A postharvest green-keeping method of lime fresh fruit based on self-source extracellular vesicle delivery of antisense oligonucleotide
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHONGQING THREE GORGES UNIV
- Filing Date
- 2026-05-08
- Publication Date
- 2026-08-07
AI Technical Summary
然而,ASO在采后果实上的应用仍面临瓶颈:果皮角质层/蜡质层屏障导致核酸难以进入表皮细胞,且贮运环境中易被核酸酶降解,难以在低温、低水活度条件下保持稳定有效浓度;同时,常规助剂或载体可能带来安全性与残留风险,或影响果面外观与香气释放,致使ASO难以在真实冷链条件下获得稳定、可重复的护绿效果
[0021] (1) Stable and efficient greening: This invention uses autologous plant extracellular vesicles (EVs) to deliver antisense oligonucleotides (ASOs) targeting SGR. By controlling the process of low temperature and low shear loading, ionic strength and fruit surface adhesion, the stability and delivery consistency of ASOs on the peel are improved. Without changing the SGR genome, the peel of lime fruit can be effectively maintained for 30 weeks under specific cold storage conditions, thereby improving the stability and reproducibility of the greening effect under cold storage and transportation conditions.
Smart Images

Figure CN122515340A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of green preservation during the postharvest storage of fresh limes, and in particular to a method for postharvest green preservation based on the delivery of antisense oligonucleotides (ASO) via autologous extracellular vesicles (EVs), as well as its formulation and application technology, belonging to the field of fruit postharvest preservation technology. Background Technology
[0002] Lime (Citrus limon, commercially referring to lemons with green peel at maturity) is an evergreen shrub or small tree belonging to the Rutaceae family and the Citrus genus. Its fruit is characterized by its relatively long-lasting green peel, prominent sour taste, and fresh aroma from volatile essential oils. It is cultivated on a large scale in parts of South and Southwest my country. The core commercial value of lime lies in its highly recognizable bright green peel with uniform color. However, the fruit is prone to fading and turning yellow during post-harvest storage and transportation, with a shelf life of only about two weeks at room temperature, severely impacting its marketability. To delay fading, the industry currently employs cold chain temperature and humidity control, reducing ethylene exposure, or combining this with modified atmosphere packaging, edible coatings, 1-MCP, UV-C, and intermittent warming techniques. Under low-temperature storage and transportation conditions, a green preservation period of about 6-10 weeks can be achieved. However, current measures still have limitations, including high equipment investment, high operation and management costs, unstable inhibition effects in cold chain environments that may affect flavor or appearance, and a short green preservation period that makes it difficult to effectively connect to the next harvest season. Therefore, there is an urgent need to develop more effective, green, and simple new technologies for post-harvest greening of limes that are suitable for cold chain storage and transportation.
[0003] Postharvest chlorosis in limes is closely related to chlorophyll degradation along the PAO / phyllobilin pathway, with SGR being a crucial upstream regulatory node that promotes the expression of chlorophyll degradation-related genes and accelerates peel chlorosis. At the molecular level, antisense oligonucleotides (ASOs) can achieve spatial blocking or induced degradation through complementary pairing with target mRNAs, thereby providing short-term, reversible, and precise inhibition of SGR expression without altering the genome, offering advantages such as strong targeting and a small intervention range. However, the application of ASOs in postharvest fruits still faces bottlenecks: the cuticle / wax barrier of the peel makes it difficult for nucleic acids to enter epidermal cells, and they are easily degraded by nucleases in the storage and transportation environment, making it difficult to maintain a stable and effective concentration under low temperature and low water activity conditions; at the same time, conventional adjuvants or carriers may pose safety and residue risks, or affect the appearance and aroma release of the fruit, making it difficult for ASOs to achieve a stable and reproducible chlorosis-preserving effect under real cold chain conditions. At the same time, although plant-derived extracellular vesicles (EVs) have advantages such as lipid bilayer protection and good biocompatibility as natural nanocarriers, there is still a lack of systematic application solutions for pericarp delivery in the postharvest field. Summary of the Invention
[0004] This invention addresses the problem of chlorosis and yellowing of fresh limes during postharvest storage and transportation by providing a method for postharvest green protection of fresh limes based on the delivery of antisense oligonucleotides (ASO) via autologous extracellular vesicles (EVs). This invention utilizes the protective and delivery effects of EVs on nucleic acids to effectively deliver ASO targeting the key chlorosis-regulating gene SGR to the pericarp tissue. This inhibits SGR expression without altering the genome, thereby reducing chlorophyll degradation flux and delaying chlorosis in the pericarp. It overcomes the bottleneck of low delivery efficiency and poor stability of postharvest pericarp delivery. Furthermore, by targeting and inhibiting SGR, this invention achieves a more effective, greener, simpler, and cold-chain-compatible postharvest green protection technology for limes. Under specific cold storage conditions, it can significantly delay chlorosis in lime fruits and maintain a high Hue value and chlorophyll content even after 30 weeks of storage.
[0005] For ease of description, the term "lime" in this invention refers to green-skinned mature lemon (Citrus limon) fruit with a green peel appearance as its main commercial characteristic after harvest; the ASO sequence targeting SGR is designed based on conserved homologous regions of lemon (Citrus limon) SGR mRNA and is suitable for post-harvest greening treatment of the aforementioned lime fruit.
