleotide, both the sense strand and the antisense strand contain at least one targeting ligand. In some embodiments, the targeting ligand comprises GalNAc (e.g., GalNAc linked via G1b).

[0052] This disclosure also provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand form a double-stranded region, wherein the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 552 and a sense strand according to the nucleic acid sequence of SEQ ID NO: 1100;

[0053] ii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 553 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1101; iii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 554 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 573; iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 555 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 574; v) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 556 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 575; vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 557 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 576; vii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 558 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 577; viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 559 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 553; 578 sense strand; ix) antisense strand according to SEQ ID NO: 560 and sense strand according to SEQ ID NO: 579; x) antisense strand according to SEQ ID NO: 561 and sense strand according to SEQ ID NO: 580; xi) antisense strand according to SEQ ID NO: 562 and sense strand according to SEQ ID NO: 581; xii) antisense strand according to SEQ ID NO: 563 and sense strand according to SEQ ID NO: 582; xiii) antisense strand according to SEQ ID NO: 564 and sense strand according to SEQ ID NO: 583; xiv) antisense strand according to SEQ ID NO: 565 and sense strand according to SEQ ID NO: 584; xv) according to SEQ ID NO: xvi) The antisense strand of the nucleic acid sequence of SEQ ID NO: 566 and the sense strand of the nucleic acid sequence of SEQ ID NO: 585; xvii) The antisense strand of the nucleic acid sequence of SEQ ID NO: 567 and the sense strand of the nucleic acid sequence of SEQ ID NO: 586; xvii) The antisense strand of the nucleic acid sequence of SEQ ID NO: 568 and the sense strand of the nucleic acid sequence of SEQ ID NO: 587; xviii) The antisense strand of the nucleic acid sequence of SEQ ID NO: 569 and the sense strand of the nucleic acid sequence of SEQ ID NO: 588;xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 570 and the sense strand according to SEQ ID NO: 589; xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 571 and the sense strand according to SEQ ID NO: 590; xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 572 and the sense strand according to SEQ ID NO: 591; xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 592 and the sense strand according to SEQ ID NO: 846; xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 593 and the sense strand according to SEQ ID NO: 847; xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 594 and the sense strand according to SEQ ID NO: 848; xxv) According to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 595 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 849; xxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 596 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 850; xxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 597 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 851; xxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 598 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 852; xxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 599 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 853; xxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 600 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 854; xxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 601 and the sense strand of the nucleic acid sequence according to SEQ ID NO: xxxii) the sense strand of the nucleic acid sequence of SEQ ID NO: 602 and the sense strand of the nucleic acid sequence of SEQ ID NO: 856; xxxiii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 603 and the sense strand of the nucleic acid sequence of SEQ ID NO: 857; xxxiv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 604 and the sense strand of the nucleic acid sequence of SEQ ID NO: 858; xxxv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 605 and the sense strand of the nucleic acid sequence of SEQ ID NO: 859;xxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 606 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 860; xxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 607 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 861; xxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 608 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 862; xxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 609 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 863; xl) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 610 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 864; xli) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 611 and the sense strand according to SEQ ID NO: 865; xlii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 611 and the sense strand according to SEQ ID NO: 865; x1i) The antisense strand of the nucleic acid sequence of SEQ ID NO: 612 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 866; x1ii) The antisense strand of the nucleic acid sequence of SEQ ID NO: 613 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 867; x1v) The antisense strand of the nucleic acid sequence of SEQ ID NO: 614 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 868; xlv) The antisense strand of the nucleic acid sequence of SEQ ID NO: 615 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 869; xlvi) The antisense strand of the nucleic acid sequence of SEQ ID NO: 616 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 870; xlvii) The antisense strand of the nucleic acid sequence of SEQ ID NO: 617 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 871; xlviii) The antisense strand of the nucleic acid sequence of SEQ ID NO: 618 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 869. The sense strand of the nucleic acid sequence 872; xlix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 619 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 873; l) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 620 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 874; li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 621 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 875; lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 622 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 876;liii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 623 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 877; liv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 624 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 878; lv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 625 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 879; lvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 626 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 880; lvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 627 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 881; lviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 628 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 882; lix) According to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 629 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 883; lx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 630 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 884; lxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 631 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 885; lxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 632 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 886; lxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 633 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 887; lxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 634 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 888; lxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 635 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 887; The sense strand of the nucleic acid sequence 889; lxvi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 636 and the sense strand of the nucleic acid sequence of SEQ ID NO: 890; lxvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 637 and the sense strand of the nucleic acid sequence of SEQ ID NO: 891; lxviii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 638 and the sense strand of the nucleic acid sequence of SEQ ID NO: 892; lxix) the antisense strand of the nucleic acid sequence of SEQ ID NO: 639 and the sense strand of the nucleic acid sequence of SEQ ID NO: 893;lxx) Antisense strand of SEQ ID NO: 640 and sense strand of SEQ ID NO: 894; lxxi) Antisense strand of SEQ ID NO: 641 and sense strand of SEQ ID NO: 895; lxxii) Antisense strand of SEQ ID NO: 642 and sense strand of SEQ ID NO: 896; lxxiii) Antisense strand of SEQ ID NO: 643 and sense strand of SEQ ID NO: 897; lxxiv) Antisense strand of SEQ ID NO: 644 and sense strand of SEQ ID NO: 898; lxxv) Antisense strand of SEQ ID NO: 645 and sense strand of SEQ ID NO: 899; lxxvi) Based on SEQ ID NO: The antisense strand of SEQ ID NO: 646 and the sense strand of SEQ ID NO: 900; lxxvii) the antisense strand of SEQ ID NO: 647 and the sense strand of SEQ ID NO: 901; lxxviii) the antisense strand of SEQ ID NO: 648 and the sense strand of SEQ ID NO: 902; lxxix) the antisense strand of SEQ ID NO: 649 and the sense strand of SEQ ID NO: 903; lxxx) the antisense strand of SEQ ID NO: 650 and the sense strand of SEQ ID NO: 904; lxxxi) the antisense strand of SEQ ID NO: 651 and the sense strand of SEQ ID NO: 905; lxxxii) the antisense strand of SEQ ID NO: 652 and the sense strand of SEQ ID NO: 904. The sense strand of the nucleic acid sequence 906; lxxxiii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 653 and the sense strand of the nucleic acid sequence of SEQ ID NO: 907; lxxxiv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 654 and the sense strand of the nucleic acid sequence of SEQ ID NO: 908; lxxxv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 655 and the sense strand of the nucleic acid sequence of SEQ ID NO: 909;lxxxvi) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 656 and sense strand based on the nucleic acid sequence of SEQ ID NO: 910; lxxxvii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 657 and sense strand based on the nucleic acid sequence of SEQ ID NO: 911; lxxxviii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 658 and sense strand based on the nucleic acid sequence of SEQ ID NO: 912; lxxxix) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 659 and sense strand based on the nucleic acid sequence of SEQ ID NO: 913; xc) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 660 and sense strand based on the nucleic acid sequence of SEQ ID NO: 914; xci) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 661 and sense strand based on the nucleic acid sequence of SEQ ID NO: 915; xcii) Based on the nucleic acid sequence of SEQ ID NO: xciii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 662 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 916; xcv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 663 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 917; xcv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 664 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 918; xcv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 665 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 919; xcvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 666 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 920; xcvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 667 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 921; xcviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 668 and the sense strand according to SEQ ID NO: 919. The sense strand of the nucleic acid sequence 922; xcix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 669 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 923; c) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 670 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 924; ci) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 671 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 925; cii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 672 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 926;ciii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 673 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 927; civ) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 674 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 928; cv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 675 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 929; cvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 676 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 930; cvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 677 and the sense strand according to SEQ ID NO: 931; cviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 678 and the sense strand according to SEQ ID NO: 932; cix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 679 and the sense strand according to SEQ ID NO: 927. cx) the sense strand of the nucleic acid sequence of SEQ ID NO: 933; cx) the antisense strand of the nucleic acid sequence of SEQ ID NO: 680 and the sense strand of the nucleic acid sequence of SEQ ID NO: 934; cxi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 681 and the sense strand of the nucleic acid sequence of SEQ ID NO: 935; cxii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 682 and the sense strand of the nucleic acid sequence of SEQ ID NO: 936; cxiii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 683 and the sense strand of the nucleic acid sequence of SEQ ID NO: 937; cxiv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 684 and the sense strand of the nucleic acid sequence of SEQ ID NO: 938; cxv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 685 and the sense strand of the nucleic acid sequence of SEQ ID NO: 939; cxvi) the sense strand of the nucleic acid sequence of SEQ ID NO: 939. The antisense strand of the nucleic acid sequence according to SEQ ID NO: 686 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 940; cxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 687 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 941; cxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 688 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 942; cxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 689 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 943;cxx) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 690 and sense strand based on the nucleic acid sequence of SEQ ID NO: 944; cxxi) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 691 and sense strand based on the nucleic acid sequence of SEQ ID NO: 945; cxxii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 692 and sense strand based on the nucleic acid sequence of SEQ ID NO: 946; cxxiii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 693 and sense strand based on the nucleic acid sequence of SEQ ID NO: 947; cxxiv) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 694 and sense strand based on the nucleic acid sequence of SEQ ID NO: 948; cxxv) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 695 and sense strand based on the nucleic acid sequence of SEQ ID NO: 949; cxxvi) Based on the nucleic acid sequence of SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 696 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 950; cxxvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 697 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 951; cxxviii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 698 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 952; cxxix) the antisense strand of the nucleic acid sequence of SEQ ID NO: 699 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 953; cxxx) the antisense strand of the nucleic acid sequence of SEQ ID NO: 700 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 954; cxxxi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 701 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 955; cxxxii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 702 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 954. The sense strand of the nucleic acid sequence 956; cxxxiii) the antisense strand of the nucleic acid sequence SEQ ID NO: 703 and the sense strand of the nucleic acid sequence SEQ ID NO: 957; cxxxiv) the antisense strand of the nucleic acid sequence SEQ ID NO: 704 and the sense strand of the nucleic acid sequence SEQ ID NO: 958; cxxxv) the antisense strand of the nucleic acid sequence SEQ ID NO: 705 and the sense strand of the nucleic acid sequence SEQ ID NO: 959;cxxxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 706 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 960; cxxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 707 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 961; cxxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 708 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 962; cxxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 709 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 963; cxl) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 710 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 964; cxli) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 711 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 965; cxlii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 706 and the sense strand according to SEQ ID NO: 965; The antisense strand of the nucleic acid sequence SEQ ID NO: 712 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 966; cxliii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 713 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 967; cxliv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 714 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 968; cxlv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 715 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 969; cxlvi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 716 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 970; cxlvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 717 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 971; cxlviii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 718 and the sense strand according to SEQ ID NO: 966. The sense strand of the nucleic acid sequence NO: 972; cxlix) the antisense strand of the nucleic acid sequence of SEQ ID NO: 719 and the sense strand of the nucleic acid sequence of SEQ ID NO: 973; cl) the antisense strand of the nucleic acid sequence of SEQ ID NO: 720 and the sense strand of the nucleic acid sequence of SEQ ID NO: 974; cli) the antisense strand of the nucleic acid sequence of SEQ ID NO: 721 and the sense strand of the nucleic acid sequence of SEQ ID NO: 975; clii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 722 and the sense strand of the nucleic acid sequence of SEQ ID NO: 976;cliii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 723 and the sense strand according to SEQ ID NO: 977; cliv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 724 and the sense strand according to SEQ ID NO: 978; clv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 725 and the sense strand according to SEQ ID NO: 979; clvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 726 and the sense strand according to SEQ ID NO: 980; clvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 727 and the sense strand according to SEQ ID NO: 981; clviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 728 and the sense strand according to SEQ ID NO: 982; clix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 723 and the sense strand according to SEQ ID NO: 977; clx) antisense strand of SEQ ID NO: 730 and sense strand of SEQ ID NO: 984; clxi) antisense strand of SEQ ID NO: 731 and sense strand of SEQ ID NO: 985; clxii) antisense strand of SEQ ID NO: 732 and sense strand of SEQ ID NO: 986; clxiii) antisense strand of SEQ ID NO: 733 and sense strand of SEQ ID NO: 987; clxiv) antisense strand of SEQ ID NO: 734 and sense strand of SEQ ID NO: 988; clxv) antisense strand of SEQ ID NO: 735 and sense strand of SEQ ID NO: 986. clxvi) sense strand of SEQ ID NO: 736 and sense strand of SEQ ID NO: 990; clxvii) antisense strand of SEQ ID NO: 737 and sense strand of SEQ ID NO: 991; clxviii) antisense strand of SEQ ID NO: 738 and sense strand of SEQ ID NO: 992; clxix) antisense strand of SEQ ID NO: 739 and sense strand of SEQ ID NO: 993;clxx) antisense strand of the nucleic acid sequence according to SEQ ID NO: 740 and sense strand of the nucleic acid sequence according to SEQ ID NO: 994; clxxi) antisense strand of the nucleic acid sequence according to SEQ ID NO: 741 and sense strand of the nucleic acid sequence according to SEQ ID NO: 995; clxxii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 742 and sense strand of the nucleic acid sequence according to SEQ ID NO: 996; clxxiii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 743 and sense strand of the nucleic acid sequence according to SEQ ID NO: 997; clxxiv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 744 and sense strand of the nucleic acid sequence according to SEQ ID NO: 998; clxxv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 745 and sense strand of the nucleic acid sequence according to SEQ ID NO: 999; clxxvi) according to SEQ ID NO: The antisense strand of the nucleic acid sequence 746 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1000; clxxvii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 747 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1001; clxxviii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 748 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1002; clxxix) the antisense strand of the nucleic acid sequence of SEQ ID NO: 749 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1003; clxxx) the antisense strand of the nucleic acid sequence of SEQ ID NO: 750 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1004; clxxxi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 751 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1005; clxxxii) the sense strand according to the nucleic acid sequence of SEQ ID NO: 1000; The antisense strand of the nucleic acid sequence 752 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1006; clxxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 753 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1007; clxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 754 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1008; clxxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 755 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1009;clxxxvi) antisense strand of the nucleic acid sequence according to SEQ ID NO: 756 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1010; clxxxvii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 757 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1011; clxxxviii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 758 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1012; clxxxix) antisense strand of the nucleic acid sequence according to SEQ ID NO: 759 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1013; cxc) antisense strand of the nucleic acid sequence according to SEQ ID NO: 760 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1014; cxci) antisense strand of the nucleic acid sequence according to SEQ ID NO: 761 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1015; cxcii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 762 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1016; cxciii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 763 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1017; cxciv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 764 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1018; cxcv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 765 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1019; cxcvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 766 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1020; cxcvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 767 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1021; cxcviii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 768 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1022; cxcix) antisense strand of the nucleic acid sequence according to SEQ ID NO: 769 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1023; cc) antisense strand of the nucleic acid sequence according to SEQ ID NO: 770 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1024; cci) antisense strand of the nucleic acid sequence according to SEQ ID NO: 771 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1025;ccii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 772 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1026; cciii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 773 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1027; cciv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 774 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1028; ccv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 775 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1029; ccvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 776 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1030; ccvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 777 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1031; ccviii) According to SEQ ID NO: The antisense strand of the nucleic acid sequence 778 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1032; ccix) the antisense strand of the nucleic acid sequence of SEQ ID NO: 779 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1033; ccx) the antisense strand of the nucleic acid sequence of SEQ ID NO: 780 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1034; ccxi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 781 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1035; ccxii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 782 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1036; ccxiii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 783 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1037; ccxiv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 779 and the sense strand according to the nucleic acid sequence of SEQ ID NO: 1037; The antisense strand of the nucleic acid sequence 784 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1038; ccxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 785 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1039; ccxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 786 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1040; ccxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 787 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1041;ccxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 788 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1042; ccxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 789 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1043; ccxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 790 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1044; ccxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 791 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1045; ccxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 792 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1046; ccxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 793 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1047; ccxxiv) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 794 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1048; ccxxv) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 795 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1049; ccxxvi) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 796 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1050; ccxxvii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 797 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1051; ccxxviii) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 798 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1052; ccxxix) Antisense strand based on the nucleic acid sequence of SEQ ID NO: 799 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1053; ccxxx) Based on SEQ ID NO: 794... The antisense strand of the nucleic acid sequence according to SEQ ID NO: 800 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1054; ccxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 801 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1055; ccxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 802 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1056; ccxxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 803 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1057;ccxxxiv) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 804 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1058; ccxxxv) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 805 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1059; ccxxxvi) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 806 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1060; ccxxxvii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 807 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1061; ccxxxviii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 808 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1062; ccxxxix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 809 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1063; ccxl) antisense strand of the nucleic acid sequence according to SEQ ID NO: 810 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1064; ccxli) antisense strand of the nucleic acid sequence according to SEQ ID NO: 811 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1065; ccxlii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 812 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1066; ccxliii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 813 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1067; ccxliv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 814 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1068; ccxlv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 815 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1069; ccxlvi) antisense strand of the nucleic acid sequence according to SEQ ID NO: 816 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1070; ccxlvii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 817 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1071; ccxlviii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 818 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1072; ccxlix) antisense strand of the nucleic acid sequence according to SEQ ID NO: 819 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1073;ccl) antisense strand of the nucleic acid sequence according to SEQ ID NO: 820 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1074; ccli) antisense strand of the nucleic acid sequence according to SEQ ID NO: 821 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1075; cclii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 822 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1076; cclii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 823 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1077; ccliv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 824 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1078; ccllv) antisense strand of the nucleic acid sequence according to SEQ ID NO: 825 and sense strand of the nucleic acid sequence according to SEQ ID NO: 1079; cclvi) according to SEQ ID NO: The antisense strand of the nucleic acid sequence 826 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1080; cclvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 827 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1081; cclviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 828 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1082; cclix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 829 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1083; cclx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 830 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1084; cclxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 831 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1085; cclxii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 1085. The antisense strand of the nucleic acid sequence 832 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1086; cclxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 833 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1087; cclxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 834 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1088; cclxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 835 and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1089;cclxvi) antisense strand based on the nucleic acid sequence of SEQ ID NO: 836 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1090; cclxvii) antisense strand based on the nucleic acid sequence of SEQ ID NO: 837 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1091; cclxviii) antisense strand based on the nucleic acid sequence of SEQ ID NO: 838 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1092; cclxix) antisense strand based on the nucleic acid sequence of SEQ ID NO: 839 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1093; cclxx) antisense strand based on the nucleic acid sequence of SEQ ID NO: 840 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1094; cclxxi) antisense strand based on the nucleic acid sequence of SEQ ID NO: 841 and sense strand based on the nucleic acid sequence of SEQ ID NO: 1095; cclxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 842 and the sense strand according to the nucleic acid sequence according to SEQ ID NO: 1096; cclxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 843 and the sense strand according to SEQ ID NO: 1097; cclxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 844 and the sense strand according to SEQ ID NO: 1098; or cclxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 845 and the sense strand according to SEQ ID NO: 1099. Attached Figure Description

[0054] Figure 1 This is a graph showing the efficacy of the siRNA compounds listed in Table 2 in silencing human Lp(a) in cultured RT4 cells. The compounds were transfected into the cells at a concentration of 10 nM. Data are presented as the percentage of human LPA mRNA remaining after normalization to PPIB mRNA levels relative to simulated transfection (mean + / - SEM). Each bar represents a single compound tested.

[0055] Figure 2 This is a graph showing the efficacy of the siRNA compounds listed in Table 2 in silencing human Lp(a) in cultured RT4 cells. The compounds were transfected into the cells at a concentration of 1 nM. Data are presented as the percentage of human LPA mRNA remaining after normalization to PPIB mRNA levels relative to simulated transfection (mean + / - SEM). Each bar represents a single compound tested.

[0056] Figure 3 This is a graph showing the in vivo potency of a subset of compounds listed in Table 2 in silencing LPA mRNA in 6–8 week old female BALB / c mice. Mice were administered a single subcutaneous dose of the selected siRNA compound at 1 mg / kg, followed by transient transfection with the LPA plasmid via high-pressure tail vein injection (HDI). Liver mRNA was extracted and analyzed by RT-qPCR. Data are presented as the percentage of LPA mRNA remaining after normalization to PPIB mRNA levels relative to simulated transfection (mean + / - SD).

[0057] Figure 4 This is a graph showing the in vivo potency of a subset of the compounds listed in Table 2 in silencing LPALPA mRNA in 6–8 week old female BALB / c mice. Mice were administered a single subcutaneous dose of the selected siRNA compound at 0.3, 1, or 3 mg / kg, followed by transient transfection with the LPA plasmid via high-pressure tail vein injection (HDI). Liver mRNA was extracted and analyzed by RT-qPCR. Data are presented as the percentage of LPALPA mRNA remaining after normalization to PPIB mRNA levels relative to simulated transfection (mean + / - SD).

[0058] Figure 5 This is a graph showing the changes in serum human Lp(a) protein levels after subcutaneous injection of 0.5 mg / kg of a reference or representative compound in humanized LPA mice.

[0059] Figures 6A-6B This is a graph showing changes in the levels of Lp(a) protein or LPA mRNA in cynomolgus monkeys. Figure 6A The study showed the change in Lp(a) protein on day 7 (day -7) relative to baseline after subcutaneous injection of 3 mg / kg of the candidate compound in cynomolgus monkeys. Figure 6B The study showed the change in hepatic LPALPA mRNA levels on day 28 relative to baseline on day 7 (day -7) after subcutaneous injection of the candidate compound in cynomolgus monkeys.

[0060] Figure 7 This is a graph showing the change in serum Lp(a) protein levels on day 1 relative to baseline after subcutaneous injection of 3 mg / kg of the candidate compound in cynomolgus monkeys. Detailed Implementation

[0061] This disclosure provides isolated oligonucleotides (one or more oligonucleotides) forming double-stranded regions, preferably small interfering RNA (siRNA), which can reduce LPA mRNA expression, thereby leading to a decrease in Lp(a) protein expression in target cells. The oligonucleotides disclosed herein may have therapeutic applications in regulating Lp(a) expression for the treatment of diseases or conditions involving Lp(a), such as, but not limited to, stroke, atherosclerosis, lipid metabolism disorders (including dyslipidemia), cardiovascular diseases (CVD) (such as coronary artery disease and aortic stenosis), nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH), or any other condition, pathology, or syndrome associated with elevated Lp(a) particle levels.

[0062] In some aspects, the present invention provides compositions and methods for treating subjects suffering from conditions that would benefit from reduced Lp(a) expression. In some aspects, the methods disclosed herein prevent at least one symptom in subjects suffering from diseases or conditions that would benefit from reduced Lp(a) expression.

[0063] This disclosure has identified a specific region within LPA mRNA that provides a target for binding double-stranded oligonucleotides (e.g., siRNA), thereby leading to a decrease in the expression level of LPA mRNA.

[0064] The LPA mRNA sequence described in this article is the mRNA sequence encoded by the Lp(a) gene, based on GenBank accession number NM_005577.4:

[0065] >NM_005577.4 Homo sapiens lipoprotein (a) (LPA), mRNA

[0066]

[0067] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides located between any of the following nucleotide positions: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944, and the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region.

[0068] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical nucleotide sequences to a region comprising 19-25 nucleotides located between any of the following nucleotide positions: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944.

[0069] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises the same nucleotide sequence as the region comprising 19-25 nucleotides located between any of the following nucleotide positions: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944.

[0070] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises a nucleotide sequence substantially identical to the region located between any of the following nucleotide positions: a) 151 to 172, b) 248 to 269, c) 2947 to 2968, d) 2991 to 3012, e) 3463 to 3484, and f) 3931 to 3952, starting from the 5' end of the human LPAmRNA sequence according to SEQ ID NO: 1.

[0071] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical nucleotide sequences to the region located between any of the following nucleotide positions: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0072] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises the same nucleotide sequence as the region located between any of the following nucleotide positions: a) 151 to 172, b) 248 to 269, c) 2947 to 2968, d) 2991 to 3012, e) 3463 to 3484, and f) 3931 to 3952, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0073] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises a nucleotide sequence substantially identical to the region comprising a sequence selected from any of the following nucleotide positions: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0074] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to the region comprising a sequence selected from any of the following nucleotide positions: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0075] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises the same sequence as the region comprising a sequence selected between any of the following nucleotide positions: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0076] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises a sequence substantially identical to the region comprising the sequence between any of nucleotide positions 156 to 177 from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0077] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of the same sequence as the region comprising the sequence between any of the nucleotide positions 156 to 177 from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0078] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises the same sequence as the region comprising the sequence between any of nucleotide positions 156 to 177, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0079] As described herein, the LPA mRNA sequence according to SEQ ID NO: 1 is any heterologous mRNA sequence that is sufficiently identical to Lp(a) as described herein according to accession number NM_005577.4, which allows binding to the antisense strand of the oligonucleotide of this disclosure.

[0080] In some embodiments of the isolated oligonucleotides disclosed herein, the isolated oligonucleotides are capable of inducing the degradation of LPAmRNA.

[0081] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of this disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of this disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0082] In some embodiments, the isolated oligonucleotides of this disclosure are small interfering RNAs (siRNAs). Therefore, this disclosure provides siRNAs comprising a sense region and an antisense region complementary to the sense region, which together form an RNA duplex, and wherein the sense region comprises a sequence that is at least 70% to 100% identical to the LPA mRNA sequence.

[0083] definition

[0084] "RNAi" or "RNA interference" refers to the sequence-specific post-transcriptional gene silencing process mediated by double-stranded RNA (dsRNA). Double-stranded RNAs such as siRNA (small interfering RNA), miRNA (microRNA), shRNA (short hairpin RNA), ddRNA (DNA-directed RNA), piRNA (Piwi-interacting RNA), or rasiRNA (repetitive sequence-associated siRNA), and their modified forms, can all mediate RNA interference. These dsRNA molecules can be commercially available or designed and prepared based on known sequence information. The antisense strand of these molecules can include RNA, DNA, PNA, or combinations thereof. These DNA / RNA chimeric polynucleotides include, but are not limited to, double-stranded polynucleotides composed of DNA and RNA that inhibit target gene expression. These dsRNA molecules may also include one or more modified nucleotides as described herein, which can be incorporated into either strand.