[0006] To achieve the above objectives, the technical solution adopted by this invention is: a method for post-harvest greening of fresh lime fruit based on the delivery of antisense oligonucleotides by autologous extracellular vesicles, comprising the following steps:
[0007] (1) Preparation of EV stock solution from autologous plant: Lime endocarp tissue was taken and homogenized at 4 ℃ at a ratio of tissue mass to pre-cooled homogenate volume of 1:10-1:15 (w / v); the obtained homogenate was centrifuged at 4 ℃ to remove large particles, cell debris and organelle residues, and the supernatant was collected; the supernatant was filtered through 0.45 μm and 0.22 μm microporous membranes in sequence, and the filtrate was separated, purified / enriched for EV to obtain crude EV precipitate; the crude EV precipitate was resuspended and washed to obtain concentrated EV stock solution.
[0008] (2) Preparation of EV dispersion: Using food-grade citric acid-sodium citrate buffer as the dispersion medium, add the protective component and add the EV concentrated mother liquor obtained in step (1) to it and mix well to obtain EV dispersion;
[0009] (3) Preparation of antisense oligonucleotide ASO solution targeting SGR: antisense oligonucleotide ASO was designed and synthesized using the homologous gene of SGR as a reference sequence, and ASO solution was prepared by dissolving the lyophilized ASO powder in sterile ultrapure water.
[0010] (4) Preparation of lime treatment solution with EV loaded with ASO: Mix the EV dispersion obtained in step (2) with the ASO solution obtained in step (3) to make ASO and EV fully contact to form an EV-ASO composite system and obtain the treatment solution;
[0011] (5) Fruit treatment and storage: The treatment liquid is sprayed evenly on the surface of the lime fruit in a spraying manner, and after standing to allow the treatment liquid to spread and adhere, it is transferred to a cold storage environment for storage to delay the greening of the peel.
[0012] Step (1) specifically includes the following steps: Take tissue from the inner pericarp (white skin / sponge layer) of a lime and homogenize it at 4 ℃ at a ratio of tissue mass to pre-cooled homogenate volume of 1:10-1:15 (w / v). The homogenate is a food-grade citrate-sodium citrate buffer solution, preferably with a concentration of 5-20 mmol / L and a pH of 5.5-6.2. Centrifuge the resulting homogenate at 4 ℃ using differential centrifugation to remove large particles, cell debris, and organelle residues. The preferred centrifugation conditions are: 500-1000 g, 5-10 min; 2000-5000 g, 5-15 min; 10000-15000 g, 15-30 min. Collect the supernatant after each centrifugation step. Filter the supernatant sequentially through 0.45 μm and 0.22 μm microporous membranes to further remove impurities. The microporous membrane is preferably a low-protein adsorption membrane material, more preferably a PES membrane. The filtered filtrate was ultracentrifuged at 4 °C (preferably 100,000 g, 70-120 min) to precipitate extracellular vesicles and obtain a crude EV precipitate. The crude EV precipitate was gently resuspended in pre-cooled sterile citrate-sodium citrate buffer (preferably 5-10 mL), and then washed once more by ultracentrifugation at 4 °C (preferably 100,000 g, 70-120 min). After discarding the supernatant, the precipitate was resuspended in sterile citrate-sodium citrate buffer (preferably 3-5 mL) to obtain a concentrated EV stock solution, which was stored at 4 °C protected from light for later use.
[0013] Step (2) specifically includes the following steps: Under aseptic conditions, an EV dispersion is prepared using food-grade citrate-sodium citrate buffer as the dispersion medium. The buffer concentration is preferably 5-20 mmol / L, pH 5.5-6.2. A protective component is added to the buffer system to improve vesicle stability. The protective component is preferably trehalose and mannitol, wherein trehalose is preferably 1-3% (w / v), and mannitol is preferably 0.5-2% (w / v). A food-grade wetting and dispersing component can be added to the buffer system to improve wettability and dispersion uniformity. The wetting and dispersing component is preferably lecithin, and its dosage is preferably 0.001-0.005% (w / v), provided that it does not significantly change the EV particle size distribution or form independent nanoparticles. The above components are mixed to obtain a dispersion base. The EV concentrated mother liquor obtained in step (1) is added to the dispersion base at the target concentration, and the EV dispersion is obtained by gentle mixing. It is then stored at 4 ℃ in the dark for later use. The amount of EV added in the EV dispersion can be standardized according to particle concentration or equivalent protein content, preferably with an EV particle concentration of 1×10⁻⁶. 10 -1×10 12 particles / mL, or equivalent EV protein amount of 50-300 μg / mL.