[0085] In RNAi gene silencing or knockdown, dsRNA containing a first (antisense) strand complementary to a portion of the target gene and a second (sense) strand fully or partially complementary to the first antisense strand is introduced into the organism. After introduction, the target gene-specific dsRNA is processed into relatively small fragments (siRNA) and can subsequently become distributed throughout the organism, reducing the messenger RNA of the target gene and thus leading to a phenotype that may be highly similar to that produced by the complete or partial deletion of the target gene.

[0086] Some dsRNAs in cells can be processed by the enzyme Dicer (ribonuclease III). Dicer can process dsRNA into shorter dsRNA fragments, namely siRNAs. RNAi also involves a nuclease complex called the RNA-induced silencing complex (RISC). After being cleaved by Dicer, the siRNA enters the RISC complex and directs the cleavage of a single-stranded RNA target with a sequence complementary to the antisense strand of the siRNA duplex. The other strand of the siRNA is the transit strand. Cleavage of the target RNA occurs in the middle of a region complementary to the antisense strand of the siRNA duplex. Therefore, siRNA can downregulate or knock down gene expression by mediating RNA interference in a sequence-specific manner.

[0087] As used herein, "target gene" or "target sequence" refers to a gene or gene sequence whose corresponding RNA can be targeted and degraded via the RNAi pathway using dsRNA or siRNA as described herein. To target a gene (e.g., using siRNA), the siRNA contains an antisense region that is at least partially or substantially complementary to the target gene or sequence, and a sense strand that is complementary to the antisense strand. Once introduced into the cell, the siRNA directs the RISC complex to cleave the RNA containing the target sequence, thereby degrading the RNA.

[0088] As used herein, the terms “oligonucleotide,” “nucleic acid,” “nucleotide sequence,” and “polynucleotide” are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA, and chimeras of RNA and DNA. The terms polynucleotide, nucleotide sequence, or nucleic acid refer to a nucleotide chain, regardless of chain length. Nucleic acids can be double-stranded or single-stranded. In the case of a single-stranded nucleic acid, it can be a sense strand or an antisense strand. Nucleic acids can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphate-thioester nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids with altered base-pairing capabilities or enhanced resistance to nucleases. This disclosure further provides a nucleic acid that is a complementary sequence (which can be a fully complementary or partially complementary sequence) of the nucleic acid, nucleotide sequence, or polynucleotide of this disclosure. When dsRNA is generated synthetically, less common bases (such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine, etc.) can also be used for antisense strand, dsRNA, and ribozyme pairing. Other modifications can also be made, such as modifications to the phosphodiester backbone, or modifications to the 2'-fluorine, 2'-hydroxyl, or 2'-O-methyl groups of the RNA ribose group.

[0089] The term "isolated" can refer to a nucleic acid, nucleotide sequence, or polypeptide that is substantially free of cellular material, viral material, and / or culture medium (when produced using recombinant DNA technology), or chemical precursors or other chemicals (when chemically synthesized). Furthermore, "isolated fragment" refers to a fragment of a nucleic acid, nucleotide sequence, or polypeptide that is not naturally present in fragment form and cannot be found in its natural state. "Isolated" does not imply that the preparation is technically pure (homogeneous), but its purity is sufficient to provide a polypeptide or nucleic acid in a form suitable for its intended purpose.

[0090] The terms “region” and “fragment” are used interchangeably and specifically apply to oligonucleotides.

[0091] Unless otherwise stated, the LPA mRNA sequence described herein shall be understood to refer to a full-length LPA mRNA nucleotide sequence. In some embodiments, the LPA mRNA sequence may be a nucleotide sequence of reduced length relative to a reference nucleic acid or LPA mRNA sequence, comprising, substantially comprising, and / or comprising a nucleotide sequence of consecutive nucleotides identical or substantially identical (e.g., 60%, 70%, 80%, 90%, 92%, 95%, 98%, or 99% identical) to, the reference nucleic acid or nucleotide sequence. Where appropriate, such nucleic acid fragments according to this disclosure may be incorporated into larger polynucleotides as constituents thereof. In some embodiments, such fragments may comprise, substantially comprising, and / or comprising, an oligonucleotide of at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200 or more consecutive nucleotides of a nucleic acid or nucleotide sequence according to this disclosure.

[0092] As used herein, “complementary” polynucleotides are those that can pair bases according to the standard Watson-Crick complementarity rule. Specifically, purines will pair with pyrimidine bases to form combinations such as guanine with cytosine (G:C) and adenine with thymine (A:T) (in the case of DNA) or adenine with uracil (A:U) (in the case of RNA). For example, the sequence “AGT” binds to the complementary sequence “TCA”. It should be understood that two polynucleotides can hybridize with each other even if they are not perfectly complementary, provided that each has at least one substantially complementary region.

[0093] As used herein, the term "substantially complementary" means complementary to at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of a sense strand that is substantially identical to the nucleotide sequence defined in the region defined in SEQ ID NO: 1. As used herein, the term "substantially complementary" means that two nucleic acid sequences are complementary at least about 90%, 95%, or 99% of their nucleotides.

[0094] In some embodiments, the two nucleic acid sequences may be complementary at at least 90%, 95%, 96%, 97%, 98%, 99% or more of their nucleotides. In some embodiments, the two nucleic acid sequences may be complementary between 90% and 95%, between 70% and 100%, between 95% and 96%, between 90% and 100%, between 96% and 97%, between 60% and 80%, between 97% and 98%, between 70% and 90%, between 98% and 99%, between 80% and 100%, or between 99% and 100%.

[0095] The term "substantially complementary" can also mean that two nucleic acid sequences, namely the sense and antisense strands, are sufficiently complementary to allow binding between the sense and antisense strands to form a double-stranded region of 19-25 nucleotides in length. The term "substantially complementary" can also mean that the two nucleic acid sequences can hybridize under highly stringent conditions, and such conditions are well known in the art.

[0096] As used herein, the terms “substantially identical” or “sufficiently identical” that are interchangeable herein mean that the nucleotide sequence within the defined region of SEQ ID NO: 1 is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% (e.g., between 70% and 80%, 8% and 90%, 90% and 95%, 95% and 99%, or 99% and 100%) identical.

[0097] As used herein, the term "identity" means comparing sequences to each other as follows. To determine the percentage of identity between two nucleic acid sequences, the sequences are first aligned relative to each other to make subsequent comparisons possible. For this purpose, for example, a vacancy can be inserted into the sequence of the first nucleic acid sequence, and the nucleotide can be compared to its corresponding position in the second nucleic acid sequence. If a position in the first nucleic acid sequence is occupied by the same nucleotide as its corresponding position in the second sequence, then the two sequences are identical at that position. The percentage of identity between two sequences is a function of the number of identical positions divided by the total number of positions compared in the sequence under study.

[0098] For the aligned segments of the test and reference sequences, the “identity percentage” or “identity %” used interchangeably in this paper is the percentage of the common components shared by the two aligned sequences divided by the total number of components in the reference sequence segment (i.e., the entire reference sequence or a smaller defined portion of the reference sequence).

[0099] Unless otherwise stated, “nucleotide sequence” and “nucleic acid sequence” are used interchangeably in this document.

[0100] The percentage of identity between two sequences can be determined using a mathematical algorithm. A preferred, but not limiting, example of a mathematical algorithm that can be used to compare two sequences is the algorithm of Karlin et al. (1993), PNAS USA, 90:5873-5877. Such an algorithm is integrated into the NBLAST procedure, which can be used to identify sequences with the desired identity to the sequences disclosed herein. To obtain gap-aligned sequences as described herein, a "gap-aligned BLAST" procedure, such as that described in Altschul et al. (1997), Nucleic Acids Res, 25:3389-3402, can be used. If using BLAST and gap-aligned BLAST procedures, preset parameters of the specific procedure (e.g., NBLAST) can be used. The sequences can be further aligned using GAP (Global Alignment Program) version 9 of the Genetic Computational Groups, using a preset (BLOSUM62) matrix (values ​​ranging from -4 to +11), a vacancy opening penalty of -12 (for the first zero of a vacancy), and a vacancy extension penalty of -4 (for each additional consecutive zero in a vacancy). After alignment, the percentage of identity is calculated by expressing the number of consistent sites as a percentage of the nucleic acid content in the claimed sequence. If necessary, the methods described for determining the percentage of identity between two nucleic acid sequences can also be applied correspondingly to the encoded amino acid sequences.

[0101] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers (edited by Martin J. Bishop, Academic Press, San Diego (1994)) and Carillo, H. and Lipton, D. (Applied Math 48:1073 (1988)). More specifically, preferred computer programs for determining sequence identity include, but are not limited to, the Basic Local Alignment Search Tool (BLAST) program, which is publicly available from the National Center for Biotechnology Information (NCBI) of the National Library of Medicine, National Institutes of Health (Bethesda, Md. 20894); see BLAST Anual, Altschul et al., NCBI, NLM, NIH (Altschul et al., J. Mol. Biol. 215:403-410 (1990)); BLAST program version 2.0 or higher allows the introduction of vacancies (deletions and insertions) in the alignment; for peptide sequences, BLASTX can be used to determine sequence identity; and for polynucleotide sequences, BLASTN can be used to determine sequence identity. The identity percentage can be 70% or higher, such as at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity.

[0102] As used herein, "heterologous" refers to a nucleic acid sequence originating from another species, or a nucleic acid sequence from the same species or organism but modified from its original form or the form predominantly expressed in its cells. Therefore, a nucleotide sequence originating from an organism or species different from the cell to which the nucleotide sequence is to be introduced is heterologous relative to that cell and its progeny. Furthermore, heterologous nucleotide sequences include nucleotide sequences originating from the same natural original cell type and inserted therein, but existing in a non-natural state, such as having a different copy number and / or being controlled by regulatory sequences different from those found in nature.

[0103] Double-stranded RNA targeting human lipoprotein(a) (Lp(a))

[0104] This disclosure provides isolated oligonucleotides comprising a double-stranded region of double-stranded RNA (dsRNA) that targets LPA mRNA sequences for degradation. The double-stranded RNA molecules of this disclosure can be in the form of any type of RNA interference molecule known in the art. In some embodiments, the double-stranded RNA molecule is a small interfering RNA (siRNA). In other embodiments, the double-stranded RNA molecule is a short hairpin RNA (shRNA) molecule. In other embodiments, the double-stranded RNA molecule is a Dicer substrate processed in the cell to produce siRNA. In other embodiments, the double-stranded RNA molecule is part of a microRNA precursor molecule.

[0105] In some embodiments, dsRNA is a small interfering RNA (siRNA) that targets the LPA mRNA sequence for degradation. In some embodiments, the siRNA targeting Lp(a) is packaged in a delivery system (e.g., nanoparticles) described herein.

[0106] The isolated oligonucleotides of this disclosure targeting Lp(a) for degradation may contain at least 70% identical sense strands to any fragment of LPA mRNA (e.g., the LPA mRNA of SEQ ID NO: 1). In some embodiments, the sense strand contains or is substantially composed of at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical sequences to any fragment of SEQ ID NO: 1. The siRNA targeting Lp(a) for degradation may contain at least 70% identical antisense strands to any fragment of LPA mRNA (e.g., the LPA mRNA of SEQ ID NO: 1). In some embodiments, the antisense strand contains or is substantially composed of at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical sequences to any fragment of SEQ ID NO: 1. In some embodiments, the sense and antisense regions are complementary, and base pairing forms an RNA duplex structure. A fragment of LPAmRNA that has the same percentage of identity with the sense region of siRNA and is complementary to the antisense region of siRNA can be a protein-coding sequence of mRNA, an untranslated region (UTR) of mRNA (5' UTR or 3' UTR), or both.

[0107] In some embodiments, the isolated oligonucleotides of this disclosure comprise a sense region and an antisense region complementary to the sense region, which together form an RNA duplex, and the sense region comprises at least 70% of the same sequence as the LPA mRNA sequence. In some embodiments, the sense region is identical to the LPA mRNA sequence.

[0108] As used herein, the term "sense strand" or "sense region" refers to a nucleotide sequence of an siRNA molecule that is partially or completely complementary to at least a portion of the corresponding antisense strand or antisense region of the siRNA molecule. The sense strand of the isolated oligonucleotide of the disclosed molecules may include a nucleic acid sequence having a certain percentage of identity with a target nucleic acid sequence (such as an LPA mRNA sequence). In some cases, the sense region may have 100% identity with the target nucleic acid sequence, i.e., complete identity or homology. In other cases, one or more mismatches may exist between the sense region and the target nucleic acid sequence. For example, there may be 1, 2, 3, 4, 5, 6, or 7 mismatches between the sense region and the target nucleic acid sequence.

[0109] As used herein, the terms "antisense strand" or "antisense region" refer to the nucleotide sequence of the isolated oligonucleotide of this disclosure, which is partially or completely complementary to at least a portion of the target nucleic acid sequence. The antisense strand of the isolated oligonucleotide of the molecules disclosed herein may include a nucleic acid sequence complementary to at least a portion of the corresponding sense strand of the isolated oligonucleotide.

[0110] In some embodiments, the meaningful region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO: 1 disclosed herein or the region of SEQ ID NO: 1. In some embodiments, the meaningful region comprises a sequence that is identical to the sequence of SEQ ID NO: 1 disclosed herein or the region of SEQ ID NO: 1. In some embodiments, the meaningful region comprises a sequence that is essentially identical to the sequence of SEQ ID NO: 1 disclosed herein or the region of SEQ ID NO: 1.

[0111] In some embodiments, the sense region of the isolated oligonucleotide of this disclosure targeting Lp(a) has one or more mismatches between the sequence of the isolated oligonucleotide and the Lp(a) sequence. For example, the sequence of the sense region may have 1, 2, 3, 4, or 5 mismatches between the sequence of the sense region of the isolated oligonucleotide and the Lp(a) sequence. In some embodiments, the Lp(a) sequence is the Lp(a) 3' untranslated region (3' UTR) sequence. It is not intended to be theoretically rigorous, but it is believed that the mismatch tolerance of siRNA targeting the 3' UTR is higher than that of mismatches in isolated oligonucleotides targeting gene coding regions. Furthermore, the isolated oligonucleotide RNA is tolerant of mismatches outside the seed region. As used herein, the "seed region" of the isolated oligonucleotide refers to base pairs 2-8 of the antisense region of the isolated oligonucleotide, i.e., the strand of the isolated oligonucleotide that is complementary to and hybridizes with the target mRNA.

[0112] In some embodiments, the antisense region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence complementary to or the region of SEQ ID NO: 1 disclosed herein. In some embodiments, the antisense region is substantially composed of a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence complementary to or the region of SEQ ID NO: 1. In some embodiments, the antisense region comprises a sequence identical to the sequence complementary to or the region of SEQ ID NO: 1. In some embodiments, the sense region is substantially composed of a sequence complementary to or the region of SEQ ID NO: 1.

[0113] The antisense and sense regions of the isolated oligonucleotides targeting Lp(a) disclosed herein are complementary. In some embodiments, the sense and antisense regions are perfectly complementary (no mismatches). In some embodiments, the antisense and sense regions are partially complementary, i.e., there are 1, 2, 3, 4, or 5 mismatches between the sense and antisense regions.

[0114] Generally, the isolated oligonucleotides of this disclosure comprise RNA duplexes of about 16 to about 25 nucleotides in length. In some embodiments, the length of the RNA duplex is between about 17 and about 24 nucleotides, between about 18 and about 23 nucleotides, or between about 19 and about 22 nucleotides. In some embodiments, the length of the RNA duplex is 19 nucleotides. In some embodiments, the length of the RNA duplex is 20 nucleotides.

[0115] In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of this disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments, both the sense strand and the antisense strand are single-stranded RNA molecules. In some embodiments, the isolated oligonucleotides of this disclosure are siRNAs targeting Lp(a) that comprise two distinct single-stranded RNAs, the first containing a sense region and the second containing an antisense region, which hybridize to form an RNA duplex.

[0116] In some embodiments, the isolated oligonucleotides of this disclosure may have one or more overhangs from a double-stranded region. In some embodiments, the overhangs are non-base-paired single-stranded regions of one to eight nucleotides or longer. In some embodiments, the overhangs may be 3' overhangs, wherein the 3' end of the chain has a single-stranded region of one to eight nucleotides. In some embodiments, the overhangs may be 5' overhangs, wherein the 5' end of the chain has a single-stranded region of one to eight nucleotides. In some embodiments, the overhangs of the isolated oligonucleotides have the same length. In some embodiments, the overhangs of the isolated oligonucleotides have different lengths.

[0117] In some embodiments of the isolated oligonucleotides disclosed herein, the sense single-stranded RNA molecule includes a 3' overhang. In some embodiments, the 3' overhang of the sense single-stranded RNA molecule includes at least one nucleotide. In some embodiments, the 3' overhang of the sense single-stranded RNA molecule includes two nucleotides.

[0118] In some embodiments of the isolated oligonucleotides disclosed herein, the antisense single-stranded RNA molecule includes a 3' overhang. In some embodiments, the 3' overhang of the antisense single-stranded RNA molecule includes at least one nucleotide. In some embodiments, the 3' overhang of the antisense single-stranded RNA molecule includes two nucleotides.

[0119] In some embodiments of the isolated oligonucleotides disclosed herein, the isolated oligonucleotides have overhangs at both ends, for example, a 3' dinucleotide overhang at each end. In some embodiments, the overhangs at the 5' and 3' ends have different lengths. In some embodiments, the overhangs at the 5' and 3' ends have the same length.

[0120] In some embodiments of the isolated oligonucleotides disclosed herein, the overhang may contain one or more deoxyribonucleotides, one or more ribonucleotides, or a combination of deoxyribonucleotides and ribonucleotides. In some embodiments, one or both of the overhang nucleotides of the siRNA may be 2'-deoxyribonucleotides.

[0121] In some embodiments of the isolated oligonucleotides disclosed herein, the first single-stranded RNA molecule includes a first 3' overhang. In some embodiments, the second single-stranded RNA molecule includes a second 3' overhang. In some embodiments, the first and second 3' overhangs comprise dinucleotides.

[0122] In some embodiments of the isolated oligonucleotides of this disclosure, the 3' overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cysteine-cysteine ​​(CC), guanine-guanine (GG), or uracil-uracil (UU). In some embodiments, the 3' overhang of the isolated oligonucleotides of this disclosure comprises a thymidine-thymidine (dTdT) or uracil-uracil (UU) overhang. In some embodiments, the 3' overhang comprises a uracil-uracil (UU) overhang. It is not intended to be theoretically construed that 3' overhangs (such as dinucleotide overhangs) enhance siRNA-mediated mRNA degradation by enhancing the rate of siRNA-RISC complex formation and / or siRNA-RISC complex cleavage of target mRNA.

[0123] In some embodiments, the isolated oligonucleotides of this disclosure may have one or more blunt ends, wherein the duplex region has no overhangs at its ends, and the two strands pair with the terminal bases of the duplex region. In some embodiments, the isolated oligonucleotides of this disclosure may have one or more blunt ends, or one or more overhangs, or a combination of blunt ends and overhangs. For example, the 5' end of siRNA may be blunt, and the 3' end of the same isolated oligonucleotide may contain an overhang, or vice versa.

[0124] In some embodiments, the isolated oligonucleotides of this disclosure have blunt ends at both ends.

[0125] In some embodiments of the isolated oligonucleotides disclosed herein, the double-stranded region comprises an antisense strand and a sense strand, according to either of the antisense and sense strand sequence pairs in Tables 1-6, as described below.

[0126] Therefore, the isolated oligonucleotides disclosed herein can be used to treat or prevent diseases or conditions associated with abnormal or increased expression or activity of Lp(a), or diseases or conditions in which Lp(a) plays a role. Exemplary isolated oligonucleotides of this disclosure are described in Tables 1-6. In some embodiments of the isolated oligonucleotides of this disclosure, the sense strand comprises a sequence selected from the group consisting of sense / guest strand sequences listed in Tables 1-6. In some embodiments, the antisense strand comprises a sequence selected from the group consisting of antisense / guide strand sequences listed in Tables 1-6. In some embodiments, the sense and antisense regions comprise complementary sequences selected from the group consisting of sequences listed in Tables 1-6.

[0127] In some embodiments of the isolated oligonucleotides disclosed herein, the antisense strand comprises a nucleotide sequence according to any of the following: SEQ ID NO: 2-11 and 13-22.

[0128] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises a nucleotide sequence according to any of the following: SEQ ID NO: 23-30, 32-41, 550, and 551.

[0129] In some embodiments of the isolated oligonucleotides disclosed herein, the antisense strand comprises a nucleotide sequence according to any of the following: SEQ ID NO: 2-11 and 13-22; and the sense strand comprises a nucleotide sequence according to any of the following: SEQ ID NO: 23-30, 32-41, 550 and 551, wherein the antisense and sense strand sequences are sufficiently complementary to allow for the formation of a double-stranded region between the antisense and sense strands.

[0130] This disclosure also provides an isolated oligonucleotide comprising a sense strand selected from SEQ ID NO: 2-22 and 42-295 and its corresponding antisense strand selected from SEQ ID NO: 23-41 and 296-551, as shown in Table 2.

[0131] In some embodiments of the isolated oligonucleotides, the sense strand comprises a modified sequence selected from SEQ ID NO: 2-22 and 42-295, and its corresponding antisense strand is selected from SEQ ID NO: 23-41 and 296-551, as shown in Table 2; the sense strand comprises a modified sequence as shown in SEQ ID NO: 552-845, 1372-1378, 1383-1384, 1386-1387 and 1395-1396, and its corresponding antisense strand comprises a sequence selected from SEQ ID NO: 573-1101, 1379-1380, 1385 and 1388, as shown in Table 6.

[0132] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NO: 2-22, and its corresponding antisense strand comprises a sequence selected from 23-41 and 550-551, as shown in Table 1.

[0133] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NO: 2, 6, 16, 18, 552, 556, 568, 566, 1377-1378, 1383-1384, 1386-1387, and 1395-1396, and its corresponding antisense strand is selected from SEQ ID NO: 575, 585, 587, 1100, 1379-1380, 1385, and 1388, as shown in Table 3.

[0134] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NO: 2, 6, 18, 552, 556 and 568, and its corresponding antisense strand is selected from SEQ ID NO: 575, 587, 1100, 1379-1380 and 1385, as shown in Table 4.

[0135] In some embodiments of the isolated oligonucleotide, the sense strand comprises a sequence selected from SEQ ID NO: 18, 568 and 1383-1384, and its corresponding antisense strand is selected from SEQ ID NO: 587 and 1380, as shown in Table 5.

[0136] In some embodiments of the isolated oligonucleotide, the sense strand comprises the sequence shown in SEQ ID NO: 18, and its corresponding antisense strand comprises the sequence shown in SEQ ID NO: 37.

[0137] In some embodiments of the isolated oligonucleotide, the sense strand comprises a modified sequence as shown in SEQ ID NO: 568, and its corresponding antisense strand comprises a modified sequence as shown in SEQ ID NO: 587.