[0014] In step (3), "SGR" refers to the SGR gene or its homologous sequence in lemon (Citrus limon) fruit associated with chlorosis. The lemon (Citrus limon) SGR mRNA sequence (SEQ ID NO. 1) is used as a reference sequence in ASO sequence design, and the design and validation are based on the conservation of the corresponding homologous region in the target lime. The reference sequence is used for ASO targeting design and validation. The mRNA sequence information of the lemon (Citrus limon) SGR gene is obtained, and an antisense oligonucleotide (ASO) with complementary pairing ability to the SGR mRNA is designed accordingly. The length of the ASO is preferably 18-20 nt; the candidate sequence preferably meets the GC content of 40-60%, and avoids excessively long fragments with the same base consecutively; the ASO is preferably located near the start codon, near the 5′ end, or in a conserved region; the candidate sequence of the ASO can be any one of SEQ ID NO. 2-4. The ASO is preferably synthesized using a natural phosphodiester backbone to enhance biocompatibility and biodegradability; the ASO is preferably obtained in lyophilized powder form. The lyophilized ASO powder is dissolved in sterile ultrapure water to prepare an ASO stock solution, the concentration of which is preferably 100-200 μmol / L. The ASO stock solution may be desalted to remove small molecule impurities; the preferred desalting method is dialysis desalting, with the dialysis membrane having a molecular weight cutoff of 0.5-1.0 kDa. The desalted ASO stock solution is diluted with a sterile buffer system to obtain an ASO working solution, the concentration of which is preferably 1-10 μmol / L. The sterile buffer system is preferably a 5-20 mmol / L citrate-sodium citrate buffer solution with a pH of 5.5-6.2. The ASO solution is stored at 4°C protected from light for later use.
[0015] Step (4) specifically includes: mixing the EV dispersion obtained in step (2) with the ASO solution targeting SGR obtained in step (3), so that the ASO and EV are in full contact to form an EV-ASO composite system, thereby obtaining a treatment solution. The preferred EV particle concentration in the EV dispersion is 1×10⁻⁶. 10 -1×10 12 The particle / mL concentration of ASO in the mixed system is preferably 0.2-3.3 μmol / L. The volume ratio of the EV dispersion to the ASO solution is preferably 2:1-4:1 (v / v).
[0016] The mixing process is preferably carried out at 4 °C, using a low-shear, quantifiable mixing method to reduce damage to the extracellular vesicle structure. The preferred mixing method is end-to-end rotary mixing or roller mixing. End-to-end rotary mixing is preferably performed at 4 °C and 6-12 rpm for 10-20 min; roller mixing is preferably performed at 4 °C and 8-15 rpm for 20-30 min. After mixing, KCl is added to adjust the ionic strength to promote binding and loading, preferably ensuring that the [K] in the mixture... + The concentration was 5-15 mmol / L; then it was incubated at 4 °C for 60-120 min to promote the binding and loading of ASO with EV.
[0017] After incubation, the treatment solution can be filtered through a 0.45 μm microporous membrane to reduce the microbial load. The microporous membrane is preferably a low-protein adsorption membrane material, more preferably a PES membrane. A stabilizer is added after filtration, preferably sodium carboxymethyl cellulose (CMC-Na), at a concentration of 0.05-0.1% (w / v). A preservative can be added to the treatment solution to reduce the microbial risk during storage. Potassium sorbate is preferably added at a concentration of 0.01-0.05% (w / v). The pH of the system can be adjusted to 5.3-5.8 by adding citric acid to balance preservative effect and EV stability. The resulting treatment solution is stored at 4 ℃ protected from light for later use, and should be gently mixed by inverting before use.
[0018] Step (5) specifically includes: selecting lime fruits of uniform maturity, size, and appearance, free from mechanical damage and lesions. Before treatment, disinfect the surface with 70% ethanol and allow the fruit surface to air dry naturally under clean conditions. Before use, place the EV-loaded ASO treatment solution obtained in step (4) at 10-15 ℃ and pre-equilibrate the fruits within the same temperature range; avoid condensation or free water film on the fruit surface during pre-equilibration. Before spraying, gently invert and mix the treatment solution to ensure the EV-ASO composite system is uniformly dispersed, avoiding violent shaking, vortexing, or strong shearing operations. Use a spraying device to uniformly spray the lime fruit surface, preferably along the equatorial direction of the fruit in a circular motion, rotating the fruit as needed to ensure even hydration; the spraying amount should be such that the fruit surface is "just moistened without dripping." After spraying, place the fruit in a clean environment and let it stand for 20-30 minutes to allow the treatment solution to spread, adhere, and solidify on the fruit surface. During this period, avoid contact between fruits, squeezing, or wiping the fruit surface again to prevent damage to the formed adhesion layer. After standing, transfer the fruit to a cold storage environment with a storage temperature of 4-8 ℃ and a relative humidity of 85-95%. During cold storage, it is preferable to use a single-layer or spaced arrangement to avoid local condensation buildup.
[0019] This invention also provides an EV-ASO treatment solution for postharvest greening of fresh lime fruit, prepared from steps (1) to (4), comprising autologous plant extracellular vesicles (EVs) derived from the endocarp tissue of lime, antisense oligonucleotides (ASOs) targeting SGR, and a food-grade citrate-sodium citrate buffer system. The EVs and ASOs form an EV-ASO complex system; wherein the concentration of the buffer system is 5-20 mmol / L and the pH is 5.5-6.2; the concentration of the EV particles is 1×10⁻⁶. 10 -1×10 12 The particle / mL or equivalent EV protein amount is 50-300 μg / mL; the final concentration of ASO is 0.2-3.3 μmol / L; the mixing volume ratio of EV to ASO is 2:1-4:1 (v / v).