[0138] In some embodiments of the isolated oligonucleotide, the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 2 (5'UUCGAUAACUCUGUCCAUCACC 3') and a sense strand according to the nucleic acid sequence of SEQ ID NO: 550 (5'UGAUGGACAGAGUUAUCGAA 3'); ii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 3 (5'UCAUUUGGGUAGUUUUCUGUGG 3') and a sense strand according to the nucleic acid sequence of SEQ ID NO: 551 (5'ACAGAAAACUACCCAAAUGA 3'); iii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 4 (5'UUGGUGUCAUAGAUGACCAAGC 3') and a sense strand according to the nucleic acid sequence of SEQ ID NO: 23 (5'UUGGUCAUCUAUGACACCAA 3'); iv) according to SEQ ID NO: 5 The antisense strand of the nucleic acid sequence (5'UAAGCCAGCAUUUGGGUAGUAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'ACUACCCAAAUGCUGGCUUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UAGACUGACAUGUCCUUCCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'AGGAAGGACAUGUCAGUCUA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UAGUUGCAAGGACACUUGAUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'AUCAAGUGUCCUUGCAACUA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UCGAUAACUCUGUCCAUCACCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 27 viii) The sense strand of the nucleic acid sequence (5'GUGAUGGACAGAGUUAUCGA 3'); viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UUAACUCUGUCCAUCACCAUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'AUGGUGAUGGACAGAGUUAA 3');ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UUGAGCAUUGUGUCAGGUUGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'CAACCUGACACAAUGCUCAA 3'); x) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UGAUAACUCUGUCCAUCACCAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'GGUGAUGGACAGAGUUAUCA 3'); xi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UAUAACUCUGUCCAUUACCGUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'CGGUAAUGGACAGAGUUAUA 3'); xii) The nucleic acid sequence according to SEQ ID NO: 13 (5'UUCAUAGAUGACCAAGCUUGGC xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 3' (5'CAAGCUUGGUCAUCUAUGAA 3'); xiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAUAACUCUGUCCAUCACCAUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UGGUGAUGGACAGAGUUAUA 3'); xiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UUGUCAUAGAUGACCAAGCUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'AGCUUGGUCAUCUAUGACAA 3'); xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UAAUGUGCCUCGAUAACUCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 35 xvi) The sense strand of the nucleic acid sequence (5'AGAGUUAUCGAGGCACAUUA 3'); xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UGAGCAUUGUGUCAGGUUGCAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'GCAACCUGACACAAUGCUCA 3');xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAUGACCAAGCUUGGCAAGUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'CUUGCCAAGCUUGGUCAUCA 3'); xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UACCAAGCUUGGCAAGUUCUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'AGAACUUGCCAAGCUUGGUA 3'); xix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAGUGUGGUGUCAUAGAUGACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'UCAUCUAUGACACCACACUA 3'); xx) The nucleic acid sequence according to SEQ ID NO: 21 (5'UCUCUGUCCAUCACCAUGGUAG... 3') The antisense strand of the nucleic acid sequence and the sense strand according to the nucleic acid sequence of SEQ ID NO: 40 (5'ACCAUGGUGAUGGACAGAGA 3'); xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UGUGCCUCGAUAACUCUGUCCA 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 41 (5'GACAGAGUUAUCGAGGCACA 3'); xxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'UGUGGUGUCAUAGAUGACCAAG 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 296 (5'UGGUCAUCUAUGACACCACA 3'); xxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'UAGUGGUGGAGAAUGAGCCUCG 3') and the sense strand according to SEQ ID NO: 297 The sense strand of the nucleic acid sequence (5'AGGCUCAUUCUCCACCACUA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UCCUCGAUAACUCUGUCCAUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 298 (5'AUGGACAGAGUUAUCGAGGA 3');xxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UUAGAUGACCAAGCUUGGCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 299 (5'UGCCAAGCUUGGUCAUCUAA 3'); xxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'UAGCAUUGUGUCAGGUUGCAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 300 (5'UGCAACCUGACACAAUGCUA 3'); xxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'UAGAAUGUGCCUCGAUAACUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 301 (5'AGUUAUCGAGGCACAUUCUA 3'); xxviii) According to SEQ ID NO: 48 The antisense strand of the nucleic acid sequence (5'UGUCAUAGAUGACCAAGCUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 302 (5'AAGCUUGGUCAUCUAUGACA 3'); xxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'UAACUCUGUCCAUCACCAUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 303 (5'CAUGGUGAUGGACAGAGUUA 3'); xxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'UGCCUCGAUAACUCUGUCCAUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5'UGGACAGAGUUAUCGAGGCA 3'); xxxi) The sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UAGUAGUUCCUGGUCAGGCCAG xxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 305 (5'GGCCUGACCAGGAACUACUA 3'); xxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'UCUUUUCUCAGGUGGUGCUUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 306 (5'AAGCACCACCUGAGAAAAGA 3');xxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'UGAAUGUGCCUCGAUAACUCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 307 (5'GAGUUAUCGAGGCACAUUCA 3'); xxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'UAUGACCAAGCUUGGCAGGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 308 (5'ACCUGCCAAGCUUGGUCAUA 3'); xxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'UUGACCAAGCUUGGCAAGUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 309 (5'AACUUGCCAAGCUUGGUCAA 3'); xxxvi) According to SEQ ID NO: 56 The antisense strand of the nucleic acid sequence (5'UGCCACAGGAUCUGGAUUUCGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 310 (5'GAAAUCCAGAUCCUGUGGCA 3'); xxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'UCUGAGCAUUGUGUCAGGUUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 311 (5'AACCUGACACAAUGCUCAGA 3'); xxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'UACUCUGUCCAUCACCAUGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 312 (5'CCAUGGUGAUGGACAGAGUA 3'); xxxix) According to SEQ ID NO: 59 (5'UAUGUGCCUCGAUAACUCUGGC) x1) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 313 (5'CAGAGUUAUCGAGGCACAUA 3'); x2) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'UUAGAUGACCAAGCUUGGCAAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 314 (5'UGCCAAGCUUGGUCAUCUAA 3');xli) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'UGAGUUGCAAGGACACUUGAUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 315 (5'UCAAGUGUCCUUGCAACUCA 3'); xlii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UGAGUGUGGUGUCAUAGAUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 316 (5'CAUCUAUGACACCACACUCA 3'); xliii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'UUGACCAAGCUUGGCAGGUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 317 (5'AACCUGCCAAGCUUGGUCAA 3'); xliv) According to SEQ ID NO: 64 xlv) The antisense strand of the nucleic acid sequence (5'UGCUCAGUCGGUGCUUGUUCGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 318 (5'GAACAAGCACCGACUGAGCA 3'); xlv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UGAGAAUGAGCCUCGAUAACUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 319 (5'GUUAUCGAGGCUCAUUCUCA 3'); xlvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'UUUGCAAGGACACUUGAUUCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 320 (5'GAAUCAAGUGUCCUUGCAAA 3'); xlvii) The sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'UUGCAGUACUCCCAUCUGACAC xlviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 321 (5'GUCAGAUGGGAGUACUGCAA 3'); xlviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'UACAGUGGUGGAGAAUGUGCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 322 (5'GCACAUUCUCCACCACUGUA 3');x1) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'UAUAGAUGACCAAGCUUGGCAG 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 323 (5'GCCAAGCUUGGUCAUCUAUA 3'); l) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5'UAUUGUGUCAGGUUGCAGUACU 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 324 (5'UACUGCAACCUGACACAAUA 3'); li) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'UGUCCAUCACCAUGGUAGCAAU 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 325 (5'UGCUACCAUGGUGAUGGACA 3'); lii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5'UUGGUGUCAUGGAUGACCAAGA 3') The antisense strand of the nucleic acid sequence and the sense strand according to the nucleic acid sequence of SEQ ID NO: 326 (5'UUGGUCAUCCAUGACACCAA 3'); liii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5'UAUCAAGCCAGCAUUUGGGUAG 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 327 (5'ACCCAAAUGCUGGCUUGAUA 3'); liv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'UCACCAUGGUAGCAAUCCUGGA 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 328 (5'CAGGAUUGCUACCAUGGUGA 3'); lv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5'UAGUAGUUCCUGGUCAGGCCAC 3') and the sense strand according to SEQ ID NO: 329 sense strand of the nucleic acid sequence (5'GGCCUGACCAGGAACUACUA 3'); antisense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5'UCCAAGCUUGGCAGGUCCUUCC 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 330 (5'AAGGACCUGCCAAGCUUGGA 3');lvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5'UAGUCGGUGCUUGUUCGGAAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 331 (5'UUCCGAACAAGCACCGACUA 3'); lviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5'UCGUCAGGUUGCAGUACUCCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 332 (5'GGAGUACUGCAACCUGACGA 3'); lix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UACUGACAUGUCCUUCCUGUAA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 333 (5'ACAGGAAGGACAUGUCAGUA 3'); lx) According to SEQ ID NO: 80 The antisense strand of the nucleic acid sequence (5'UUUUUCUCAGGUGGUGCUUGUU 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 334 (5'CAAGCACCACCUGAGAAAAA 3'); lxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'UCUGCGUCUGAGCAUUGUGUCA 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 335 (5'ACACAAUGCUCAGACGCAGA 3'); lxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'UAAGACUGACAUGUCCUUCCUG 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 336 (5'GGAAGGACAUGUCAGUCUUA 3'); lxiii) the sense strand according to SEQ ID NO: 83 (5'UAACAAUAAGGGGCUGCCACAG The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5'GUGGCAGCCCCUUAUUGUUA 3'); lxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5'UAACACCAAGGGCGAAUCUCAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 338 (5'GAGAUUCGCCCUUGGUGUUA 3');lxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUGCAGUACUCCCAUCUGACAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 339 (5'GUCAGAUGGGAGUACUGCAA 3'); lxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5'UCUGCAGUAGUUCCUGGUCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 340 (5'UGACCAGGAACUACUGCAGA 3'); lxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5'UUCAGUUGGUGCUUCUUCAGAA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 341 (5'CUGAAGAAGCACCAACUGAA 3'); lxviii) According to SEQ ID NO: 88 The antisense strand of the nucleic acid sequence (5'UGUACUCCCACCUGACACUGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 342 (5'CAGUGUCAGGUGGGAGUACA 3'); lxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5'UAGGUUGCAGUACUCCCAUCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5'GAUGGGAGUACUGCAACCUA 3'); lxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5'UCUCGAUAACUCUGUCCAUCAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 344 (5'GAUGGACAGAGUUAUCGAGA 3'); lxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5'UCAAGACUGACAUGUCCUUCCU The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 345 (5'GAAGGACAUGUCAGUCUUGA 3'); lxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5'UACUUGAUUCUGUCACUGGACA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5'UCCAGUGACAGAAUCAAGUA 3');lxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5'UAAUAUUCUGUUGUCCUCUGAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5'CAGAGGACAACAGAAUAUUA 3'); lxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 94 (5'UGUAUAACAAUAAGGGGCUGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 348 (5'CAGCCCCUUAUUGUUAUACA 3'); lxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'UUCAGGCCACCAUUUGGGUAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 349 (5'UACCCAAAUGGUGGCCUGAA 3'); lxxvi) According to SEQ ID NO: 96 The antisense strand of the nucleic acid sequence (5'UAUAAUAUUCUGUUGUCCUCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 350 (5'GAGGACAACAGAAUAUUAUA 3'); lxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5'UAUGAGCCUCGAUAACUCUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351 (5'CAGAGUUAUCGAGGCUCAUA 3'); lxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'UCUCUAGGCUUGGAACCGGGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 352 (5'CCCGGUUCCAAGCCUAGAGA 3'); lxxix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UGAUAAUAUUCUGUUGUCCUCUG 3'). The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 353 (5'AGGACAACAGAAUAUUAUCA 3'); the antisense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5'UUGCAGUACUCCCACCUGACAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5'GUCAGGUGGGAGUACUGCAA 3');lxxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5'UACAUGUCCUUCCUGUGACAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 355 (5'UGUCACAGGAAGGACAUGUA 3'); lxxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5'UCAAUAAGGGGCUGCCACAGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 356 (5'CUGUGGCAGCCCCUUAUUGA 3'); lxxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5'UUGUGGUGUCAUAGAGGACCAA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357 (5'GGUCCUCUAUGACACCACAA 3'); lxxxiv) According to SEQ ID NO: 104 The antisense strand of the nucleic acid sequence (5'UCCGUUGGUGCUUCUUCAGAAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 358 (5'UCUGAAGAAGCACCAACGGA 3'); lxxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5'UACCAAGACUGACAUGUCCUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359 (5'AGGACAUGUCAGUCUUGGUA 3'); lxxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'UAGAAUGAGCCUCGAUAACUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 360 (5'AGUUAUCGAGGCUCAUUCUA 3'); lxxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'UCUUGGCAGGUUCUUCCUGUGA The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 361 (5'ACAGGAAGAACCUGCCAAGA 3'); lxxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5'UUGCUCCGUUGGUGCUUCUUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 362 (5'AAGAAGCACCAACGGAGCAA 3');xxxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'UAUUCUGUUGUCCUCUGAUGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 363 (5'CAUCAGAGGACAACAGAAUA 3'); xc) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'UAAGCUUGGCAAGUUCUUCCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 364 (5'GGAAGAACUUGCCAAGCUUA 3'); xci) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'UCUGUCCAUCACCAUGGUAGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365 (5'CUACCAUGGUGAUGGACAGA 3'); xcii) According to SEQ ID NO: 112 xciii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5'UCAAGCUUGGCAAGUUCUUCCU 3') and the sense strand according to SEQ ID NO: 367 (5'GAAGAACUUGCCAAGCUUGA 3'); xciv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 (5'UGAGGACCAAGACUGACAUGUC 3') and the sense strand according to SEQ ID NO: 368 (5'CAUGUCAGUCUUGGUCCUCA 3'); xcv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 (5'UAGAUGACCAAGCUUGGCAAGU... The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369 (5'UUGCCAAGCUUGGUCAUCUA 3'); xcvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 (5'UAGGUUGCAGUACUCCCACCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5'GGUGGGAGUACUGCAACCUA 3');xcvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 (5'UCAUAGAGGACCAAGACUGACA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5'UCAGUCUUGGUCCUCUAUGA 3'); xcviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5'UGAGAAUGUGCCUCGAUAACUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5'GUUAUCGAGGCACAUUCUCA 3'); xcix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 (5'UAUUGACAUGUCCUUCCUGUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5'ACAGGAAGGACAUGUCAAUA 3'); c) According to SEQ ID NO: 120 The antisense strand of the nucleic acid sequence (5'UAUAUUCUGUUGUCCUCUGAUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5'UCAGAGGACAACAGAAUAUA 3'); c1) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5'UGCCACCAUUUGGGUAGUAUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5'AUACUACCCAAAUGGUGGCA 3'); cii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5'UGUAGUUUUCUGGGGUCCGACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5'UCGGACCCCAGAAAACUACA 3'); ciii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5'UCACUGGACAUUGUGUCAGGUU... The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5'CCUGACACAAUGUCCAGUGA 3'); civ) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5'UCCAGUGUGGUGUCAUAGAGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5'CUCUAUGACACCACACUGGA 3');cv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5'UGGACACUUGAUUCUGUCACCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5'GUGACAGAAUCAAGUGUCCA 3'); cvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5'UGUUGCAAGGACACUUGAUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 380 (5'AAUCAAGUGUCCUUGCAACA 3'); cvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 (5'UGCAAUCCUGGACCACAUGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5'CCAUGUGGUCCAGGAUUGCA 3'); cviii) the nucleic acid sequence according to SEQ ID NO: 128 The antisense strand of the nucleic acid sequence (5'UCAAGCUUGGCAGGUUCUUCCU 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 382 (5'GAAGAACCUGCCAAGCUUGA 3'); cix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5'UGAUCCAUGGUGUAACACCAAG 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 383 (5'UGGUGUUACACCAUGGAUCA 3'); cx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5'UUAAUAUUCUGUUGUCCUCUGA 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 384 (5'AGAGGACAACAGAAUAUUAA 3'); cxi) the sense strand according to SEQ ID NO: 131 (5'UUAACACCAAGGGGCUGCCACA The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5'UGGCAGCCCCUUGGUGUUAA 3'); cxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5'UCCAUCACCAUGGUAGCAAUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5'AUUGCUACCAUGGUGAUGGA 3');cxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5'UCUCAGCAUCUGGAUUCCUGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5'CAGGAAUCCAGAUGCUGAGA 3'); cxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5'UCACAGGAUCUGGAUUCCUGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5'CAGGAAUCCAGAUCCUGUGA 3'); cxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5'UGGCAGGUCCUUCCUGUGACAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5'GUCACAGGAAGGACCUGCCA 3'); cxvi) According to SEQ ID NO: 136 The antisense strand of the nucleic acid sequence (5'UGACUGACAUGUCCUUCCUGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 390 (5'CAGGAAGGACAUGUCAGUCA 3'); cxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5'UAUUCCUGCAGUAGUUCCUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5'CAGGAACUACUGCAGGAAUA 3'); cxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5'UCAUUGUGUCAGGUUGCAGUAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 392 (5'ACUGCAACCUGACACAAUGA 3'); cxix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5'UCAAGCCAGCAUUUGGGUAGUA The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 393 (5'CUACCCAAAUGCUGGCUUGA 3'); cxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5'UGACACUGGGAUCCAUGGUGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 394 (5'CACCAUGGAUCCCAGUGUCA 3');cxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5'UGACCAAGCUUGGCAAGUUCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 395 (5'GAACUUGCCAAGCUUGGUCA 3'); cxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 (5'UUCUGAGCAUUGUGUCAGGUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 396 (5'ACCUGACACAAUGCUCAGAA 3'); cxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 (5'UGCAUUGUGUCAGGUUGCAGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 397 (5'CUGCAACCUGACACAAUGCA 3'); cxxiv) According to SEQ ID NO: 144 The antisense strand of the nucleic acid sequence (5'UUUGCUCAGUUGGUGCUUGUUC 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 398 (5'ACAAGCACCAACUGAGCAAA 3'); cxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5'UCAUGGUAUAACACCAAGGGCG 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 399 (5'CCCUUGGUGUUAUACCAUGA 3'); cxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5'UAACUCUGUCCAUAAUGGUAGU 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 400 (5'UACCAUUAUGGACAGAGUUA 3'); cxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 147 (5'UCAGGAUCUGGAUUUCGGCAGU The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 401 (5'UGCCGAAAUCCAGAUCCUGA 3'); cxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5'UGAAUCUCAGCAUCUGGAUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 402 (5'AAUCCAGAUGCUGAGAUUCA 3');cxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5'UUGGUGGAGAAUGUGCCUCGAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 403 (5'CGAGGCACAUUCUCCACCAA 3'); cxxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5'UUCAGGCCAGCAUUUGGGUAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 404 (5'UACCCAAAUGCUGGCCUGAA 3'); cxxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5'UGCAUCUGGAUUCCUGCAGUAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 405 (5'ACUGCAGGAAUCCAGAUGCA 3'); cxxxii) According to SEQ ID NO: 152 The antisense strand of the nucleic acid sequence (5'UUGCCUCGAUAACUCUGUCCAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 406 (5'GGACAGAGUUAUCGAGGCAA 3'); cxxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5'UAGUCCCUUCUGCGUCUGAGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 407 (5'CUCAGACGCAGAAGGGACUA 3'); cxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5'UGGAUUUCGGCAGUAGUUCUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 408 (5'AGAACUACUGCCGAAAUCCA 3'); cxxxv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 155 (5'UGUGUCAUAGAUGACCAAGCUU The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 409 (5'GCUUGGUCAUCUAUGACACA 3'); cxxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5'UCUGACAUGUUCUUCCUGUGAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 410 (5'CACAGGAAGAACAUGUCAGA 3');cxxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5'UCUGGUCAGGCCAGCAUUUGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 411 (5'CAAAUGCUGGCCUGACCAGA 3'); cxxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 (5'UGUUUUCAGUUGGUGCUUCUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 412 (5'AGAAGCACCAACUGAAAACA 3'); cxxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5'UCUCUGAUGCCAGUGUGGUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 413 (5'CACCACACUGGCAUCAGAGA 3'); cxl) According to SEQ ID NO: 160 The antisense strand of the nucleic acid sequence (5'UAUCACCAUGGUAGCAAUCCUG 3') and the sense strand according to SEQ ID NO: 414 (5'GGAUUGCUACCAUGGUGAUA 3'); cxli) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 (5'UGUGGAGAAUGAGCCUCGAUAA 3') and the sense strand according to SEQ ID NO: 415 (5'AUCGAGGCUCAUUCUCCACA 3'); cxlii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5'UUUCUGUUGUCCUCUGAUGCCA 3') and the sense strand according to SEQ ID NO: 416 (5'GCAUCAGAGGACAACAGAAA 3'); cxliii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 (5'UCUGUCACUGGACAUUGUGUCA 3'). The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 417 (5'ACACAAUGUCCAGUGACAGA 3'); the antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 (5'UUGCUUGUUCAGAAGGAGCCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 418 (5'GGCUCCUUCUGAACAAGCAA 3');cxlv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5'UCUUUGCUCAGUCGGUGCUUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 419 (5'AAGCACCGACUGAGCAAAGA 3'); cxlvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5'UCUGUUGUCCUCUGAUGCCAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 420 (5'UGGCAUCAGAGGACAACAGA 3'); cxlvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5'UCCAAGCUUGGCAAGUUCUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 421 (5'AAGAACUUGCCAAGCUUGGA 3'); cxlviii) According to SEQ ID NO: 168 The antisense strand of the nucleic acid sequence (5'UAUGGUAGCAAUCCUGGACCCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 422 (5'GGUCCAGGAUUGCUACCAUA 3'); cxlix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5'UGUAUAACACCAAGGGCGAAUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 423 (5'UUCGCCCUUGGUGUUAUACA 3'); cl) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5'UGACACUGGGAUCCAUGGUAUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 424 (5'UACCAUGGAUCCCAGUGUCA 3'); cli) the sense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5'UCUUCCUGUGACAGUGGUGGAG The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 425 (5'CCACCACUGUCACAGGAAGA 3'); the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5'UUCCCACCUGACACUGGGAUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 426 (5'AUCCCAGUGUCAGGUGGGAA 3');clii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 173 (5'UGCAUUUGGGUAGUUUUCUGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 427 (5'CAGAAAACUACCCAAAUGCA 3'); cliv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 174 (5'UGAUCAAGCCAGCAUUUGGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 428 (5'CCCAAAUGCUGGCUUGAUCA 3'); clv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5'UGUAGCACUCCUGCACCCCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 429 (5'UGGGGUGCAGGAGUGCUACA 3'); clvi) According to SEQ ID NO: 176 The antisense strand of the nucleic acid sequence (5'UUUGGGUAGUUUUCUGGGGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 430 (5'ACCCCAGAAAACUACCCAAA 3'); clvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UGUCUGAGCAUUGUGUCAGGUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 431 (5'CCUGACACAAUGCUCAGACA 3'); clviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5'UGAUCCAUGGUAUAACACCAAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 432 (5'UGGUGUUAUACCAUGGAUCA 3'); clix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UACCUGACACUGGGAUCCAUGG The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 433 (5'AUGGAUCCCAGUGUCAGGUA 3'); clx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5'UGUGCUUCUUCAGAAGAAGCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 434 (5'GCUUCUUCUGAAGAAGCACA 3');clxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5'UUUUUCUGGGGUCCGACUAUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 435 (5'AUAGUCGGACCCCAGAAAAA 3'); clxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5'UGACAUUGGGAUCCAUGGUAUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 436 (5'UACCAUGGAUCCCAAUGUCA 3'); clxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 183 (5'UUAUUCUGUUGUCCUCUGAUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 437 (5'AUCAGAGGACAACAGAAUAA 3'); clxiv) The nucleic acid sequence according to SEQ ID NO: 184 The antisense strand of the nucleic acid sequence (5'UGACCACCGUGGGAGUUGUGAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 438 (5'CACAACUCCCACGGUGGUCA 3'); clxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5'UCUUGUUCGGAAGGAGCCUCUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 439 (5'GAGGCUCCUUCCGAACAAGA 3'); clxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5'UGGACAUUGUGUCAGGUUGCAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 440 (5'GCAACCUGACACAAUGUCCA 3'); clxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5'UAUAAGGGGCUGCCACAGGAUC clxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 441 (5'UCCUGUGGCAGCCCCUUAUA 3'); clxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5'UGCUUGGCAGGUCCUUCCUGUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 442 (5'CAGGAAGGACCUGCCAAGCA 3');clxix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5'UCUGCCACAGGAUCUGGAUUCC 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 443 (5'AAUCCAGAUCCUGUGGCAGA 3'); clxx) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5'UUCAAGCCAGCAUUUGGGUAGU 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 444 (5'UACCCAAAUGCUGGCUUGAA 3'); clxxi) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UUGCCUUGAUAACUCUGUCCAU 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 445 (5'GGACAGAGUUAUCAAGGCAA 3'); clxxii) According to SEQ ID NO: 192 The antisense strand of the nucleic acid sequence (5'UCCCCAGGCCUUUGCUCAGUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 446 (5'ACUGAGCAAAGGCCUGGGGA 3'); clxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 193 (5'UCGACUAUGCUGGUGUGGUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 447 (5'CACCACACCAGCAUAGUCGA 3'); clxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5'UGGGCGAAUCUCAGCAUCUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 448 (5'CAGAUGCUGAGAUUCGCCCA 3'); clxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5'UGCCUUUGCUCAGUUGGUGCUU The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 449 (5'GCACCAACUGAGCAAAGGCA 3'); clxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5'UUAUGCUGGUGUGGUGUCAUAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 450 (5'AUGACACCACACCAGCAUAA 3');clxxvii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 197 (5'UUUUUCAGUUGGUGCUUCUUCA 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 451 (5'AAGAAGCACCAACUGAAAAA 3'); clxxviii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5'UGAGCCUCUAGGCUUGGAACCG 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 452 (5'GUUCCAAGCCUAGAGGCUCA 3'); clxxix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5'UCUGAGCAUCGCGUCAGGUUGC 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 453 (5'AACCUGACGCGAUGCUCAGA 3'); clxxx) According to SEQ ID NO: 200 The antisense strand of the nucleic acid sequence (5'UAUGACCAAGCUUGGCAAGUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 454 (5'ACUUGCCAAGCUUGGUCAUA 3'); clxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5'UUGUCCUCUGAUGCCAGUGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 455 (5'ACACUGGCAUCAGAGGACAA 3'); clxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5'UGUUCCUGGUCAGGCCAGCAUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 456 (5'UGCUGGCCUGACCAGGAACA 3'); clxxxiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5'UCUGGGAUCCAUGGUAUAACACA 3'). The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 457 (5'GUUAUACCAUGGAUCCCAGA 3'); clxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5'UCCAGGCCUUUGCUCAGUUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 458 (5'CAACUGAGCAAAGGCCUGGA 3');clxxxv) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5'UGUUGCAGUACUCCCACCUGAU 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 459 (5'CAGGUGGGAGUACUGCAACA 