[0020] Based on the above technical solutions, the advantages and positive effects of the present invention are as follows:
[0021] (1) Stable and efficient greening: This invention uses autologous plant extracellular vesicles (EVs) to deliver antisense oligonucleotides (ASOs) targeting SGR. By controlling the process of low temperature and low shear loading, ionic strength and fruit surface adhesion, the stability and delivery consistency of ASOs on the peel are improved. Without changing the SGR genome, the peel of lime fruit can be effectively maintained for 30 weeks under specific cold storage conditions, thereby improving the stability and reproducibility of the greening effect under cold storage and transportation conditions.
[0022] (2) Green and safe: The buffer and dispersion system and additives used in this invention are preferably food-grade citric acid-sodium citrate buffer, trehalose, mannitol, lecithin, sodium carboxymethyl cellulose, etc., and the preservatives can be food-grade additives such as potassium sorbate; EV is derived from lime tissue itself and has good biocompatibility. The ASO is a short-chain oligonucleotide, preferably using a natural phosphodiester backbone, which has degradable properties. The overall scheme avoids or reduces the safety and residue hazards that may be caused by traditional chemical greening inhibitors / fumigation treatments.
[0023] (3) Easy to use and rich in application scenarios: The method of treating lime fruit in this invention is mainly spraying. The spraying process does not require complicated equipment and is easy to connect with post-harvest grading, packaging, warehousing and cold chain storage and transportation. At the same time, it constructs a new green protection route for the "fruit peel delivery" scenario of post-harvest fruit, which can provide technical support for the cross-regional and off-season supply of green-skinned citrus such as lime, and has good potential for promotion and industrial application. Attached Figure Description
[0024] Figure 1 This is a flowchart of the method of the present invention;
[0025] Figure 2The effect of EV-loaded ASO treatment solution on the expression level of the ClSGR gene in lime fruit during storage at 4 ℃. Detailed Implementation
[0026] The invention will be further illustrated below by way of non-limiting embodiments. However, it should be understood that these descriptions are merely illustrative and not intended to limit the scope of the invention. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concept of the invention.
[0027] Lime fruits of uniform ripeness (commercially mature) are randomly harvested from lime farms. Those free from disease, pests, and mechanical damage, with a smooth, bright green surface, are selected. Fruits should have a diameter of 3.0-6.0 cm; soluble solids (TSS) ≥ 6.0 °Brix; titratable acid (calculated as citric acid) ≥ 5.0%; and juice yield (calculated as juice weight / fruit weight) ≥ 40% (preferably ≥ 42%). Wash and set aside. Figure 1 As shown, the following steps were performed to treat postharvest lime fruits with autologous extracellular vesicle delivery of antisense oligonucleotides for chlorosis protection:
[0028] (1) Preparation of concentrated mother liquor of autologous plant extracellular vesicles (EVs): Fresh seeded limes harvested on the same day were picked, the inner pericarp (white skin / sponge layer) tissue was peeled and cut into small pieces, and 120 g of tissue was weighed; 1.50 L of pre-cooled food-grade citric acid-sodium citrate buffer (concentration 10 mmol / L, pH 5.8) was added, and homogenized at 4 ℃ (tissue mass to homogenate volume ratio approximately 1:12.5 (w / v)). The homogenate was centrifuged at 4 ℃ to remove large particles, cell debris and organelle residues. The centrifugation conditions were as follows: 1,000 g, 10 min, supernatant collected; 5,000 g, 15 min, supernatant collected; 15,000 g, 30 min, supernatant collected. The final supernatant was filtered sequentially through 0.45 μm and 0.22 μm microporous membranes (both low protein adsorption membrane materials, PES) to obtain a clear filtrate. The clarified filtrate was then ultracentrifuged at 4 °C for 100,000 g for 90 min to precipitate extracellular vesicles. The supernatant was discarded to obtain a coarse EV precipitate. The coarse EV precipitate was gently resuspended in 8 mL of pre-cooled sterile citrate-sodium citrate buffer and washed once more by ultracentrifugation at 4 °C for 100,000 g for 90 min. The supernatant was discarded, and the precipitate was resuspended in 4 mL of sterile citrate-sodium citrate buffer to obtain a concentrated EV stock solution, which was stored at 4 °C protected from light for later use.
[0029] (2) Preparation of EV dispersion: Under aseptic conditions, using food-grade citrate-sodium citrate buffer (10 mmol / L, pH 5.8) as the dispersion medium, trehalose was added to a final concentration of 2.0% (w / v), and mannitol was added to a final concentration of 1.0% (w / v). The mixture was then stirred to form a dispersion base. Lecithin was then added to a final concentration of 0.003% (w / v), and the mixture was stirred using a low-shear method until uniformly dispersed. The EV concentrate obtained in step (1) was added to the dispersion base and stirred using a gentle inverting or slow transfer method to obtain the EV dispersion. The dispersion was then standardized according to particle concentration or equivalent protein content: preferably, the EV particle concentration was adjusted to 5 × 10⁻⁶. 11 particles / mL; when particle counting is inconvenient, the equivalent EV protein concentration can be adjusted to 150 μg / mL. The obtained EV dispersion should be stored at 4 ℃ in the dark for later use.
[0030] (3) Obtain SGR gene mRNA sequence information; In this embodiment, a fragment of the lemon (Citrus limon) SGR gene mRNA sequence is used as a reference sequence; For ease of description, the mRNA reference sequence is represented in cDNA form as A / C / G / T, where the RNA base U is represented by T, and therefore the start codon is denoted as ATG in the reference sequence (corresponding to AUG in RNA form). The reference sequence contains at least the start codon ATG and its upstream and downstream sequences, as shown in SEQ ID NO.1. The region near the start codon (ATG / AUG) is used as a target window, which covers the sequence segments 1-30 nt upstream and 1-120 nt downstream of the start codon; within the target window, a sliding window method is used to screen candidate target sequences, and an ASO complementary to the candidate target sequence is designed. The ASO has a length of 18-20 nt (19 nt in this example), a GC content of 40-60%, avoids ≥4 consecutive identical bases, and avoids the formation of significant hairpin structures or self-dimers; the ASO is synthesized using a natural phosphodiester backbone.
[0031] SEQ ID NO.1, Citrus limon SGR mRNA reference fragment (ATG-30 to ATG+120): AGTCAGTCTCTCTGATATTTGAAGAGAGAGATGGCGAGTTTGGTTGCTGCTCTTGGGCTTTCCCTCAAAGCTCAAAGCTTCCCCCTATGAGCAGAAAAACGCACTCTTTGTTTCTAGAAGAAGATCCAAGAAAAAGAACCAATCTTTTGCT.
[0032] In this embodiment, at least two example ASO sequences targeting SGR are provided, including ASO-1 and ASO-2, whose sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively. ASO-1 is inversely complementary to the target sequence (sense, 5′→3′: ATGGCGAGTTTGGTTGCTG) corresponding to positions 31-49 within the target window of the reference sequence shown in SEQ ID NO.1; ASO-2 is inversely complementary to the target sequence (sense, 5′→3′: CCTTGGGCTTTCCCTCAA) corresponding to positions 50-68 within the target window of the reference sequence shown in SEQ ID NO.1.
[0033] In a further preferred embodiment, an alternative candidate sequence ASO-3 is also provided, the sequence of which is shown in SEQ ID NO.4; wherein, ASO-3 is inversely complementary to the target sequence (sense, 5′→3′: CGCACTCTTTGTTTCTAGA) corresponding to the 100-118th site within the target window of the reference sequence shown in SEQ ID NO.1.
[0034] The above SEQ ID NO.2 (ASO-1) is: CAGCAACCAAACTCGCCAT
[0035] SEQ ID NO.3 (ASO-2) is: TTGAGGGAAAGCCCAAGAG
[0036] SEQ ID NO.4 (ASO-3) is: TCTAGAAACAAAGAGTGCG
[0037] (4) Preparation of ASO stock solution: The ASO obtained in step (3) can be prepared by oligonucleotide chemical synthesis (e.g., solid-phase phosphoramide method) and provided in the form of lyophilized powder or solution; in this embodiment, it is obtained in the form of lyophilized powder. When using, the lyophilized ASO powder is dissolved in sterile ultrapure water under sterile conditions to prepare an ASO stock solution of 200 μmol / L; then it is diluted with sterile citrate-sodium citrate buffer (10 mmol / L, pH 5.8) at a ratio of 1:50 (v / v) to prepare an ASO working solution of 4 μmol / L, and then desalted by dialysis with a 0.5-1.0 kDa dialysis membrane, and stored at 4 ℃ in the dark for later use, preferably avoiding repeated freeze-thaw cycles.
[0038] (5) Preparation of EV-loaded ASO lime treatment solution (EV-ASO complex system): The ASO used in this embodiment is ASO-1 (SEQ ID NO.2), which is used as a representative ASO targeting SGR mRNA for verification; SEQ ID NO.3 (ASO-2) and SEQ ID NO.4 (ASO-3) are designed based on different conserved segments of SGR mRNA according to the same design principle, and can be used interchangeably with reference to the process conditions of this embodiment. At 4 ℃, the EV dispersion obtained in step (2) and the ASO solution obtained in step (4) are mixed at a volume ratio of 3:1 (v / v) (e.g., 300 mL of EV dispersion + 100 mL of ASO solution) to make the final concentration of ASO in the mixed system 1 μmol / L. The mixture is mixed by end-to-end rotational mixing: 4 ℃, 8 rpm, 15 min. Then KCl is added to adjust the ionic strength to promote binding, so that the mixture [K + The concentration of ASO was 10 mmol / L (e.g., 4 mL of 1 mol / L KCl solution was added to a 400 mL system), and then incubated at 4 °C for 90 min to promote the binding and loading of ASO and EV. After incubation, the treatment solution was filtered once through a 0.45 μm PES membrane to reduce the microbial load; then, the stabilizer CMC-Na was added to bring the final concentration to 0.08% (w / v), and the preservative potassium sorbate was added to bring the final concentration to 0.03% (w / v). The pH was adjusted to 5.6 with citric acid. The EV-ASO treatment solution was stored at 4 °C protected from light for later use, and was gently mixed 20 times by inverting before use.