3'); clxxxvi) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5'UGGAGAAUGUGCCUCGAUAACU 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 460 (5'UUAUCGAGGCACAUUCUCCA 3'); clxxxvii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5'UCUGGACCCCGGGGCUUUGCUC 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 461 (5'GCAAAGCCCCGGGGUCCAGA 3'); clxxxviii) According to SEQ ID NO: Antisense strand of SEQ ID NO: 208 (5'UCACAUGGCUUUGCUCAGGUGC 3') and sense strand of SEQ ID NO: 462 (5'ACCUGAGCAAAGCCAUGUGA 3'); clxxxix) Antisense strand of SEQ ID NO: 209 (5'UCUGCAUCUGAGCAUCGUGUCA 3') and sense strand of SEQ ID NO: 463 (5'ACACGAUGCUCAGAUGCAGA 3'); cxc) Antisense strand of SEQ ID NO: 210 (5'UUGACCAAGAUUGACAUGUCCU 3') and sense strand of SEQ ID NO: 464 (5'GACAUGUCAAUCUUGGUCAA 3'); cxci) Antisense strand of SEQ ID NO: 211 (5'UGGGGCUGCCACAGGAUCUGGA The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 465 (5'CAGAUCCUGUGGCAGCCCCA 3'); the antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5'UACCGUGGGAGUUGUGAGGAGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 466 (5'UCCUCACAACUCCCACGGUA 3');cxciii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 213 (5'UCAGAAGGAGCCUCUAGGCUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 467 (5'AGCCUAGAGGCUCCUUCUGA 3'); cxciv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5'UUCCUGCAGUAGUUCAUUGUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 468 (5'ACAAUGAACUACUGCAGGAA 3'); cxcv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5'UGGACACUUGAUUCUGUCACUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 469 (5'GUGACAGAAUCAAGUGUCCA 3'); cxcvi) According to SEQ ID NO: 216 The antisense strand of the nucleic acid sequence (5'UGGUCCUUCCUGUGACAGUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 470 (5'CACUGUCACAGGAAGGACCA 3'); cxcvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'UGUGUCAUAGAGGACCAAGACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 471 (5'UCUUGGUCCUCUAUGACACA 3'); cxcviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5'UCCUUCUGCGUCUGAGCAUUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 472 (5'AAUGCUCAGACGCAGAAGGA 3'); cxcix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5'UGGAUUCCUGCAGUAGUUCAUU... The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 473 (5'UGAACUACUGCAGGAAUCCA 3'); cc) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5'UGGUAGCAAUCCUGGACCACAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 474 (5'GUGGUCCAGGAUUGCUACCA 3');cci) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5'UUGGUAGCACUCCUGCACCCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 475 (5'GGGUGCAGGAGUGCUACCAA 3'); ccii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 222 (5'UCUGGUGUGGUGUCAUAGAUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 476 (5'AUCUAUGACACCACACCAGA 3'); cciii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5'UGUCUCUAGGACACCUGAUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 477 (5'AAUCAGGUGUCCUAGAGACA 3'); cciv) According to SEQ ID NO: 224 The antisense strand of the nucleic acid sequence (5'UCCAUGGUAGCAAUCCUGGACC 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 478 (5'UCCAGGAUUGCUACCAUGGA 3'); ccv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5'UGACCACAUGGCUUUGCUCAGG 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 479 (5'UGAGCAAAGCCAUGUGGUCA 3'); ccvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5'UAUCUGGAUUUCGGCAGUAGUU 3') and the sense strand according to the nucleic acid sequence of SEQ ID NO: 480 (5'CUACUGCCGAAAUCCAGAUA 3'); ccvii) the sense strand according to SEQ ID NO: 227 (5'UCACCCCAGGCCUUUGCUCAGU... ccviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 481 (5'UGAGCAAAGGCCUGGGGUGA 3'); ccviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5'UUGCACCCCAGGCCUUUGCUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 482 (5'AGCAAAGGCCUGGGGUGCAA 3');ccix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5'UUGGAUGACCAAGAUUGACAUG 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 483 (5'UGUCAAUCUUGGUCAUCCAA 3'); ccx) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5'UCUGUUUUCAGUUGGUGCUUCU 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 484 (5'AAGCACCAACUGAAAACAGA 3'); ccxi) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 231 (5'UCUGUACCCCGGGGGUUUCCUC 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 485 (5'GGAAACCCCCGGGGUACAGA 3'); ccxii) According to SEQ ID NO: 232 The antisense strand of the nucleic acid sequence (5'UGGGUAGUUUUCUGGGGUCCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 486 (5'GGACCCCAGAAAACUACCCA 3'); ccxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5'UGGUGUGGUGUCAUGGAUGACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 487 (5'UCAUCCAUGACACCACACCA 3'); ccxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5'UUGUACCCCGGGGGUUUCCUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 488 (5'AGGAAACCCCCGGGGUACAA 3'); ccxv) according to SEQ ID NO: 235 The antisense strand of the nucleic acid sequence (5'UCCAAGGGCGAAUCUCAGCAUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 489 (5'UGCUGAGAUUCGCCCUUGGA 3'); ccxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 236 (5'UUGUGGUGUCAUAGAUGACCAA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 490 (5'GGUCAUCUAUGACACCACAA 3');ccxvii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5'UUUGGGAUCCAUGGUAUAACAC 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 491 (5'GUUAUACCAUGGAUCCCAAA 3'); ccxviii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 238 (5'UAGGCCUUUGCUCAGUCGGUGC 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 492 (5'ACCGACUGAGCAAAGGCCUA 3'); ccxix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5'UGGAUCUGGAUUCCUGCAGUAG 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 493 (5'ACUGCAGGAAUCCAGAUCCA 3'); ccxx) According to SEQ ID NO: 240 The antisense strand of the nucleic acid sequence (5'UCUGGGAUCCAUGGUGUAACAC 3') and the sense strand according to SEQ ID NO: 494 (5'GUUACACCAUGGAUCCCAGA 3'); ccxxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5'UUUGGUGCUUCUUCAGAAGGAA 3') and the sense strand according to SEQ ID NO: 495 (5'CCUUCUGAAGAAGCACCAAA 3'); ccxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5'UCUGUCCAUAAUGGUAGUAGCA 3') and the sense strand according to SEQ ID NO: 496 (5'CUACUACCAUUAUGGACAGA 3'); ccxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5'UCAUAGAUGACCAAGCUUGGCA 3'). The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 497 (5'CCAAGCUUGGUCAUCUAUGA 3'); ccxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5'UGGGGUCCAUGGUAAAACACCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 498 (5'GUGUUUUACCAUGGACCCCA 3');ccxxv) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5'UCUCCUGCACCCCAGGCCUUUG 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 499 (5'AAGGCCUGGGGUGCAGGAGA 3'); ccxxvi) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5'UGCUUGGAACUGGGACCACCGU 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 500 (5'GGUGGUCCCAGUUCCAAGCA 3'); ccxxvii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5'UAGCACUCCUGCACCCCAGGCC 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 501 (5'CCUGGGGUGCAGGAGUGCUA 3'); ccxxviii) According to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 248 (5'UAGUUUUCUGGGGUCCUCUGAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 502 (5'CAGAGGACCCCAGAAAACUA 3'); ccxxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 249 (5'UUCCCUUCUGUGUCUGAGCAUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 503 (5'UGCUCAGACACAGAAGGGAA 3'); ccxxx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5'UCAUGGUGUAACACCAAGGGCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 504 (5'CCCUUGGUGUUACACCAUGA 3'); ccxxxi) According to SEQ ID NO: 251 The antisense strand of the nucleic acid sequence (5'UGUGUAACACCAAGGGCGAAUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 505 (5'UUCGCCCUUGGUGUUACACA 3'); ccxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5'UGGACCACAUGGCUUUGCUCAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 506 (5'GAGCAAAGCCAUGUGGUCCA 3');ccxxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 253 (5'UGUCCUUCCUGUGACAGUGGUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 507 (5'CCACUGUCACAGGAAGGACA 3'); ccxxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5'UGUUCCUGGUCAGGCCACCAUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 508 (5'UGGUGGCCUGACCAGGAACA 3'); ccxxxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 255 (5'UAUAGAUGACCAAGCUUGGCAA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 509 (5'GCCAAGCUUGGUCAUCUAUA 3'); ccxxxvi) According to SEQ ID NO: 256 The antisense strand of the nucleic acid sequence (5'UCGUGGUAGCACUCCUGCACCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 510 (5'GUGCAGGAGUGCUACCACGA 3'); ccxxxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 257 (5'UUUCGGAAGGAGCCUCUAGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 511 (5'CCUAGAGGCUCCUUCCGAAA 3'); ccxxxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5'UCACAGGGCUUUUCUCAGGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 512 (5'ACCUGAGAAAAGCCCUGUGA 3'); ccxxxix) According to SEQ ID NO: 259 The antisense strand of the nucleic acid sequence (5'UUAUAACACCAAGGGGCUGCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 513 (5'GCAGCCCCUUGGUGUUAUAA 3'); ccxl) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5'UAUUUGGGUAGUUUUCUGGGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 514 (5'CCCAGAAAACUACCCAAAUA 3');ccxli) antisense strand of the nucleic acid sequence according to SEQ ID NO: 261 (5'UGGUGCUUGUUCGGAAGGAGCC 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 515 (5'CUCCUUCCGAACAAGCACCA 3'); ccxlii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 262 (5'UCUCUAGGACACCUGAUUCUGU 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 516 (5'AGAAUCAGGUGUCCUAGAGA 3'); ccxliii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 263 (5'UGCCAGCAUUUGGGUAGUUUUC 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 517 (5'AAACUACCCAAAUGCUGGCA 3'); ccxliv) according to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 264 (5'UAUCUGGAUUCCUGCAGUAGUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 518 (5'CUACUGCAGGAAUCCAGAUA 3'); ccxlv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 265 (5'UGAAGGAGCCUCUAGGCUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 519 (5'CAAGCCUAGAGGCUCCUUCA 3'); ccxlvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5'UCAAGAUUGACAUGUCCUUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 520 (5'GAAGGACAUGUCAAUCUUGA 3'); ccxlvii) According to SEQ ID NO: 267 The antisense strand of the nucleic acid sequence (5'UUUCCUGUGACAGUGGUGGAGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 521 (5'UCCACCACUGUCACAGGAAA 3'); ccxlviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5'UGUCAUGGAUGACCAAGAUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 522 (5'AAUCUUGGUCAUCCAUGACA 3');ccxlix) antisense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5'UCAAUGCUUCCAGGACAUUUCU 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 523 (5'AAAUGUCCUGGAAGCAUUGA 3'); ccl) antisense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5'UGGUCCGACUAUGCUGGUGUGG 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 524 (5'ACACCAGCAUAGUCGGACCA 3'); ccli) antisense strand of the nucleic acid sequence according to SEQ ID NO: 271 (5'UCUACAAUGCUUCCAGGACAUU 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 525 (5'UGUCCUGGAAGCAUUGUAGA 3'); cclii) according to SEQ ID NO: 272 The antisense strand of the nucleic acid sequence (5'UGAUGCCAGUGUGGUGUCAUAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 526 (5'AUGACACCACACUGGCAUCA 3'); ccliii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5'UUCCAUGGUAAAACACCAAGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 527 (5'CUUGGUGUUUUACCAUGGAA 3'); ccliv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5'UUUCUGCAUCUGAGCAUCGUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 528 (5'ACGAUGCUCAGAUGCAGAAA 3'); cclv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5'UAUCCUGGACCACAUGGCUUUG The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 529 (5'AAGCCAUGUGGUCCAGGAUA 3'); cclvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 276 (5'UCGCGUCAGGUUGCAGUACUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 530 (5'AGUACUGCAACCUGACGCGA 3');cclvii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5'UCUGGAUUCCUGCAGUAGUUCC 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 531 (5'AACUACUGCAGGAAUCCAGA 3'); cclviii) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5'UGCAUCGCGUCAGGUUGCAGUA 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 532 (5'CUGCAACCUGACGCGAUGCA 3'); cclix) Antisense strand of the nucleic acid sequence according to SEQ ID NO: 279 (5'UUUCUGGGGUCCUCUGAUGCCG 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 533 (5'GCAUCAGAGGACCCCAGAAA 3'); cclx) According to SEQ ID NO: 280 The antisense strand of the nucleic acid sequence (5'UGACACCUGAUUCUGUUUCUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 534 (5'AGAAACAGAAUCAGGUGUCA 3'); cclxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5'UACAGUCCCUUCUGUGUCUGAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 535 (5'CAGACACAGAAGGGACUGUA 3'); cclxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 282 (5'UUGUUCAGAAGGAGCCUCUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 536 (5'UAGAGGCUCCUUCUGAACAA 3'); cclxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5'UCACUCCUGCACCCCAGGCCUU... The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 537 (5'GGCCUGGGGUGCAGGAGUGA 3'); cclxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 284 (5'UAUAGAUGACCAAGAUUGACAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 538 (5'GUCAAUCUUGGUCAUCUAUA 3');cclxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5'UUGUGACAGUGGUGGAGAAUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 539 (5'AUUCUCCACCACUGUCACAA 3'); cclxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 286 (5'UUGUCAGGUUGCAGUACUCCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 540 (5'GGAGUACUGCAACCUGACAA 3'); cclxvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5'UGAUUCUGUCACUGGACAUUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 541 (5'AAUGUCCAGUGACAGAAUCA 3'); cclxviii) According to SEQ ID NO: 288 The antisense strand of the nucleic acid sequence (5'UUCCUGGACCACAUGGCUUUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 542 (5'AAAGCCAUGUGGUCCAGGAA 3'); cclxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5'UUUUAGCAAGGCAAUAUCUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 543 (5'CAGAUAUUGCCUUGCUAAAA 3'); cclxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 290 (5'UCCUGCACCCCAGGCCUUUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 544 (5'CAAAGGCCUGGGGUGCAGGA 3'); cclxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 291 (5'UGACCACAGUCCCUUCUGUGUC The antisense strand of the nucleic acid sequence 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 545 (5'CACAGAAGGGACUGUGGUCA 3'); cclxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 292 (5'UUUCUGUGUCUGAGCAUCGCGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 546 (5'GCGAUGCUCAGACACAGAAA 3');cclxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5'UUCAGGUUGCAGUACUCCCACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 547 (5'UGGGAGUACUGCAACCUGAA 3'); cclxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 294 (5'UGUGUCUGAGCAUCGCGUCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 548 (5'UGACGCGAUGCUCAGACACA 3'); or cclxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 295 (5'UUGGUAAAACACCAAGGGCCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 549 (5'GGCCCUUGGUGUUUUACCAA 3').

[0139] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region located between any of the following nucleotide positions: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944, and the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region.

[0140] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical nucleotide sequences to a region comprising 19-25 nucleotides located between any of the following nucleotide positions: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944.

[0141] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises the same nucleotide sequence as a region of 19-25 nucleotides located between any of the following nucleotide positions: a) 144 to 177; b) 206 to 229; c) 248 to 269; d) 2751 to 2773; e) 2947 to 2972; f) 2991 to 3012; g) 3275 to 3300; h) 3463 to 3484; i) 3570 to 3591; j) 3931 to 3952; and k) 4923 to 4944, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0142] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region located between any of the following nucleotide positions: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0143] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical nucleotide sequences to a region located between any of the following nucleotide positions: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0144] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises the same nucleotide sequence as the region comprising a sequence selected between any of the following nucleotide positions: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0145] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises the same nucleotide sequence as the region located between any of the following nucleotide positions: a) 151 to 172; b) 248 to 269; c) 2947 to 2968; d) 2991 to 3012; e) 3463 to 3484; and f) 3931 to 3952, starting from the 5' end of the human LPAmRNA sequence according to SEQ ID NO: 1. The double-stranded region comprises: i) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5'UUCGAUAACUCUGUCCAUCACC 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 550 (5'UGAUGGACAGAGUUAUCGAA 3'); ii) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5'UCAUUUGGGUAGUUUUCUGUGG 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: iii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UUGGUGUCAUAGAUGACCAAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UUGGUCAUCUAUGACACCAA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAAGCCAGCAUUUGGGUAGUAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'ACUACCCAAAUGCUGGCUUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UAGACUGACAUGUCCUUCCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'AGGAAGGACAUGUCAGUCUA 3'); or vi) according to SEQ ID The antisense strand of the nucleic acid sequence NO: 7 (5'UAGUUGCAAGGACACUUGAUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'AUCAAGUGUCCUUGCAACUA 3').

[0146] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence substantially identical to the region comprising a sequence selected between any of the following nucleotide positions: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0147] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising a sequence selected from any of the following nucleotide positions: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0148] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises the same nucleotide sequence as the region comprising a sequence selected between any of the following nucleotide positions: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0149] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises the same nucleotide sequence as the region comprising a sequence selected from any of the following nucleotide positions: a) 144 to 170; b) 206 to 229; c) 2751 to 2773; d) 2951 to 2972; e) 3275 to 3300; f) 3570 to 3591; and g) 4923 to 4944, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1; and the double-stranded region comprises: i) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UCGAUAACUCUGUCCAUCACCA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'GUGAUGGACAGAGUUAUCGA 3'); ii) a sense strand according to SEQ ID NO: 9 (5'UUAACUCUGUCCAUCACCAUGG iii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'AUGGUGAUGGACAGAGUUAA 3'); iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UUGAGCAUUGUGUCAGGUUGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'CAACCUGACACAAUGCUCAA 3'); iv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UGAUAACUCUGUCCAUCACCAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'GGUGAUGGACAGAGUUAUCA 3'); v) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UCUCUGUCCAUCACCAUGGUAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 40 vi) sense strand of the nucleic acid sequence (5'ACCAUGGUGAUGGACAGAGA 3'); vi) antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UUCAUAGAUGACCAAGCUUGGC 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'CAAGCUUGGUCAUCUAUGAA 3'); vii) antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAUAACUCUGUCCAUCACCAUG 3') and sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UGGUGAUGGACAGAGUUAUA 3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UUGUCAUAGAUGACCAAGCUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'AGCUUGGUCAUCUAUGACAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UAAUGUGCCUCGAUAACUCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'AGAGUUAUCGAGGCACAUUA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UGAGCAUUGUGUCAGGUUGCAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5'GCAACCUGACACAAUGCUCA 3'); xi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAUGACCAAGCUUGGCAAGUU... 3') The antisense strand of the nucleic acid sequence and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5'CUUGCCAAGCUUGGUCAUCA 3'); xii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UACCAAGCUUGGCAAGUUCUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'AGAACUUGCCAAGCUUGGUA 3'); or xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAGUGUGGUGUCAUAGAUGACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'UCAUCUAUGACACCACACUA 3').

[0150] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence substantially identical to a region comprising a sequence from nucleotide positions 156 to 177, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0151] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of the same sequence as a region comprising a sequence comprising nucleotide positions 156 to 177 from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0152] This disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises the same nucleotide sequence as the region comprising the sequence from nucleotide positions 156 to 177, starting from the 5' end of the human LPA mRNA sequence according to SEQ ID NO: 1.

[0153] In some embodiments of the isolated oligonucleotides disclosed herein, the sense strand comprises the same sequence as the region comprising the sequence from nucleotide positions 156 to 177 from the 5' end of the LPA mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises: i) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5' UGUGCCUCGAUAACUCUGUCCA 3') and a sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5' GACAGAGUUAUCGAGGCACA 3').

[0154] This disclosure also provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand form a double-stranded region, wherein the double-stranded region comprises: i) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 2 (5' UUCGAUAACUCUGUCCAUCACC 3') and a sense strand according to the nucleic acid sequence of SEQ ID NO: 1102 (5'UGAUGGACAGAGUUAUCGAA(X)n 3'); ii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 3 (5'UCAUUUGGGUAGUUUUCUGUGG 3') and a sense strand according to the nucleic acid sequence of SEQ ID NO: 1103 (5'ACAGAAAACUACCCAAAUGA(X)n 3'); iii) an antisense strand according to the nucleic acid sequence of SEQ ID NO: 4 (5'UUGGUGUCAUAGAUGACCAAGC 3') and a sense strand according to the nucleic acid sequence of SEQ ID NO: iv) The sense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAAGCCAGCAUUUGGGUAGUAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1105 (5'ACUACCCAAAUGCUGGCUUA(X)n 3'); v) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UAGACUGACAUGUCCUUCCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1106 (5'AGGAAGGACAUGUCAGUCUA(X)n 3'); vi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UAGUUGCAAGGACACUUGAUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1107 vii) the sense strand of the nucleic acid sequence (5'AUCAAGUGUCCUUGCAACUA(X)n 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UCGAUAACUCUGUCCAUCACCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1108 (5'GUGAUGGACAGAGUUAUCGA(X)n 3');viii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UUAACUCUGUCCAUCACCAUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1109 (5'AUGGUGAUGGACAGAGUUAA(X)n 3'); ix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UUGAGCAUUGUGUCAGGUUGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1110 (5'CAACCUGACACAAUGCUCAA(X)n 3'); x) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UGAUAACUCUGUCCAUCACCAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1111 (5'GGUGAUGGACAGAGUUAUCA(X)n 3'); xi) According to SEQ ID NO: 12 xii) The antisense strand of the nucleic acid sequence (5'UAUAACUCUGUCCAUUACCGUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1112 (5'CGGUAAUGGACAGAGUUAUA(X)n 3'); xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UUCAUAGAUGACCAAGCUUGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1113 (5'CAAGCUUGGUCAUCUAUGAA(X)n 3'); xiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAUAACUCUGUCCAUCACCAUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1114 (5'UGGUGAUGGACAGAGUUAUA(X)n 3'); xiv) According to SEQ ID NO: 15 xv) The antisense strand of the nucleic acid sequence (5'UUGUCAUAGAUGACCAAGCUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1115 (5'AGCUUGGUCAUCUAUGACAA(X)n 3'); xv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UAAUGUGCCUCGAUAACUCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1116 (5'AGAGUUAUCGAGGCACAUUA(X)n 3');xvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UGAGCAUUGUGUCAGGUUGCAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1117 (5'GCAACCUGACACAAUGCUCA(X)n 3'); xvii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAUGACCAAGCUUGGCAAGUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1118 (5'CUUGCCAAGCUUGGUCAUCA(X)n 3'); xviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UACCAAGCUUGGCAAGUUCUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1119 (5'AGAACUUGCCAAGCUUGGUA(X)n 3'); xix) According to SEQ ID NO: The antisense strand of the nucleic acid sequence SEQ ID NO: 20 (5'UAGUGUGGUGUCAUAGAUGACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1120 (5'UCAUCUAUGACACCACACUA(X)n 3'); xx) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UCUCUGUCCAUCACCAUGGUAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1121 (5'ACCAUGGUGAUGGACAGAGA(X)n 3'); xxi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UGUGCCUCGAUAACUCUGUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1122 (5'GACAGAGUUAUCGAGGCACA(X)n 3'); xxii) According to SEQ ID NO: 42 The antisense strand of the nucleic acid sequence (5'UGUGGUGUCAUAGAUGACCAAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1123 (5'UGGUCAUCUAUGACACCACA(X)n 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'UAGUGGUGGAGAAUGAGCCUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1124 (5'AGGCUCAUUCUCCACCACUA(X)n 3');xxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UCCUCGAUAACUCUGUCCAUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1125 (5'AUGGACAGAGUUAUCGAGGA(X)n 3'); xxv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UUAGAUGACCAAGCUUGGCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1126 (5'UGCCAAGCUUGGUCAUCUAA(X)n 3'); xxvi) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'UAGCAUUGUGUCAGGUUGCAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1127 (5'UGCAACCUGACACAAUGCUA(X)n 3'); xxvii) According to SEQ ID The antisense strand of the nucleic acid sequence NO: 47 (5'UAGAAUGUGCCUCGAUAACUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1128 (5'AGUUAUCGAGGCACAUUCUA(X)n 3'); xxviii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'UGUCAUAGAUGACCAAGCUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1129 (5'AAGCUUGGUCAUCUAUGACA(X)n 3'); xxix) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'UAACUCUGUCCAUCACCAUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1130 (5'CAUGGUGAUGGACAGAGUUA(X)n 3'); xxx) According to SEQ ID NO: 50 The antisense strand of the nucleic acid sequence (5'UGCCUCGAUAACUCUGUCCAUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1131 (5'UGGACAGAGUUAUCGAGGCA(X)n 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UAGUAGUUCCUGGUCAGGCCAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1132 (5'GGCCUGACCAGGAACUACUA(X)n 3');xxxii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'UCUUUUCUCAGGUGGUGCUUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1133 (5'AAGCACCACCUGAGAAAAGA(X)n 3'); xxxiii) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'UGAAUGUGCCUCGAUAACUCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1134 (5'GAGUUAUCGAGGCACAUUCA(X)n 3'); xxxiv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'UAUGACCAAGCUUGGCAGGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 1135 (5'ACCUGCCAAGCUUGGUCAUA(X)n 3'); xxxv) According to SEQ ID NO: Antisense strand of SEQ ID NO: 55 (5'UUGACCAAGCUUGGCAAGUUCU 3') and sense strand of SEQ ID NO: 1136 (5'AACUUGCCAAGCUUGGUCAA(X)n 3'); xxxvi) A...

Claims

1. An isolated oligonucleotide comprising a sense strand selected from SEQ ID NO: 2-22 and 42-295 and a corresponding antisense strand selected from SEQ ID NO: 23-41 and 296-551, as shown in Table 2.

2. The isolated oligonucleotide of claim 1, wherein the sense strand comprises a modified sequence selected from SEQ ID NO: 2-22 and 42-295, and its corresponding antisense strand is selected from SEQ ID NO: 23-41 and 296-551, as shown in Table 2; or wherein the sense strand comprises a modified sequence as shown in SEQ ID NO: 552-845, 1372-1378, 1383-1384, 1386-1387 and 1395-1396, and its corresponding antisense strand comprises a sequence selected from SEQ ID NO: 573-1101, 1379-1380, 1385 and 1388, as shown in Table 6.

3. The isolated oligonucleotide of claim 1, wherein the sense strand comprises a sequence selected from SEQ ID NO: 2-22, and its corresponding antisense strand comprises a sequence selected from 23-41 and 550-551, as shown in Table 1.

4. The isolated oligonucleotide of claim 2, wherein the sense strand comprises a sequence selected from SEQ ID NO: 2, 6, 16, 18, 552, 556, 568, 566, 1377-1378, 1383-1384, 1386-1387, and 1395-1396, and its corresponding antisense strand is selected from SEQ ID NO: 575, 585, 587, 1100, 1379-1380, 1385, and 1388, as shown in Table 3.

5. The isolated oligonucleotide of claim 2, wherein the sense strand comprises a sequence selected from SEQ ID NO: 2, 6, 18, 552, 556 and 568, and its corresponding antisense strand is selected from SEQ ID NO: 575, 587, 1100, 1379-1380 and 1385, as shown in Table 4.

6. The isolated oligonucleotide of claim 2, wherein the sense strand comprises a sequence selected from SEQ ID NO: 18, 568 and 1383-1384, and its corresponding antisense strand is selected from SEQ ID NO: 587 and 1380, as shown in Table 5.

7. A vector encoding an isolated oligonucleotide as described in any one of claims 1 to 6.

8. A delivery system comprising the isolated oligonucleotide as claimed in any one of claims 1 to 6 or the vector as claimed in claim 7.

9. A pharmaceutical composition comprising at least one isolated oligonucleotide as claimed in any one of claims 1 to 6, a carrier as claimed in claim 7 or a delivery system as claimed in claim 8, and a pharmaceutically acceptable carrier, diluent or excipient.

10. A kit comprising at least one isolated oligonucleotide as claimed in any one of claims 1 to 6, a carrier as claimed in claim 7, a delivery system as claimed in claim 8, or a pharmaceutical composition as claimed in claim 9.

11. A method for inhibiting or downregulating the expression or level of human Lp(a) in a subject in need, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide as claimed in any one of claims 1 to 6, a carrier as claimed in claim 7, a delivery system as claimed in claim 8, or a pharmaceutical composition as claimed in claim 9.

12. A method for treating or preventing a disease or condition in a subject of need that is associated with abnormal or increased expression or activity of human Lp(a) or in which human Lp(a) plays a role, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide as claimed in any one of claims 1 to 6, a carrier as claimed in claim 7, a delivery system as claimed in claim 8, or a pharmaceutical composition as claimed in claim 9.

Images