[0039] (6) Fruit treatment and storage: Wash the tested lime fruits with tap water and soak them in 70% ethanol solution for 2 min. Let them air dry naturally before use. Before treatment, place the treatment solution obtained in step (5) in an environment of 12 ℃. At the same time, place the limes to be treated in the same temperature environment for 2 h of pre-equilibrium. During the pre-equilibrium, avoid condensation or free water film on the fruit surface. Before spraying, gently invert and mix the treatment solution 20 times to avoid violent shaking, vortexing or strong shearing. Use a spraying device to spray the lime fruit surface evenly with full coverage. The spraying path moves back and forth in a circle along the equator of the fruit and rotates the fruit in time to ensure uniform liquid reception. The spraying amount per fruit is controlled at 1.0-2.0 mL / fruit, so that the fruit surface is "just wet and does not drip". After spraying, place the fruit in a clean environment and let it stand for 25 min to allow the treatment solution to spread and adhere to the fruit surface and solidify. During the standing period, avoid contact between fruits, squeezing or wiping the fruit surface. After the fruit has settled, it is transferred to a cold storage environment for storage. In this example, the fruit is stored at 4 ℃ and 90% RH. During the cold storage process, the fruit is placed in a single layer or with intervals, and an absorbent pad / drainage paper is laid at the bottom of the box. The condensation points and water accumulation are cleaned regularly to avoid long-term accumulation of local condensation.
[0040] (7) Control and Detection Methods: Four groups were set up: ① Buffer control group (sprayed with an equal volume of 10 mmol / L, pH 5.8 buffer solution); ② EV treatment group (sprayed with EV dispersion only); ③ ASO treatment group (sprayed with ASO-1 (SEQ ID NO.2) solution only, with the final ASO concentration consistent with the EV-ASO group); ④ EV-ASO treatment group (sprayed with EV-ASO treatment liquid only). Approximately 300 fresh limes were treated in each group, and the treatment was independently repeated 3 times. Tests were performed every 2 weeks during storage.
[0041] (a) Peel color: L*, a*, b* were measured using a colorimeter. Three points were measured at equal intervals at the equator for each fruit and the average was taken. The process of fading green was characterized by an increase in a or a decrease in the Hue angle.
[0042] (b) Chlorophyll content: Take a pericarp sample from the equatorial region, cut it into small pieces, weigh 0.50 g, add 10 mL of 80% acetone and extract in the dark (incubate at 4 ℃ for 30-60 min by standing or shaking), centrifuge and take the supernatant to determine A. 663 With A 645 Calculate chlorophyll a and chlorophyll b separately, and calculate the total chlorophyll content.
[0043] (c) Target validation: Fruit peel tissue was collected from the same sampling location, flash-frozen in liquid nitrogen, and RNA was extracted. qRT-PCR was then performed to detect the relative expression level of SGR. A 2... -ΔΔCt The method is used for calculation.
[0044] (d) Storage quality: Record indicators such as hardness, soluble solids, titratable acid and decay rate.
[0045] Furthermore, following the same process conditions in this embodiment, EV-ASO treatment was performed by replacing ASO-1 (SEQ ID NO.2) with ASO-2 (SEQ ID NO.3) and ASO-3 (SEQ ID NO.4), respectively. The results showed no significant differences among the three ASO treatment groups in key greening indicators such as color difference parameters (a*, Hue) and total chlorophyll content (p > 0.05), and all three groups effectively inhibited the greening process of lime fruits under cold storage conditions. By comparing the changes in color difference parameters, chlorophyll content, and SGR expression in each treatment group, the inhibitory effect of EV-ASO treatment on the greening process of limes and its impact on storage quality were evaluated, thereby verifying the greening effect and feasibility of this invention in the postharvest fruit peel delivery scenario.
[0046] First, particle characterization was performed on the EV dispersion and the EV-ASO composite system (Table 1). The results showed that both systems had narrow particle size distributions (PDI ≤ 0.30) during 30 weeks of storage at 4℃, and the particle concentration and equivalent EV protein content remained within the effective range. The particle size of the EV-ASO composite system was slightly larger than that of the EV dispersion, indicating that ASO had successfully bound to EV to form a composite system. Second, the binding efficiency of ASO and the removal efficiency of free ASO were tested (Table 2). The binding efficiency of ASO to EV reached 81.7%, and the removal rate of free ASO reached 76.5%, indicating that the process described in this invention can effectively achieve EV loading of ASO and remove unbound free ASO. Furthermore, the stability of ASO in the naked ASO and EV-ASO treatment solutions at 4℃ was compared (Table 3). Naked ASO degraded rapidly with storage time, with a residual rate of only 11.64% after 30 weeks. In contrast, the ASO content in the EV-ASO system remained at 38.92% after 30 weeks. The protection factor of EV for ASO increased continuously from the initial 1.01 times to 3.34 times after 30 weeks, indicating that EV significantly improved the stability of ASO under long-term cold storage conditions. Finally, the ASO retention in the peel tissue after spraying was measured (Table 4). The ASO retention in the peel of the EV-ASO group was 2.60 times that of the single ASO group, and the retention rate after washing reached 86.0% (compared to 73.8% in the single ASO group), indicating that EV significantly improved the retention level of ASO in the peel tissue and its resistance to washing.
[0047] As shown in Tables 5-6, during storage at 4 ℃, the peel of the control group showed significant fading over time, characterized by a decrease in the absolute value of a* and a continuous decline in Hue. Simultaneously, the contents of chlorophyll a, chlorophyll b, and total chlorophyll were significantly reduced. After 30 weeks of storage at 4 ℃, the fruit had essentially turned yellow, losing the characteristic bright green appearance of limes and significantly decreasing its marketability. Compared to the control group, the EV treatment group showed similar overall trends in color parameters (L*, a*, b*, Hue), chlorophyll a / b, and total chlorophyll content, indicating that EV itself had little effect on protecting the green color of the fruit. The ASO treatment group significantly delayed fading in the later stages of storage, characterized by a smaller decrease in a*, a higher level of Hue, and a significantly higher retention of total chlorophyll than the control group, indicating that ASO had a practical effect on inhibiting fading. EV delivery significantly enhances the green-preserving effect of ASO. After 30 weeks of storage, the EV-ASO treated group achieved a Hue angle of 122.1 and a total chlorophyll content of 10.18 mg / gFW, significantly higher than the ASO-only treatment group. Taking chlorophyll retention rate as an example, the control group was 20.7%, the EV-only group was 22.4%, and the ASO-only group was 44.9%. After deducting the baseline from the control, the sum of the two was expected to be approximately 46.6%; however, the measured EV-ASO group reached 84.6%, significantly higher than the expected sum, indicating that EV and ASO produced a significant synergistic effect under the process described in this invention, rather than a simple additive effect. Therefore, the treated fruit can maintain a bright green appearance and high marketability for a longer period, making it suitable for storage, preservation, and distribution.
[0048] like Figure 2 As shown, the EV-loaded ASO treatment solution exhibited the most significant inhibitory effect on the ClSGR gene in lime fruits stored at 4 ℃, followed by the ASO group. The EV group and the control group were similar, indicating that compared with the single ASO treatment, EV-delivered ASO had a more significant inhibitory effect on ClSGR gene expression. This molecular-level inhibitory effect is highly consistent with the phenotypic-level greening effects shown in Tables 5 and 6, jointly demonstrating the mechanism of action of this invention in inhibiting SGR expression, delaying chlorophyll degradation, and maintaining the green color of the peel through EV-delivered ASO.
[0049] Table 1. Particle characterization results of EV and EV-ASO composite systems
[0050]
[0051] Table 2. ASO binding efficiency and free ASO removal effect of EV-ASO composite system
[0052]
[0053] Table 3. Comparison of stability between bare ASO and EV-ASO treated solutions at 4 °C.
[0054]
[0055] Table 4. Comparison of ASO retention in lime peel tissue after spraying
[0056]
[0057] Table 5. Experimental results on the effects of EV-loaded ASO treatment on the peel color and quality of lime fruit during storage at 4 ℃.
[0058]
[0059] Sig indicates a significant difference, with a significance threshold of p < 0.05. ns indicates no significant difference. The ASO used in both the ASO treatment group and the EV-ASO treatment group was ASO-1 (SEQ ID NO. 2).
[0060] Table 6. Experimental results showing the effect of EV-loaded ASO treatment solution on chlorophyll content in lime peel during storage at 4 ℃.
[0061]
[0062] Sig indicates a significant difference, with a significance threshold of p < 0.05. The ASO used in both the ASO treatment group and the EV-ASO treatment group was ASO-1 (SEQ ID NO. 2).
Claims
1. A method for postharvest greening of fresh lime fruit based on delivery of antisense oligonucleotides via autologous extracellular vesicles, wherein the lime is lemon (Citrus limon), characterized in that, Includes the following steps: (1) Preparation of EV stock solution from autologous plant: Lime endocarp tissue was taken and homogenized at 4 ℃ at a ratio of tissue mass to pre-cooled homogenate volume of 1:10-1:15 (w / v); the obtained homogenate was centrifuged at 4 ℃ to remove large particles, cell debris and organelle residues, and the supernatant was collected; the supernatant was filtered through 0.45 μm and 0.22 μm microporous membranes in sequence, and the filtrate was separated, purified / enriched for EV to obtain crude EV precipitate; the crude EV precipitate was resuspended and washed to obtain concentrated EV stock solution; (2) Preparation of EV dispersion: Using food-grade citric acid-sodium citrate buffer as the dispersion medium, add the protective component and add the EV concentrated mother liquor obtained in step (1) to it and mix well to obtain EV dispersion; (3) Preparation of antisense oligonucleotide ASO solution targeting SGR: antisense oligonucleotide ASO was designed and synthesized using the homologous gene of SGR as a reference sequence, and ASO solution was prepared by dissolving the lyophilized ASO powder in sterile ultrapure water. (4) Preparation of lime treatment solution with EV loaded with ASO: Mix the EV dispersion obtained in step (2) with the ASO solution obtained in step (3) to make ASO and EV fully contact to form an EV-ASO composite system and obtain the treatment solution; (5) Fruit treatment and storage: The treatment liquid is sprayed evenly on the surface of the lime fruit in a spraying manner, and after standing to allow the treatment liquid to spread and adhere, it is transferred to a cold storage environment for storage to delay the greening of the peel.
2. The method for postharvest greening of fresh lime fruit based on the delivery of antisense oligonucleotides by autologous extracellular vesicles according to claim 1, characterized in that: The homogenate in step (1) is a food-grade citric acid-sodium citrate buffer solution with a concentration of 5-20 mmol / L and a pH of 5.5-6.2; the 0.45 μm and 0.22 μm microporous membranes are low-protein adsorption membrane materials; the resuspension is performed using sterile citric acid-sodium citrate buffer solution.
3. The method for postharvest greening of fresh lime fruit based on the delivery of antisense oligonucleotides by autologous extracellular vesicles according to claim 1, characterized in that: The differential centrifugation conditions described in step (1) are: 500-1000 g, 5-10 min; 2000-5000 g, 5-15 min; 10000-15000 g, 15-30 min; The separation, purification / enrichment process employs ultracentrifugation sedimentation. The ultracentrifugation conditions are 100,000 g for 70-120 min to obtain a coarse EV precipitate. The coarse EV precipitate is then resuspended and washed once with 100,000 g for 70-120 min.
4. The method for postharvest greening of fresh lime fruit based on the delivery of antisense oligonucleotides by autologous extracellular vesicles according to claim 1, characterized in that: The protective components mentioned in step (2) include trehalose and mannitol, wherein the concentration of trehalose is 1-3% (w / v) and the concentration of mannitol is 0.5-2% (w / v).
5. The method for postharvest greening of fresh lime fruit based on the delivery of antisense oligonucleotides by autologous extracellular vesicles according to claim 1, characterized in that: The EV dispersion in step (2) also includes food-grade wetting and dispersing component lecithin, with a lecithin dosage of 0.001-0.005% (w / v); the EV addition amount is standardized according to particle concentration or equivalent protein content, with an EV particle concentration of 1×10⁻⁶. 10 -1×10 12 particles / mL, or equivalent EV protein amount of 50-300 μg / mL.
6. The method for postharvest greening of fresh lime fruit based on the delivery of antisense oligonucleotides by autologous extracellular vesicles according to claim 1, characterized in that: The ASO in step (3) is 18-20 nt in length and has a GC content of 40-60%, avoiding ≥4 consecutive identical bases; the ASO is selected from the sequence shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.
4.
7. The method for postharvest greening of fresh lime fruit based on the delivery of antisense oligonucleotides by autologous extracellular vesicles according to claim 1, characterized in that: The preparation of ASO solution in step (3) further includes preparing an ASO stock solution with a concentration of 100-200 μmol / L by using ASO lyophilized powder and sterile ultrapure water. After desalting, the ASO stock solution is diluted with a sterile buffer system to obtain an ASO working solution with a concentration of 1-10 μmol / L. The desalting process is dialysis desalting, and the dialysis membrane has a molecular weight cutoff of 0.5-1.0 kDa. The sterile buffer system is a 5-20 mmol / L citrate-sodium citrate buffer solution with a pH of 5.5-6.
2.
8. The method for postharvest greening of fresh lime fruit based on the delivery of antisense oligonucleotides by autologous extracellular vesicles according to claim 1, characterized in that: Step (4) specifically includes mixing the EV dispersion and ASO solution end-to-end by rotary mixing or roller mixing at 4 ℃. End-to-end rotary mixing is performed at 6-12 rpm for 10-20 min, and roller mixing is performed at 8-15 rpm for 20-30 min. After mixing, KCl is added to adjust the ionic strength to promote binding and loading, so that the [K] in the mixed system... + The concentration was 5-15 mmol / L; then it was incubated at 4 °C for 60-120 min; filtered through a 0.45 μm microporous membrane; after filtration, sodium carboxymethyl cellulose stabilizer was added at a concentration of 0.05-0.1% (w / v).
9. The method for postharvest greening of fresh lime fruit based on the delivery of antisense oligonucleotides by autologous extracellular vesicles according to claim 8, characterized in that: Add potassium sorbate as a preservative at a concentration of 0.01-0.05% (w / v) and adjust the pH of the system to 5.3-5.
8.
10. A method for postharvest greening of fresh lime fruit based on the delivery of antisense oligonucleotides via autologous extracellular vesicles, as described in any one of claims 1-9, characterized in that: The final concentration of ASO in the mixed system in step (4) is 0.2-3.3 μmol / L; the volume ratio of EV dispersion to ASO solution is 2:1-4:1 (v / v).
11. An EV-ASO treatment solution for post-harvest greening of fresh lime, wherein the lime is lemon (Citrus limon), characterized in that: Prepared by steps (1) to (4) of the method according to any one of claims 1-10, comprising autologous plant extracellular vesicles (EVs) derived from the endocarp tissue of lime, antisense oligonucleotides (ASOs) targeting SGR, and a food-grade citrate-sodium citrate buffer system, wherein the EVs and the ASOs form an EV-ASO complex system; wherein the concentration of the buffer system is 5-20 mmol / L and the pH is 5.5-6.2; and the concentration of the EV particles is 1×10⁻⁶. 10 -1×10 12 The particle / mL or equivalent EV protein amount is 50-300 μg / mL; the final concentration of ASO is 0.2-3.3 μmol / L; the mixing volume ratio of EV to ASO is 2:1-4:1 (v / v).